Studium genetické predispozice ke vzniku karcinomu prsu

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Studium genetické predispozice ke vzniku karcinomu prsu"

Transkript

1 Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie (doc. Pohlreich) Ústav biologie a lékařské genetiky, 1. LF UK Odd. biologie nádorové buňky, ÚMG AVČR

2 Karcinom prsu Nejčastější zhoubný nádor u žen Incidence > 120 / žen / rok ~ 5-10% - dědičná forma C50

3 Genetika dědičného karcinomu prsu Analýza 963 rodin z Prahy a okolí ( ) Bez mutace Geny se střední penetrancí (CHEK2, PALB2, ATM, RAD51C, NBN, ) Vysoko-penetrantní geny (BRCA1, BRCA2, p53, PTEN, STK11) Pohlreich P

4 Genetika dědičného karcinomu prsu Analýza 963 rodin z Prahy a okolí ( ) Bez mutace Geny se střední penetrancí (CHEK2, PALB2, ATM, RAD51C, NBN, ) Vysoko-penetrantní geny (BRCA1, BRCA2, p53, PTEN, STK11) Pohlreich P

5 Genetika dědičného karcinomu prsu Analýza 963 rodin z Prahy a okolí ( ) Negativní Geny se střední penetrancí (CHEK2, PALB2, ATM, RAD51C, NBN, ) Vysoko-penetrantní geny (BRCA1, BRCA2, p53, PTEN, STK11)

6 Genetika dědičného karcinomu prsu Necharakterizované predispoziční varianty Privátní mutace v genech s vysokou penetrancí ( BRCAX ) Doposud necharakterizované variace v genech se střední penetrancí (kandidátní geny) Doposud necharakterizované kombinace variant v genech s nízkou penetrancí

7 Genetika dědičného karcinomu prsu Necharakterizované predispoziční varianty Privátní mutace v genech s vysokou penetrancí ( BRCAX ) Doposud necharakterizované variace v genech se střední penetrancí (kandidátní geny) Doposud necharakterizované kombinace variant v genech s nízkou penetrancí

8 Genetika dědičného karcinomu prsu Analýza predispozičních variant GWAS (celogenomové asociační studie) HTS (high throughput sequencing) Mutační analýza genů kódujících proteiny v společných cestách

9 Genetika dědičného karcinomu prsu Analýza predispozičních variant GWAS (celogenomové asociační studie) HTS (high throughput sequencing) Mutační analýza genů kódujících proteiny v společných cestách

10 Genetika dědičného karcinomu prsu Geny pro DNA-reparační proteiny v predispozici ke vzniku karcinomu prsu -H2AX P P Chk2 P P 53BP1 BRIP1 ATM BRCA1 P P MRE11 RAD50 Nbs1 DNA P p53 P CDC25A P CDC25C P BRCA2 PALB2 RAD51 Regulace buněčného cyklu Apoptóza Reparace DNA (reparace DDSB)

11 Genetika dědičného karcinomu prsu Geny pro DNA-reparační proteiny v predispozici ke vzniku karcinomu prsu -H2AX P WIP1 P Chk2 P P 53BP1 BRIP1 ATM BRCA1 P P MRE11 RAD50 Nbs1 DNA P p53 P CDC25A P CDC25C P BRCA2 PALB2 RAD51 Regulace buněčného cyklu Apoptóza Reparace DNA (reparace DDSB)

12 Mutační analýza genu PPM1D (WIP1) WIP1 Gen PPM1D lokalizován na 17q23.2 Monomerní serin-threoninová fosfatáza Defosforylace proteinů zapojených do reparace DNA (včetně ATM, CHEK1/2, -H2AX a p53) Amplifikace lokusu 17q23 v p53 wt nádorech

13 Mutační analýza genu PPM1D (WIP1) Populace pacientů 330 BRCA1/2 wt HBC/HBOC primární soubor 398 BRCA1/2 wt HBC/HBOC konfirmační soubor 450 kontrol bez onkologického onemocnění panel p53 wt buněčných linií 304 pacientů s neselektovaným C18 C20

