Genetický polymorfismus

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Genetický polymorfismus"

Transkript

1 Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci alespoň 1%. Uvedené vymezení pojmu genetický polymorfismus znamená, že sem nepatří znaky, kde má zřídkavá varianta frekvenci menší než 1% (tj. např. geneticky podmíněné choroby), dále znaky, jejichž variabilita není podmíněná geneticky (infekční choroby), znaky s kontinuální variabilitou (tělesná hmotnost, výška) a konečně znaky, kde se v rámci druhu vyskytují různé varianty, avšak v různých navzájem oddělených populacích (barva kůže aj.). V posledním případě se jedná o interpopulační variabilitu. Genetický polymorfismus naproti tomu tvoří významnou část intrapopulační genetické variability. Široký pojem genetického polymorfismu lze podle objektu studia členit do několika skupin na 1/ polymorfismus DNA, 2/ polymorfismus biochemický, 3/ polymorfismus imunologický, 4/ polymorfismus morfologický. Polymorfismus DNA Jak vyplývá ze závěrů uvedených v kapitole popisující mutace, má každá genetická variabilita svůj podklad ve variabilitě na úrovni DNA. To platí pro každou variabilitu detekovatelnou na fenotypové úrovni, tedy i pro biochemický, imunologický a morfologický polymorfismus, pro bodové, chromosomální i genomové mutace. Ve fenotypu se však projeví jen malá část variability DNA. Tato skutečnost je způsobená zejména tím, že exony kódujících genů tvoří jen malou část, řádově několik procent celkové genomové DNA, zbytek připadá na nekódující sekvence vč. intronů. Fenotypově se však neprojeví i taková změna exonu, která díky degeneraci genetického kódu nevede k záměně aminokyseliny. Na úrovni DNA tedy existuje velké množství polymorfismů, jejichž detekce je možná jen metodami molekulární genetiky. 1/ bodový polymorfismus Tento typ je způsoben změnou v sekvenci bazí, nejčastěji bodovou mutací (většinou záměna nukleotidu nebo delece několika bazí) v určitém místě DNA. Odhaduje se, že u eukaryot je polymorfní přibližně každý 500. nukleotid v kódujících sekvencích DNA a každý 50. v nekódujících sekvencích. Prakticky je bodový polymorfismus detekován jako polymorfismus délky restrikčních fragmentů RFLP (restriction fragment length polymorphism). Příčinou RFLP je, že změna i jen jedné báze v sekvenci cílového místa restrikční endonukleázy může vést k tomu, že restriktáza dvoušroubovici DNA neštěpí. Mnohem jednodušší je úsek namnožený v polymerázové řetězové reakci následně štěpit restriktázou, která rozezná záměnu v sekvenci bazí. Na chromozomu, na kterém není přítomné cílové místo zůstane fragment delší, při gelové elektroforéze migruje pomaleji:

2 A B 1.chromozom 2.chromozom C 1.chromozom 2.chromozom start elektroforéza A B C LEGENDA restrikční místo přítomné chybí primery

3 V poslední době je bodový polymorfismus označován jako SNP (single nucleotide polymorphism) a je analyzován za použití přístrojové techniky. Takto definované polymorfní místo se chová jako mendelisticky děděný gen s kodominantní dědičností, jednotlivé varianty se vyskytují s určitou frekvencí, která se může v různých populacích lišit. 2/ repetitivní sekvence V DNA se vyskytují sekvence jednotkové a repetitivní. Jednotkové jsou v genómu přítomny v jedné nebo několika málo kopiích. Patří sem geny, okrajové sekvence a spacery. Jako repetitivní se označují sekvence, které se v genómové DNA vyskytují v mnoha kopiích. V posledních letech je velmi intenzívně sledován výskyt satelitů. Satelity přítomné na určitém místě v genómu mohou mít v rámci populace různý počet opakujících se bází, různou délku. Tyto varianty se chovají jako mendelisticky děděné geny. Mikrosatelity jsou tvořeny 2-6 bázemi. Schematické znázornění mikrosatelitu 1. chromozóm CACACACACACA ACACACACACAC 2. chromozóm CACACA ACACAC primery (CA) n mikrosatelitní repetitivní motiv Praktické využití polymorfismu DNA Polymorfismus DNA, v poslední době zejména výskyt mikrosatelitních sekvencí v genómu, má možné praktické využití. Pomocí hybridizace in situ je možné lokalizovat mikrosatelitní lokus na chromozom a připravit tak dostatečně vysycenou genetickou mapu. V posledních letech byly vypracovány metodiky pro ověřování rodičovství nebo pro identifikaci osob (soudní lékařství) pomocí mikrosatelitů. Princip spočívá v tom, že potomek může mít ve svém genotypu jen takové alely, které mohl získat od svých rodičů. Spolehlivost této metody je díky vysokému polymorfismu mikrosatelitů velmi vysoká. K uvedeným účelům lze rovněž použít techniku nazývanou fingerprinting. Její princip spočívá na rozštěpení genomové DNA restriktázou, hybridizaci se sondou, tvořenou vhodným repetitivním motivem a elektroforéze na gelu. Jednotlivci se od sebe liší délkou naštěpených fragmentů.

