Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC"

Transkript

1 Analýza DNA

2 Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace, které se vyskytují v populaci s frekvencí vyšší než 1% podobnost DNA mezi druhy organismů koncentraci, čistotu, chemické vazby s proteiny, funkci a mnoho dalších vlastností ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

3 DNA izolace detekce DNA specifické analýzy DNA struktury hlavní metody pro práci s DNA: PCR sekvenace RFLP DNA hybridizace - blotting

4 PCR polymerase chain reaction Nobelova cena za její objev v roce 1984 obdoba DNA replikace, která se odehrává v buňkách amplifikace (zmnožení) vybraných úseků DNA u oblasti, kterou se snažíme amplifikovat musíme znát sekvenci koncových částí cyklické střídání těchto teplotních kroků: denaturace dvoušroubovice se oddělí na jednotlivá vlákna (vliv teploty či chemických činidel) annealing (čti anýlink) ke koncové oblasti vybraného úseku se přiloží primery (cca 20bp dlouhé oligonukleotidy jednovláknovéřetězce) elongace prodloužení primeru vkládáním jednotlivých dntp (A,G,C,T) podle komplementarity k templátové DNA primer

5 Princip PCR Teplotní denaturace Annealing primerů Elongace Teplotní denaturace Annealing primerů Elongace

6 PRINCIP METODY PCR (1 MOLEKULA) DENATURACE 1. CYKLUS PRIMERY Taq POLYMERÁZA (2 MOLEKULY) DENATURACE PRIMERY 2. CYKLUS Taq POLYMERÁZA (4 MOLEKULY) 3. CYKLUS DENATURACE PRIMERY Taq POLYMERÁZA (8 MOLEKUL) 4. CYKLUS (16 MOLEKUL) 5. CYKLUS (32 MOLEKUL)

7 PCR v reakci: templát (DNA), Taq-polymeráza (teplotně stabilní), primery, dntp (jednotlivé nukleotidy) a vhodný pufr z jednoho cílového lokusu pro dané primery vznikne po 1 cyklu denaturace, annealingu a elongace vždy dvojnásobek DNA fragmentů (velikost fragmentu je dána primery) možno vyjádřit matematicky 2 n kde n je počet cyklů Kolik bude DNA fragmentů po 8 PCR cyklech? 2 8 = 256

8 Elektroforéza metoda, která slouží k rozdělení naamplifikovaných DNA fragmentů o nestejné délce DNA má celkově slabě negativní náboj a v elektrickém poli putuje ke kladné elektrodě rychlost putování je závislá na její celkové délce gel (agaróza, polyakrylamid) je ponořen do vhodného pufru mezi elektrody v gelu u záporné elektrody jsou jamky, do kterých se dává vzorek DNA pustí se elektrický proud po čase se fragmenty rozdílných délek rozdělí vizualizace fragmentů se provádí například ethidiumbromidem (interkalačníhočinidla), které svítí v UV světle

9 Sekvenace zjištění konkrétní sekvence vybraného úseku DNA řetězce Sangerova metoda s použitím chemicky modifikovaných dntp ddntp (dideoxynukleotidy) do PCR reakce se dá: produkt předchozí PCR, primer z jedné strany, pufr, polymeráza a mix normálních dntp a značených ddntp za ddntp si při elongaci už nemůže přisednout žádný normální nukleotid a dojde tedy k terminaci elongace při vhodných podmínkách sekvenační PCR se syntetizujířetězce všech možných velikostí ddntp jsou fluorescenčně značené (každý nukleotid A,G,T,C jinak) a při specifické elektroforéze udávají sekvenci DNA řetězce

10 Sekvenace - Sanger AAGTCCGATCGTTAGCTTCCGAATTGCATGGCAACTGCAGATCGATGCAAGTGCCGATC TTCAGGCTAGCAATCGAAGGCTTAACGTACCGTTGACGTCTAGCTACGTTCACGGCTAG začne probíhat sekvenační PCR s mixem dntp a fluoresčenčně značenými ddntp AAGTCCGATCGTTAGCTTC AAGTCCGATCGTTAGCTTCC AAGTCCGATCGTTAGCTTCCG AAGTCCGATCGTTAGCTTCCGA AAGTCCGATCGTTAGCTTCCGAA AAGTCCGATCGTTAGCTTCCGAAT AAGTCCGATCGTTAGCTTCCGAATT AAGTCCGATCGTTAGCTTCCGAATTG AAGTCCGATCGTTAGCTTCCGAATTGC nejkratší fragment ve schématu bude svítit červenou barvou a nejdelší takéčervenou speciální elektroforéza s laserovou detekcí fluorescenčně barvených ddntp

