Výukový materiál zpracován v rámci projektu EU peníze školám

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Výukový materiál zpracován v rámci projektu EU peníze školám"

Transkript

1 Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ; ISSN Provozuje Národní ústav pro vzdělávání, školské poradenské zařízení a zařízení pro další vzdělávání pedagogických pracovníků (NÚV). Registrační číslo projektu: CZ.1.07/1.5.00/ Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: SZdŠ a OA Rumburk, Františka Nohy 6, , Rumburk Šablona: III/2 - Základy genetiky VY_32_INOVACE_121

2

3 Johann Gregor Mendel: autor teorie dědičnosti ( ) přírodovědec, zakladatel genetiky a objevitel základních zákonů dědičnosti působil jako mnich a později opat augustiniánského kláštera na Starém Brně v klášterní zahradě konal pokusy s řadou rostlin, především používal hrách setý

4 Mendelovy zákony dědičnosti: shrnují pravidla, která se uplatňují při dědičnosti znaků 1. Mendelův zákon: všichni příslušníci první filiální generace (F1) jsou v daném znaku stejní = uniformita F1 hybridů = zákon o uniformitě F1 generace (1. filiální = první generace potomků) 2. Mendelův zákon: kříží-li se příslušníci F1 mezi sebou, F2 není jednotná (druhá filiální generace) objevují se v ní znaky obou rodičů = štěpení znaků v generaci F Mendelův zákon: zákon o volné kombinovatelnosti alel s výjimkou genů ve vazbě

5 charakteristika: křížení dvou jedinců, při němž sledujeme dědičnost pouze jednoho znaku = jednoho páru alel dohodnuté symboly P - rodičovská generace, linie (parentální) G - pohlavní buňky, gamety s alelami genu x - symbol křížení F - generace potomků F1 - hybrid, kříženec (první filiální linie) F2 - kříženci hybridů F1, generaci F2 vytvoříme vzájemným křížením potomků z generace F1 A - velké písmeno pro dominantní alelu (dominantní alela se píše jako první) a - malé písmeno pro alelu recesivní

6 charakteristika: křížení dvou stejných homozygotů křížení dvou různých homozygotů křížení homozygota s heterozygotem křížení dvou heterozygotů

7 křížení dvou stejných homozygotů, možnost A - dominance: A A A AA AA A AA AA dominantní homozygoti = dominantní alela = modré květy výsledek křížení - jedinci F1 generace jsou uniformní (stejní) mluvíme o čisté linii

8 křížení dvou stejných homozygotů, možnost B - recese: a a a aa aa a aa aa recesivní homozygoti = recesivní alela = bílé květy výsledek křížení - jedinci F1 generace jsou uniformní (stejní) mluvíme o čisté linii

9 křížení dvou různých homozygotů: A A a Aa Aa a Aa Aa alela = modré květy (dominantní homozygot) alela = bílé květy (recesivní homozygot) výsledek křížení: potomstvo je stejné - všechny květy budou modré - dominance alely A všichni heterozygoti mluvíme o uniformitě F1 hybridů (1. Mendlův zákon)

10 1. křížení dominantního homozygota s heterozygotem: A a A AA Aa A AA Aa alela alela = modré květy = bílé květy výsledek křížení: homozygoti i heterozygoti jsou zastoupeni v poměru 1:1 všechny květy modré - dominantní A

11 2. křížení recesivního homozygota s heterozygotem: A a a Aa aa a Aa aa alela alela = modré květy = bílé květy výsledek křížení: homozygoti i heterozygoti jsou zastoupeni v poměru 1:1 50% modré květy 50% bílé květy

12 křížení heterozygotů - úplná dominance: A a A AA Aa a Aa aa alela alela = modré květy = bílé květy výsledek křížení: 1 x AA 2 x Aa 1 x aa i a jsou fenotypově stejní - budou mít modré květy, odlišuje se jen genotyp - bílý květ genotypový štěpný poměr je 1 : 2 : 1 fenotypový štěpný poměr je tedy 3 : 1

13 křížení heterozygotů - neúplná dominance: A a A AA Aa a Aa aa alela alela = modré květy = bílé květy výsledek křížení: 1 x 2 x - vzniklí heterozygoti Aa vykazují znaky, které jsou někde uprostřed mezi znaky obou rodičů = recesivní alela se také částečně projeví 1 x genotypový štěpný poměr je 1 : 2 : 1 fenotypový š. poměr je tedy 1 : 2 : 1

14

15 cvičení: u rajčat je alela řídící normální vzrůst rostliny dominantní nad alelou pro zakrslost jaký vzrůst budou vykazovat kříženci získaní hybridizací homozygotních rostlin normálního a zakrslého vzrůstu? jací budou kříženci v generaci F2?