14 Mutační analýza genu PPM1D (WIP1) Mutační analýza gen PPM1D (6 exonů; amplifikace v 8 fragmentech) e2-6 HRM analýza e1 + susp. HRM vzorky PCR + přímé sekvenování

15 Mutační analýza genu PPM1D (WIP1) Mutační analýza PPM1D v buněčných liniích U2OS: c.1372c>t (p.r458x) WT-GAGATAGCTCGAGAGAAT Mut-... T... WT/p.E I A R E N 458 Mut/p.E I A X - - HCT116: c.1349delt (p.l450x) WT-AGAATTTTTTAGAGGTTT Mut-... AGAGGTTTC WT/p.N F L E V S 450 Mut/p.N F X - - -

16 Kleiblova et al. J Cell Biol 2013 Mutační analýza genu PPM1D (WIP1) Výsledky pacienti

17 Kleiblova et al. J Cell Biol 2013 Mutační analýza genu PPM1D (WIP1) Výsledky pacienti

18 WT/p. A L T L R I 484 Mut/p. A L T X - - WT/p.N F K R T L 535 Mut/p.N F X Mutační analýza genu PPM1D (WIP1) Výsledky pacienti #BRCA380: c.1601_1615del (p.f534x) WT-AACTTTAAAAGGACATTAGAAGAG Mut-... AAGAGTCCAATTCTGGCCCC #CRC32: c.1372c>t (p.r458x) WT-GAGATAGCTCGAGAGAAT Mut-... T... WT/p.N F K R T L E E 534 Mut/p.N X WT/p.E I A R E N 458 Mut/p.E I A X - - #BRCA1855: c.1451t>g (p.l484x) #CRC145: c.1602dupt (p.k535x) WT-AGCCCTGACTTTAAGGAT WT-AACTTTAAAAGGACATTA Mut-... G... Mut-... TAAAAGGACATT

19 WT/p. A L T L R I 484 Mut/p. A L T X - - Mutační analýza genu PPM1D (WIP1) Výsledky pacienti #BRCA1855: c.1451t>g (p.l484x) WT-AGCCCTGACTTTAAGGAT Mut-... G...

20 WT/p. A L T L R I 484 Mut/p. A L T X - - Mutační analýza genu PPM1D (WIP1) Výsledky pacienti 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% WT Het Mut Mozaicismus? #BRCA1855: c.1451t>g (p.l484x) WT-AGCCCTGACTTTAAGGAT Mut-... G...

21 WT/p. A L T L R I 484 Mut/p. A L T X - - Mutační analýza genu PPM1D (WIP1) Výsledky pacienti 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% WT Het Mut Mozaicismus! nenádorová mamární tkáň WT-AGCCCTGACTTTAAGGATACATGA Mut G #BRCA1855: c.1451t>g (p.l484x) WT-AGCCCTGACTTTAAGGAT Mut-... G... karcinom prsu WT-AGCCCTGACTTTAAGGATACATGA Mut G

22 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu Ruark et al. Nature 2013 Kleiblova et al. J Cell Biol 2013

23 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu Ruark et al. Nature 2013 Kleiblova et al. J Cell Biol 2013 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116) c.1372c>t (p.r458x) WT-GAGATAGCTCGAGAGAAT #CRC32: WT-GAGATAGCTCGAGAGAAT U2OS: Mut-... T... Mut-... T... Kleiblova et al. J Cell Biol 2013 Zajkowicz et al. Mol Biol Rep 2013

24 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu 6 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116) Trunkační mutace: gain-of-function alterace - > biologický poločas WIP1 (in vitro) - funkční inaktivace p53 (ztráta G1-S kontrolního bodu) - zvýšená tolerance poškození DNA (?) - kancerogeneze (?) Kleiblova et al. J Cell Biol 2013