4 Biochemický polymorfismus Podstatou biochemického polymorfismu je výskyt několika strukturně nebo funkčně odlišných variant jednoho proteinu, jehož syntéza je řízena z jednoho lokusu. Jako příklad lze uvést hemoglobin. Existují čtyři základní typy hemoglobinových řetězců α, β, γ a δ, které se odlišují v primární struktuře a předpokládá se tedy, že každý je determinován vlastním strukturním genem. V řetězci β se může vyskytnout odchylka v primární struktuře, místo kyseliny glutamové je v defektním řetězci valin. Tato varianta se označuje HbS, u recesívních homozygotů podmiňuje srpkovitou anémii. Tato choroba je značně rozšířena zejména ve střední a západní Africe a poměrně často končí letálně. Heterozygoti HbA/HbS v běžných podmínkách neonemocní, avšak choroba se může projevit při pobytu ve vyšších nadmořských výškách. Polymorfních variant primární struktury hemoglobinu bylo dosud zjištěno více než 250, pouze malá část z nich však podmiňuje patologické stavy. Při systematickém popisu se tedy pod pojmem "polymorfní systém" rozumí všechny varianty konkrétního proteinu, je označován zkratkou (hemoglobin - Hb). "Polymorfní varianta" je označována většinou velkými písmeny, např. HbA, HbB. "Polymorfní typ" je kombinace polymorfních variant v rámci každého polymorfního systému, např. HbAA, HbAB, HbBB. Polymorfní typ je zároveň fenotypem. "Genotyp" - každá polymorfní varianta je většinou podmíněna jednou alelou, která se označuje zkratkou systému a označením alely horním indexem Hb A, Hb B. Genotyp se označuje zlomkem Hb A /Hb B apod. Variabilita proteinů je dána změnami v jejich primární struktuře, počtem prostetických skupin, velikostí a celkovým uspořádáním molekuly, změnami ve velikosti elektrického náboje. Medicínsky nejzávažnějším typem biochemického polymorfismu je chybění enzymu, což v řadě případů způsobuje závažná onemocnění. Nejčastějším typem genetické determinace biochemického polymorfismu je kodominance. Populačně-genetické aspekty biochemického polymorfismu Mechanismem, který umožnil vznik polymorfismu proteinů tj. způsobem udržení mutací vzniklé alely v populaci může být selekce - podle této teorie je hlavní příčinou polymorfismu selekce zvýhodňující heterozygoty. Tento mechanismus je možný v případě, že mutací dochází ke změně funkčnosti nebo množství genového produktu. Genetický drift - působí náhodně zejména v menších populacích, podléhají mu všechny alely bez ohledu na charakter změny, ke které dochází u výsledného genového produktu. Existuje vztah mezi některými enzymatickými polymorfismy a ekologickými podmínkami. Jako velmi známý příklad uvedeme vztah mezi srpkovitou anémií a malárií. Jak již bylo uvedeno, je srpkovitá anemie u velké části homozygotů letální. Heterozygotní nositelé patologické alely HbA/HbS jsou však odolní proti malárii. V oblastech s vysokým výskytem malárie, v primitivních podmínkách bez možnosti její účinné léčby došlo proto k fixaci