11 Restrikční endonukleázy - restriktázy enzymy, které štípou dvouvláknovou molekulu DNA uvnitřřetězce a to vždy v konkrétní pozici, charakteristické pro danou restriktázu např. Eco R1 restriktáza izolovaná z Escherichia coli, která specificky štípe v sekvenci G^AATTC AATGCTAATGCCTAGTCAAGCTTTCATCGAGAATTCCAGTCGAA TTAGCTTTACGGATCAGTTCGAAAGTAGCTCTTAAGGTCAGCTT AATGCTAATGCCTAGTCAAGCTTTCATCGAG TTAGCTTTACGGATCAGTTCGAAAGTAGCTCTTAA AATTCCAGTCGAA GGTCAGCTT

12 Identifikace restrikčních míst m Na a uvedeném m vlákn kně najděte restrikční místa pro nabídnut dnuté enzymy restrikční místo Alu I Sau 3AI Msp I AG / CT / GTAC C / CGG 5 G.G.G.C.G.T.A.C.A.T.A.G.C.T.A.A.T.G.G.C.A.A.G.C.T.A.T.G.G.T. 3 8

13 RFLP restriction fragment length polymorphism charakteristické fragmenty pro každého jedince po naštípání celkové DNA restriktázami jednotlivé cílové sekvence vybraných restriktáz mohou být mutovány, nebo v rámci jiných delecí/inzercí posunuty každý člověk má proto charakterictické rozložení restrikčních míst pro určitou restriktázu (restrikční mapy) Mendelovská dědičnost délky restrikčních fragmentů EcoRI štípání fragmentů 2 jedinců AGAATTCGCCGATCGATCGATCGATCGATCGATCGATCGATTGAGCTCGAATTCC AGAATTCGCCGATCGATCGATCGATCGATCGATCGATCGATCGATTGAGCTCGAATTCC na elektroforéze bude mít druhý jedinec delší fragment

14 RFLP restriction fragment length polymorphism

15 Southern - blotting jméno po objeviteli Southernovi v doslovném překladu pijákování tzn. nasátí PCR produktů z elektroforetického gelu na membránu (nylonovou) a jejich následná analýza hybridizace = spojení dvou jednovláknových DNA podle pravidla komplementarity gel se denaturuje v chemickém činidlu tím se denaturuje i dvouvláknová DNA a na membránu jsou blottována jen jednořetězcová vlákna a to v takovém uspořádání, v jakém byla na elektroforetickém gelu následuje hybridizace s radioaktivně značenou próbou membrána je ponořena do roztoku s jednovláknovým radioaktivně značeným řetězcem DNA na základě komplementarity buď dojde nebo nedojde k hybridizaci nenavázaná próba je odmyta v případě úspěšné hybridizace svítí na membráně v určité oblasti dvoušroubovice tvořená jedním vláknem ze studované DNA a jedním vláknem próby umožňuje z velkého množství fragmentů podobných délek (např. po štěpení celkové DNA restrikčními endonukleázami) specificky detekovat DNA fragment

16 Southern - blotting

17 Southern blot hybridizace sondy DNA Sonda Zahřátí (denaturace) Ochlazení (renaturace) 12

18 Fenylketonurie defekt genu pro fenylalanin hydroxylázu (PAH) AR onemocnění PAH 13 exonů mnoho mutací (více než 400 známých v roce 2000) Fenylketonurie

19 PAH gen Mutace - např. delece v 2. exonu detekce systémem restrikční endonukleázy (viz obrázek) Při negativním výsledku vyšetření jednoho exonu vyšetření mutací v dalších exonech