16 cvičení - generace F1 - postup: doplň alely do tabulky (je jasné, že budeme křížit dva různé homozygoty) alela = homozygotní rostlina normálního vzrůstu (normální vzrůst rostliny je dominantní nad alelou pro zakrslost) alela = homozygotní rostlina zakrslého vzrůstu (pro doplnění klikni)

17 cvičení - generace F1 - postup: a a A A proveď křížení (pro doplnění klikni)

18 cvičení - generace F1 - výsledek: A A a Aa Aa a Aa Aa potomstvo je stejné - všechny rostlinky budou normálního vzrůstu - dominance alely A všichni heterozygoti mluvíme o uniformitě F1 hybridů (1. Mendlův zákon) úkol č. 2: vytvoř generaci F2 za předpokladu úplné i neúplné dominance

19 cvičení - generace F2, úplná dominance - postup: doplň alely do tabulky (je jasné, že budeme křížit dva heterozygoty, kteří vzešli z generace F1) alela = normální vzrůst alela = zakrslý růst (pro doplnění klikni)

20 cvičení - generace F2, úplná dominance - postup: A a A a proveď křížení (pro doplnění klikni)

21 cvičení - generace F2, úplná dominance - výsledek: A a A AA Aa a Aa aa 1 x AA (homozygot) 2 x Aa (heterozygoti) 1 x aa (homozygot) i a jsou fenotypově stejní - budou normálního vzrůstu, odlišuje se jen genotyp - zakrslá rostlina genotypový štěpný poměr je 1 : 2 : 1 fenotypový štěpný poměr je tedy 3 : 1

22 cvičení - generace F2, neúplná dominance - postup: doplň alely do tabulky (je jasné, že budeme křížit dva heterozygoty, kteří vzešli z generace F1) postup doplnění a křížení je shodný s předchozím úkolem, rozdíl bude ve výsledku!) alela = normální vzrůst alela = zakrslý růst (pro doplnění klikni)

23 cvičení - generace F2, neúplná dominance - postup: A a A a proveď křížení (pro doplnění klikni)

24 cvičení - generace F2, neúplná dominance - výsledek: A a A AA Aa a Aa aa 1 x - normální vzrůst 2 x - vzniklí heterozygoti Aa vykazují znaky, které jsou někde uprostřed mezi znaky obou rodičů = recesivní alela se také částečně projeví 1 x - zakrslý vzrůst genotypový štěpný poměr je 1 : 2 : 1 fenotypový š. poměr je tedy 1 : 2 : 1

25 Materiál slouží k objasnění pojmu monohybridismus, k charakteristice Mendlových zákonů dědičnosti a praktické aplikaci monohybridismu a Mendlových zákonů. Probírané pojmy: monohybridismus, Mendlovy zákony, hybrid, kříženec, homozygot, heterozygot, dominantní alela, recesivní alela. Obsahuje cvičné úlohy.

26 HANČOVÁ, H., VLKOVÁ, M. Biologie v kostce I. Praha. Fragment ISBN HANČOVÁ, H., VLKOVÁ, M. Biologie v kostce, přepracované vydání Praha. Fragment ISBN kol. autorů. Odmaturuj z biologie. Brno. Didaktis ISBN ODSTRČIL, J. Biologie. Brno. NCONZO ISBN

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v

Více

Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského

Více

Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat

Více

Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u

Více

GENETIKA A JEJÍ ZÁKLADY

GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

Zvyšování kvality výuky technických oborů

Zvyšování kvality výuky technických oborů Zvyšování kvality výuky technických oborů Klíčová aktivita V.2 Inovace a zkvalitnění výuky směřující k rozvoji odborných kompetencí žáků středních škol Téma V.2.18 Dřeviny Kapitola 2 Rozmnožování rostlin

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností

Více

Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):