5 srpkovité anémie v populaci. V tomto a podobných případech je udržování polymorfismu selekcí spojeno se ztrátou homozygotů. Polymorfní proteiny u člověka a řady živočišných druhů byly zjištěny v séru, erytrocytech, spermiích, v semenné plazmě, mozkomíšním moku, játrech, mléce aj., vyskytují se také u rostlin. Praktický význam biochemického polymorfismu: Polymorfismus proteinů lze využít k mapování genomu a konstrukci chromozomových map, k tomuto účelu se však v poslední době využívá více polymorfismu DNA. Lze jej využít při ověřování paternity. Morfologický polymorfismus Morfologické znaky mají většinou multifaktoriální etiologii. Řadí se sem např. dermatoglyfická variabilita, využívaná v kriminalistice. Charakter papilárních linií je tak vysoce individuální, že neexistují dva lidé se stejnými otisky prstů. Základní příčina této variability je v různém genotypu, fenotyp je však do určité míry korigován vlivem vnějších faktorů v první třetině gravidity. Proto nejsou absolutně shodné ani otisky prstů jednovaječných dvojčat, i když jejich odlišnosti jsou minimální. Kontrolní otázky 1/ vymezte pojem genetický polymorfismus 2/ jaké je členění genetického polymorfismu 3/ proč nelze velkou část DNA polymorfismů detekovat ve fenotypu? 4/ charakterizujte princip a příčinu bodového polymorfismu 5/ charakterizujte podstatu polymorfismu způsobeného repetitivními sekvencemi 6/ co je podstatou biochemického polymorfismu 7/ jaký je nejčastější typ genetické determinace biochemického polymorfismu 8/ čím se zabývá imunogenetika 9/ charakterizujte pojem antigen, protilátka 10/ jaké znáte imunokompetentní buňky, popište stručně imunitní odpověď 11/ popište ABO a Rh systémy u lidí 12/ charakterizujte význam histokompatibilních antigenů

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního

Více

MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta

MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Určování a ověřování paternity u koní. Bakalářská práce Brno 2006 Vedoucí bakalářské

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

polymorfní = vícetvarý, mnohotvárný

polymorfní = vícetvarý, mnohotvárný Genetický polymorfismus s Řeckyy morphos = tvar polymorfní = vícetvarý, mnohotvárný Genetický polymorfismus je tedy označení pro výskyt téhož znaku ve více tvarech, formách, přičemž tato mnohotvárnost

Více

Populační genetika II

Populační genetika II Populační genetika II 4. Mechanismy měnící frekvence alel v populaci Genetický draft (genetické svezení se) Genetický draft = zvýšení frekvence alely díky genetické vazbě s výhodnou mutací. Selekční vymetení

Více

Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí,

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí, Využití molekulárních markerů v systematice a populační biologii rostlin 12. Shrnutí, Přehled molekulárních markerů 1. proteiny isozymy 2. DNA markery RFLP (Restriction Fragment Length Polymorphism) založené

Více

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

14. přednáška z BIOLOGIE pro Bakaláře studující fyzioterapii, optometrii a pro nutriční terapeuty M.Gabriel, BÚ LF MU

14. přednáška z BIOLOGIE pro Bakaláře studující fyzioterapii, optometrii a pro nutriční terapeuty M.Gabriel, BÚ LF MU 14. přednáška z BIOLOGIE pro Bakaláře studující fyzioterapii, optometrii a pro nutriční terapeuty Genová diagnostika. 4. 1. 2012 M.Gabriel, BÚ LF MU Pojem alela. Geny existují v různých formách a mohou

Více

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,

Více

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray

Více

Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická

Více

MOLEKULÁRNÍ TAXONOMIE - 4

MOLEKULÁRNÍ TAXONOMIE - 4 MOLEKULÁRNÍ TAXONOMIE - 4 V této přednášce si představíme metody, které získávají molekulární znaky bez použití sekvenace. Všechny tyto metody je teoreticky možné sekvenací nahradit. Oproti sekvenaci celých

Více

JIHOČESKÁ UNIVERZITA V ČESKÝCH BUDĚJOVICÍCH ZEMĚDĚLSKÁ FAKULTA

JIHOČESKÁ UNIVERZITA V ČESKÝCH BUDĚJOVICÍCH ZEMĚDĚLSKÁ FAKULTA JIHOČESKÁ UNIVERZITA V ČESKÝCH BUDĚJOVICÍCH ZEMĚDĚLSKÁ FAKULTA Studijní program: Studijní obor: Zadávající katedra: Vedoucí katedry: B4131 Zemědělství Agroekologie Katedra zootechnických a veterinárních

Více

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin Část Molekulární biologie a imunologie 6. Základy dědičnosti Mendelovská dědičnost (autozomálně recesivní, autozomálně dominantní a X-vázaný přenos mutací). Nemendelovská dědičnost (uniparentální disomie,

Více

GENETIKA V MYSLIVOSTI

GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností

Více

Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat

Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Genetické markery ve studiu genetické diverzity v populacích hospodářských zvířat Bakalářská

Více

Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny

Více

ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a

Více

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o.