20 RFLP metoda Autosomálně recesivní onemocnění (např. cystická fibróza, fenylketonurie) Vyšetření je informativní Druhá dcera má genotyp Aa

21 RFLP prenatáln lní vyšet etření Fenylketonurie - AR A) B) Vyšetření je informativní Plod heterozygot - zdravý

22 RFLP metoda Polycystická choroba ledvin - AD Vyšetření je informativní Druhá dcera má genotyp aa

23 RFLP metoda GR onemocnění hemofilie (obdobné pro barvoslepost) Dcera zdravá Genotyp X + X h Přenašečka

24 Polymorfismy lidské DNA využívan vané ve vazebné analýze, přímé a nepřímé diagnostice Mikrosatelity (syn. krátké tandemové repetice) STR short tandem repeats, SSR simple sequence repeats TAGCCATCGGTACACACACACACACACAGTGCTTCAGTAGC TAGCCATCGGTACACACACACACAGTGCTTCAGTAGCGTAG Pokud se detekovatelný polymorfismus nachází dostatečně blízko lokusu, ve kterém se vyskytuje kauzální mutace pro sledovanou chorobu, bude tento polymorfismus ve vazbě s mutovanou alelou a ve většině případů bude současně s ní předáván z rodičů na potomky (kosegregace) a bude možné jej využít jako marker i bez znalosti molekulární podstaty daného onemocnění. 3

25 Polymorfismus typu (CA) n Variabilní místa mikrosatelitů (STRP short tandem repeat polymorphism) Mapování lidského genomu, nepřímá diagnostika Vysoká variabilita vysoká informativita (v rodinách je 80 % heterozygotů v CA repeticích) Vazebné mapy lidského genomu 2-3 tisíce STRP FAP AD onemocnění Gen APC ( tumor-supresor) leží v oblasti 5q21: v rodině s výskytem FAP byl pomocí PCR vyšetřen polymorfismus (CA) n v lokusu D5S346, který leží kb za APC genem na základě tohoto vyšetření bylo posouzeno nosičství mutované alely

26 Polymorfismus typu (CA) n I 1 2 II III alely

27 DNA čipy - microarrays moderní metoda analýzy DNA v několika lokusech současně genovéčipy obsahují velké množství sond, které hybridizují s různými oblastmi genomu rovněž využívá hybridizace využití nanotechnologií manipulace se vzorky probíhá převážně roboticky a vyhodnocení je softwarové

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika

Více

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních

Více

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární

Více

Genetické markery - princip a využití

Genetické markery - princip a využití Genetika a šlechtění lesních dřevin Genetické markery - princip a využití Doc. Ing. RNDr. Eva Palátová, PhD. Ing. R. Longauer, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi

Více

Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky

Více

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční

Více

Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů

Více

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou

Více

MOLEKULÁRNÍ TAXONOMIE - 4

MOLEKULÁRNÍ TAXONOMIE - 4 MOLEKULÁRNÍ TAXONOMIE - 4 V této přednášce si představíme metody, které získávají molekulární znaky bez použití sekvenace. Všechny tyto metody je teoreticky možné sekvenací nahradit. Oproti sekvenaci celých

Více

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION VYUŽITÍ AUTOMATICKÉHO SEKVENOVÁNÍ DNA PRO DETEKCI POLYMORFISMŮ KANDIDÁTNÍCH GENŮ U PRASAT Vykoukalová Z., Knoll A.,

Více

Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace

Více

14. přednáška z BIOLOGIE pro Bakaláře studující fyzioterapii, optometrii a pro nutriční terapeuty M.Gabriel, BÚ LF MU

14. přednáška z BIOLOGIE pro Bakaláře studující fyzioterapii, optometrii a pro nutriční terapeuty M.Gabriel, BÚ LF MU 14. přednáška z BIOLOGIE pro Bakaláře studující fyzioterapii, optometrii a pro nutriční terapeuty Genová diagnostika. 4. 1. 2012 M.Gabriel, BÚ LF MU Pojem alela. Geny existují v různých formách a mohou

Více

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,

Více

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin

Více

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace

Více

Elektroforéza Sekvenování

Elektroforéza Sekvenování Elektroforéza Sekvenování Výsledek PCR Elektroforéza V molekulární biologii se používá k separaci nukleových kyselin a bílkovin Principem je pohyb nabitých molekul v elektrickém poli Gelová, polyakrylamidová