Více

Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus

Více

S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

RURGenetika zápočtový program Programování II

RURGenetika zápočtový program Programování II RURGenetika zápočtový program Programování II Rudolf Rosa cvičící: Doc. RNDr. Pavel Töpfer, CSc. Obsah Specifikace...1 Původní specifikace...1 Upravená specifikace...2 Program...3 třída Populace...4 Datové

Více

GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

GENETIKA V MYSLIVOSTI

GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností

Více

Velká rodina života. mlha se zvedá

Velká rodina života. mlha se zvedá Úvod Jen málo národů a lidských pospolitostí na Zemi nemá svůj mýtus o stvoření. Američtí Irokézové věřili, že svět a všechno v něm stvořili nebeští lidé, podle starověkých Japonců byl svět výtvorem bohů,

Více

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that

Více

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

Druhová a mezidruhová hybridizace

Druhová a mezidruhová hybridizace Druhová a mezidruhová hybridizace Obsah Druhová a mezidruhová hybridizace... 1 Obsah... 1 Monohybridní křížení... 1 Dihybridní křížení... 2 Polyhybridní křížení... 3 Souhrn Mendelismus v dědičnosti kvalitativních

Více

Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu

Více

Škola: Střední škola obchodní, České Budějovice, Husova 9. Inovace a zkvalitnění výuky prostřednictvím ICT

Škola: Střední škola obchodní, České Budějovice, Husova 9. Inovace a zkvalitnění výuky prostřednictvím ICT Škola: Střední škola obchodní, České Budějovice, Husova 9 Projekt MŠMT ČR: EU PENÍZE ŠKOLÁM Číslo projektu: CZ.1.07/1.5.00/34.0536 Název projektu školy: Výuka s ICT na SŠ obchodní České Budějovice Šablona

Více

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou

Více

Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským

Více

CZ.1.07/1.5.00/34.0378 Zefektivnění výuky prostřednictvím ICT technologií III/2 - Inovace a zkvalitnění výuky prostřednictvím ICT

CZ.1.07/1.5.00/34.0378 Zefektivnění výuky prostřednictvím ICT technologií III/2 - Inovace a zkvalitnění výuky prostřednictvím ICT Autor: Mgr. Barbora Blažková Tematický celek: Základy ekologie Cílová skupina: 1. ročník SŠ Anotace Pracovní list navazuje na prezentaci, která seznámila žáky se základními projevy živé hmoty, definicí

Více

13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu

Více

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická

Více

1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,

Více

ŠKOLNÍ VZDĚLÁVACÍ PROGRAM

ŠKOLNÍ VZDĚLÁVACÍ PROGRAM Vyučovací předmět : Období ročník : Učební texty : Přírodopis 3. období 9. ročník Danuše Kvasničková, Ekologický přírodopis pro 9. ročník ZŠ a nižší ročníky víceletých gymnázií, nakl. Fortuna Praha 1998

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Vznik a vývoj života na Zemi

Vznik a vývoj života na Zemi Vznik a vývoj života na Zemi Vznik a vývoj života na Zemi VY_32_INOVACE_02_03_01 Vytvořeno 11/2012 Tento materiál je určen k doplnění výuky předmětu. Zaměřuje se na vznik života na Zemi. Cílem je uvědomit

Více

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické

Více

Škola: Gymnázium, Brno, Slovanské náměstí 7 III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: Inovace výuky na GSN

Škola: Gymnázium, Brno, Slovanské náměstí 7 III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: Inovace výuky na GSN Škola: Gymnázium, Brno, Slovanské náměstí 7 Šablona: III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: Inovace výuky na GSN prostřednictvím ICT Číslo projektu: CZ.1.07/1.5.00/34.0940

Více

Ě ÁÁ Ú é é ý ů ý ů é ý ů é é ú Ž ý ů é ů é é Ě ÁÁ Ú é Ý ž ý ž ý ý ů ž ů ň é Ž ý Ž ů ý é é é é ý ž Í Ě ÁÁ Ú é é ň é Ž ý ž Ž Í ý é ý Í ů ý ý ý é ý é ý é ň Ž Ž Ě ÁÁ Ú é é ý Ý é é ý Ž Í Í é ž Í Ž Ě ÁÁ Ú é