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o. Genetické markery ve šlechtění skotu pro masnou produkci Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Genetické markery Polymorfní místa v DNA, které vykazují asociaci na sledované znaky Příčinné

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní

Více

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu

Více

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno urban@mendelu.cz htt://www.mendelu.cz/af/genetika/ Seminář doktorského grantu 53/03/H076 : Molekulárn

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010

Více

TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE

TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy

Více

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů Imunogenetika Vědní odvětví zabývající se imunitním systémem obratlovců, který je výrazně odlišuje od nižších organizmů se nazývá imunologie. Její náplní je zejména studium imunity mechanizmů stálosti

Více

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH RÁMCOVÝ VZDĚLÁVACÍ PROGRAM PRO ZÍSKÁNÍ SPECIALIZOVANÉ ZPŮSOBILOSTI v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH 1. Cíl specializačního vzdělávání Cílem specializačního vzdělávání

Více

Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)

Více

Genetické mapování. v přírodních populacích i v laboratoři

Genetické mapování. v přírodních populacích i v laboratoři Genetické mapování v přírodních populacích i v laboratoři Funkční genetika Cílem je propojit konkrétní mutace/geny s fenotypem Vzniklý v laboratoři pomocí mutageneze či vyskytující se v přírodě. Forward

Více

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická

Více

Genetický screening predispozice k celiakii

Genetický screening predispozice k celiakii VETERINÁRN RNÍ A FARMACEUTICKÁ UNIVERZITA BRNO Farmaceutická fakulta Ústav humánn nní farmakologie a toxikologie Genetický screening predispozice k celiakii RNDr. Ladislava Bartošov ová,ph.d. 1, PharmDr.

Více

PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ

PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ 10 SEZNAM PŘÍLOH PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ PŘÍLOHA č. 2 MAPY Mapa 1 Lokalizace zájmového území (zdroj: Mapy.cz) Mapa 2 Místa odlovených nebo uhynulých kusů (zdroj:

Více

Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219.

Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219. Vzdělávací materiál vytvořený v projektu OP VK Název školy: Gymnázium, Zábřeh, náměstí Osvobození 20 Číslo projektu: Název projektu: Číslo a název klíčové aktivity: CZ.1.07/1.5.00/34.0211 Zlepšení podmínek

Více

Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u

Více

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících

Více

Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Genetické markery - princip a využití

Genetické markery - princip a využití Genetika a šlechtění lesních dřevin Genetické markery - princip a využití Doc. Ing. RNDr. Eva Palátová, PhD. Ing. R. Longauer, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován

Více

Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u

Více

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae).

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). Populační studie Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). American Journal of Botany 87(8): 1128

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku)

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) B I O L O G I E 1. Definice a obory biologie. Obecné vlastnosti organismů. Základní klasifikace organismů.

Více

Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

b) Jak se změní sekvence aminokyselin v polypeptidu, pokud dojde v pozici 23 k záměně bázového páru GC za TA (bodová mutace) a s jakými následky?

b) Jak se změní sekvence aminokyselin v polypeptidu, pokud dojde v pozici 23 k záměně bázového páru GC za TA (bodová mutace) a s jakými následky? 1.1: Gén pro polypeptid, který je součástí peroxidázy buku lesního, má sekvenci 3'...TTTACAGTCCATTCGACTTAGGGGCTAAGGTACCTGGAGCCCACGTTTGGGTCATCCAG...5' 5'...AAATGTCAGGTAAGCTGAATCCCCGATTCCATGGACCTCGGGTGCAAACCCAGTAGGTC...3'

Více

Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů

Více

Lze HCM vyléčit? Jak dlouho žije kočka s HCM? Je možné předejít hypertrofické kardiomyopatii?

Lze HCM vyléčit? Jak dlouho žije kočka s HCM? Je možné předejít hypertrofické kardiomyopatii? Nemoci srdce jsou, stejně jako u člověka, vrozené nebo získané v průběhu života. Ze získaných chorob srdce tvoří velkou část kardiomyopatie, což je onemocnění srdečního svalu spojené s jeho dysfunkcí,

Více

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení

Více

BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů.

BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů. BARVY BORDER COLLIÍ Barva psí srsti je dána geneticky. Pro všechny border collie (snad až na vzácné výjimky) platí, že ve své genetické výbavě nesou alelu Si, která determinuje irské zbarvení (bílé znaky)

Více

velké fragmenty střední fragmenty malé fragmenty

velké fragmenty střední fragmenty malé fragmenty velké fragmenty střední fragmenty malé fragmenty Southern 1975 Northern Western denaturace DNA hybridizace primerů (annealing) (mají délku kolem 20 bází) syntéza nové DNA termostabilní polymerázou vstup

Více

Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální

Více

Výukový materiál zpracovaný v rámci projektu Výuka modern

Výukový materiál zpracovaný v rámci projektu Výuka modern St ední pr myslová škola strojnická Olomouc, t. 17. listopadu 49 Výukový materiál zpracovaný v rámci projektu Výuka modern Registrační číslo projektu: CZ.1.07/1.5.00/34.0205 Šablona: III/2 P írodov dné

Více

BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc.

BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. BAKTERIÁLNÍ GENETIKA Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. -dědičnost u baktérií principiálně stejná jako u komplexnějších organismů -genom haploidní a značně menší Bakteriální genom

Více

Efektivní velikost populace Wright (1931)

Efektivní velikost populace Wright (1931) Efektivní velikost populace Wright (1931) - velikost populace z genetického hlediska nemusí být rovna censu, někteří jedinci mohou zanechat potomků více, jiní se rozmnožování nezúčastní vůbec - to má dopad

Více

Modul IB. Histochemie. CBO Odd. histologie a embryologie. MUDr. Martin Špaček

Modul IB. Histochemie. CBO Odd. histologie a embryologie. MUDr. Martin Špaček Modul IB Histochemie CBO Odd. histologie a embryologie MUDr. Martin Špaček Histochemie Histologická metoda užívaná k průkazu různých látek přímo v tkáních a buňkách Histochemie Katalytická histochemie

Více

Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

Variabilita v pigmentaci

Variabilita v pigmentaci Variabilita v pigmentaci Proč zkoumat pigmentaci Spojitost s rakovinou kůže reakcí na UV záření výživou geografickým původem metabolismem vitamínu D. Oči Pigmentace Pokožka Vlasy Měření pigmentace Neinvazivní

Více

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Dle čl. 7 odst. 2 Směrnice děkana pro realizaci bakalářských

Více

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902

Více

Genotypování markerů užitkovosti a zdraví u skotu

Genotypování markerů užitkovosti a zdraví u skotu Mezinárodní odborný seminář Využití chovatelských dat onemocnění skotu pro management stád, šlechtění a pro racionální užívání antimikrobik. Genotypování markerů užitkovosti a zdraví u skotu Jitka Kyseľová

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky

Více

Molekulární základy dědičnosti. Ústřední dogma molekulární biologie Struktura DNA a RNA

Molekulární základy dědičnosti. Ústřední dogma molekulární biologie Struktura DNA a RNA Molekulární základy dědičnosti Ústřední dogma molekulární biologie Struktura DNA a RNA Ústřední dogma molekulární genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace DNA RNA

Více

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční

Více

Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci

Více

Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100% F8 - hemofilie A monogenní

Více

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp.

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp. BIOLOGICKÉ LISTY 68 (3): 207-211, 2003 Způsoby detekce polymorfismu homologních DNA a jejich využití při studiu změn ve struktuře rodičovských genomů u modelových allotetraploidních druhů rodu Nicotiana

Více

1. Úvod do genetických algoritmů (GA)

1. Úvod do genetických algoritmů (GA) Obsah 1. Úvod do genetických algoritmů (GA)... 2 1.1 Základní informace... 2 1.2 Výstupy z učení... 2 1.3 Základní pomy genetických algoritmů... 2 1.3.1 Úvod... 2 1.3.2 Základní pomy... 2 1.3.3 Operátor

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou

Více

Duchenneova/Beckerova svalová dystrofie a Parent Project

Duchenneova/Beckerova svalová dystrofie a Parent Project Duchenneova/Beckerova svalová dystrofie a Parent Project Oddělení lékařské genetiky FN Brno Renata Gaillyová Vzácné nemoci V EU se nemoc považuje za vzácnou, jestliže postihuje méně než 5 osob z každých

Více