Více

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR)

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace Genetické markery Genetické markery

Více

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Fyzické mapování Fyzické kontigové mapy Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s konstrukcí

Více

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí,

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí, Využití molekulárních markerů v systematice a populační biologii rostlin 12. Shrnutí, Přehled molekulárních markerů 1. proteiny isozymy 2. DNA markery RFLP (Restriction Fragment Length Polymorphism) založené

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního

Více

Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE POHLED Z LABORATOŘE Petra Hedvičákov ková ÚBLG FN Motol Odd. lékal kařské molekulárn rní genetiky MZO 00064203 23.-24.5.2008

Více

Příprava rekombinantních molekul pro diagnostické účely

Příprava rekombinantních molekul pro diagnostické účely 1 Příprava rekombinantních molekul pro diagnostické účely doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 2 Obsah přednášky 1) Pojem rekombinantní DNA 2) Historické milníky

Více

Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip

Více

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky.

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

variabilita genomu bottleneck Nature Science

variabilita genomu bottleneck Nature Science variabilita genomu Nature Science genetická diverzita člověka na úrovni SNP je nízká: asi 0.1% cca. 90% variace je uvnitř populací cca. 10% mezi populacemi (kontinenty) bottleneck personal genomes James

Více

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta

MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Určování a ověřování paternity u koní. Bakalářská práce Brno 2006 Vedoucí bakalářské

Více

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem

Více

Molekulární základy dědičnosti. Ústřední dogma molekulární biologie Struktura DNA a RNA

Molekulární základy dědičnosti. Ústřední dogma molekulární biologie Struktura DNA a RNA Molekulární základy dědičnosti Ústřední dogma molekulární biologie Struktura DNA a RNA Ústřední dogma molekulární genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace DNA RNA

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902

Více

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100% F8 - hemofilie A monogenní

Více

Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace

Více

Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor

Více

První testový úkol aminokyseliny a jejich vlastnosti

První testový úkol aminokyseliny a jejich vlastnosti První testový úkol aminokyseliny a jejich vlastnosti Vysvětlete co znamená pojem α-aminokyselina Jaký je rozdíl mezi D a L řadou aminokyselin Kolik je základních stavebních aminokyselin a z čeho jsou odvozeny

Více

Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Sekvenování nové generace. Radka Reifová

Sekvenování nové generace. Radka Reifová Sekvenování nové generace Radka Reifová Prezentace ke stažení www.natur.cuni.cz/zoologie/biodiversity v záložce Přednášky 1. Přehled sekvenačních metod nové generace 2. Využití sekvenačních metod nové

Více

TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE

TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY ELEKTROFORÉZA K čemu to je? kritérium čistoty preparátu stanovení molekulové hmotnosti makromolekul stanovení izoelektrického

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

velké fragmenty střední fragmenty malé fragmenty

velké fragmenty střední fragmenty malé fragmenty velké fragmenty střední fragmenty malé fragmenty Southern 1975 Northern Western denaturace DNA hybridizace primerů (annealing) (mají délku kolem 20 bází) syntéza nové DNA termostabilní polymerázou vstup

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní

Více

Genetická kartografie

Genetická kartografie Genetická kartografie Vazba U klasického dihybridismu podle Johanna Gregora Mendela segregují různé alely dvou genů nezávisle. Rekapitulace dihybridismu je na obrázku 8.1. Toto schéma platí jen pro lokusy

Více

Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní

Více

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková Diagnostika retrovirů Lentiviry - HIV Vladislava Růžičková VI. Třída RNA-viry se zpětnou transkriptázou RT Čeleď: Retroviridae (hostitelé: Obratlovci) Rody: Alpharetrovirus Betaretrovirus Gammaretrovirus

Více

REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK

REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK Molekulární základy dědičnosti - rozšiřující učivo REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK REPLIKACE deoxyribonukleové kyseliny (zdvojení DNA) je děj, při kterém se tvoří z jedné dvoušoubovice DNA dvě nová

Více

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.