Více

Sylabus kurzu: Biologie

Sylabus kurzu: Biologie Sylabus kurzu: Biologie Výchozí úroveň studentů: Vědomosti z biologie na gymnaziální úrovni Cílová úroveň studentů: Cílem je zopakovat a prohloubit vědomosti v oblasti biologie nabyté na gymnáziu, případně

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u

Více

Gymnázium, Brno, Slovanské nám. 7, WORKBOOK - Biology WORKBOOK. http://agb.gymnaslo.cz. Student:

Gymnázium, Brno, Slovanské nám. 7, WORKBOOK - Biology WORKBOOK. http://agb.gymnaslo.cz. Student: WORKBOOK http://agb.gymnaslo.cz Subject: Teacher: Student: Biology Iva Kubištová.. School year:../ This material was prepared with using Topics: 1. 2. 3. 4. 5. 6. 7. 8. Mendelian Inheritance, Population

Více

genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto

Více

ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a

Více

Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje

Více

Rukověť genetiky pro chovatele potkanů

Rukověť genetiky pro chovatele potkanů Rukověť genetiky pro chovatele potkanů Příručka pro chovatele, kteří by se rádi dozvěděli, jak celá ta věc funguje Bc. Markéta Čacká Praha, 2013 Verze určená pro čtečky (optimalizováno na Kindle 3) OBSAH

Více

Tematický plán učiva BIOLOGIE

Tematický plán učiva BIOLOGIE Tematický plán učiva BIOLOGIE Třída: Prima Počet hodin za školní rok: 66 h 1. POZNÁVÁME PŘÍRODU 2. LES 2.1 Rostliny a houby našich lesů 2.2 Lesní patra 2.3 Živočichové v lesích 2.4 Vztahy živočichů a rostlin

Více

Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého

Více

PRAKTIKUM Z OBECNÉ GENETIKY

PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie lizal@sci.muni.cz 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní

Více

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH RÁMCOVÝ VZDĚLÁVACÍ PROGRAM PRO ZÍSKÁNÍ SPECIALIZOVANÉ ZPŮSOBILOSTI v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH 1. Cíl specializačního vzdělávání Cílem specializačního vzdělávání

Více

Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem

Více

11.12.2011 Brno - Lužánky Základy genetiky pro chovatele potkanů

11.12.2011 Brno - Lužánky Základy genetiky pro chovatele potkanů 11.12.2011 Brno - Lužánky Základy genetiky pro chovatele potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou

Více

OLYMPIÁDA MLADÝCH CHOVATELŮ 2015

OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 Genetika a plemenné znaky u králíků Chov králíků, II. Kategorie Johana Vinšová *13. 8. 1997 Žabonosy 113, Kolín 2, 280 02 ZO ČSCH Kolín 1 Práce započata dne: 25. 11. 2014

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

ZDRAVOTNICKÝ ASISTENT. 1. ročník (denní studium)

ZDRAVOTNICKÝ ASISTENT. 1. ročník (denní studium) 1. ročník (denní studium) Předmět Autoři Nakladatelství Název učebnice cena asi Anglický j. Odb. latinská terminologie New English File - Elementary 1. ročník 269,- Somatologie Rokyta, Turková Eurolex

Více

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních

Více

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním

Více

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít?

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Základy genetiky Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Johann Gregor Mendel (1822 1884) O jeho životě byl mnich, zakladatel genetiky a opat augustiniánského kláštera v Brně studium

Více

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina Přehled GMH Seminář z biologie GENETIKA Molekulární genetika Základní dogma molekulární biologie Základním nosičem genetické informace je molekula DNA. Tato molekula se může replikovat (kopírovat). Informace

Více

OBECNÁ GENETIKA. Gen ást DNA, schopná funkn zabezpeit syntézu aktivní jednotky. Genotyp soubor gen, uruje rozsah a míru fenotypových možností

OBECNÁ GENETIKA. Gen ást DNA, schopná funkn zabezpeit syntézu aktivní jednotky. Genotyp soubor gen, uruje rozsah a míru fenotypových možností GENETIKA A ŠLECHTNÍ Ivana Gardiánová Katedra genetiky a šlechtní OBECNÁ GENETIKA Genetika nauka o ddinosti a promnlivosti živých organism Ddinost schopnost organism penést znaky a vlastnosti na potomstvo

Více