Více

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno urban@mendelu.cz htt://www.mendelu.cz/af/genetika/ Seminář doktorského grantu 53/03/H076 : Molekulárn

Více

ALLELE FREQUENCY OF KIT GENE ASSOCIATED WITH TOBIANO SPOTTING PATTERN IN PAINT HORSE BREED

ALLELE FREQUENCY OF KIT GENE ASSOCIATED WITH TOBIANO SPOTTING PATTERN IN PAINT HORSE BREED ALLELE FREQUENCY OF KIT GENE ASSOCIATED WITH TOBIANO SPOTTING PATTERN IN PAINT HORSE BREED FREKVENCE ALEL GENU KIT ASOCIOVANÉHO SE STRAKATOSTÍ TOBIANO U KONÍ PLEMENE PAINT HORSE Chalupová P., Déduchová

Více

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob PGD preimplantační genetická diagnostika zahrnuje soubor technik, které se používají pro zjištění

Více

Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů

Více

Genotypování markerů užitkovosti a zdraví u skotu

Genotypování markerů užitkovosti a zdraví u skotu Mezinárodní odborný seminář Využití chovatelských dat onemocnění skotu pro management stád, šlechtění a pro racionální užívání antimikrobik. Genotypování markerů užitkovosti a zdraví u skotu Jitka Kyseľová

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

Univerzita Pardubice. Fakulta chemicko-technologická. Využití NGS pro identifikaci jedinců- nástupce STR. Kostelníková Eva

Univerzita Pardubice. Fakulta chemicko-technologická. Využití NGS pro identifikaci jedinců- nástupce STR. Kostelníková Eva Univerzita Pardubice Fakulta chemicko-technologická Využití NGS pro identifikaci jedinců- nástupce STR Kostelníková Eva Bakalářská práce 2017 Prohlášení Prohlašuji, že jsem bakalářskou práci na téma: využití

Více

Metody molekulární biologie v rostlinné ekologii a systematice

Metody molekulární biologie v rostlinné ekologii a systematice Protokoly a návody pro praktikum Metody molekulární biologie v rostlinné ekologii a systematice Laboratoř molekulární biologie rostlin, PřF JCU, Branišovská 31, České Budějovice 2008, Miroslava Herbstová,

Více

Klonování gen a genové inženýrství

Klonování gen a genové inženýrství Klonování gen a genové inženýrství Genové inženýrství užite né termíny Rekombinantní DNA = DNA, ve které se nachází geny nejmén ze dvou zdroj, asto ze dvou zných druh organism Biotechnologie = manipulace

Více

Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2 http://www.paternityexperts.com/basicgenetics.html

Více

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

GENETIKA. zkoumá dědičnost a proměnlivost organismů

GENETIKA. zkoumá dědičnost a proměnlivost organismů GENETIKA zkoumá dědičnost a proměnlivost organismů Dědičnost: schopnost organismů uchovávat informace o své struktuře a funkčních schopnostech a předávat je svým potomkům Proměnlivost (variabilita) je

Více

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat

Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Využití sekvenování pro vyhledávání polymorfizmu DNA Diplomová práce Vedoucí práce:

Více

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp.

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp. BIOLOGICKÉ LISTY 68 (3): 207-211, 2003 Způsoby detekce polymorfismu homologních DNA a jejich využití při studiu změn ve struktuře rodičovských genomů u modelových allotetraploidních druhů rodu Nicotiana

Více

Enzymy používané v molekulární biologii

Enzymy používané v molekulární biologii Enzymy používané v molekulární biologii Rozdělení enzymů 1. Podle substrátové specifity: většina metod molekulární biologie je závislá na použití enzymů, jejichž substrátem jsou nukleové kyseliny. Tyto

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

Environmentální aplikace molekulární biologie

Environmentální aplikace molekulární biologie Environmentální aplikace molekulární biologie Petra Jančová, Kristýna Maršálková, Jana Šerá, Hana Pištěková Ústav Inženýrství Ochrany Životního Prostředí, Fakulta Technologická, Univerzita Tomáše Bati

Více

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Přehled Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymerasa Princip procesu PCR Optimalizace PCR Typy PCR Aplikace

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více