25 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu 6 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116) Trunkační mutace: gain-of-function alterace - > biologický poločas WIP1 (in vitro) - funkční inaktivace p53 (ztráta G1-S kontrolního bodu) - zvýšená tolerance poškození DNA (?) - kancerogeneze (?) U pacientů se tyto mutace vyskytují jako mozaiky Ruark et al. Nature 2013; Kleiblova et al. J Cell Biol 2013

26 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu 6 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116) Trunkační mutace: gain-of-function alterace - > biologický poločas WIP1 (in vitro) - funkční inaktivace p53 (ztráta G1-S kontrolního bodu) - zvýšená tolerance poškození DNA (?) - kancerogeneze (?) U pacientů se tyto mutace vyskytují jako mozaiky - Způsob vzniku? - Přenos na další generace? - Klinický význam? Ruark et al. Nature 2013; Kleiblova et al. J Cell Biol 2013

27 Význam mutací genu PPM1D (WIP1) Nejasný mechanizmus a penetrance Negativní Geny se střední penetrancí Geny s vysokou penetrancí

28 Poděkování Ústav biochemie a exp. onkologie, 1. LF UK - Jan Ševčík - Petr Pohlreich - Zdeněk Kleibl Ústav patologie, 1. LF UK - Pavel Dundr Odd. biologie nádorové buňky, ÚMG AVČR - Libor Macůrek - Jan Benada - Soňa Pecháčková - Jiří Bártek The Netherlands Cancer Institute - Indra A. Shaltiel - Emile E. Voest - René H. Medema Grant IGA MZ ČR: NT

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?

Více

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013 Lékařská genetika a onkologie Renata Gaillyová OLG a LF MU Brno 2012/2013 *genetické souvislosti *onkogenetická vyšetření u onkologických onemocnění * genetické vyšetření u hereditárních nádorů *presymptomatické

Více

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii ONKOGENETIKA Spojuje: - lékařskou genetiku - buněčnou biologii - molekulární biologii - cytogenetiku - virologii Důležitost spolupráce různých specialistů při detekci hereditárních forem nádorů - (onkologů,internistů,chirurgů,kožních

Více

Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární

Více

ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen

ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen Dědičný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 genů. Foretová L., Macháčková E. Oddělení epidemiologie a genetiky nádorů, Masarykův onkologický ústav, Brno foretova@mou.cz

Více

Výuka genetiky na Přírodovědecké fakultě MU

Výuka genetiky na Přírodovědecké fakultě MU MASARYKOVA UNIVERZITA Přírodovědecká fakulta Výuka genetiky na Přírodovědecké fakultě MU Jiří Doškař Ústav experimentální biologie, Oddělení genetiky a molekulární biologie 1 V akademickém roce 1964/1965

Více

Přehled výzkumných aktivit

Přehled výzkumných aktivit Přehled výzkumných aktivit ROK 2004 Lenka Zahradová Laboratoř experimentální hematologie a buněčné imunoterapie Oddělení klinické hematologie FNB Bohunice Přednosta: prof. MUDr. M. Penka, CSc. Oddělení

Více

Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

,, Cesta ke zdraví mužů

,, Cesta ke zdraví mužů PREZENTACE VÝSLEDKŮ ŘEŠENÍ PILOTNÍHO PROJEKTU PREVENTIVNÍ PÉČE PRO MUŢE,, Cesta ke zdraví mužů prim. MUDr. Monika Koudová GHC GENETICS, s.r.o.- NZZ, Praha Projekt byl realizován ve dvou etapách: I. etapa

Více

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE POHLED Z LABORATOŘE Petra Hedvičákov ková ÚBLG FN Motol Odd. lékal kařské molekulárn rní genetiky MZO 00064203 23.-24.5.2008

Více

Liga proti rakovině Praha

Liga proti rakovině Praha Liga proti rakovině Praha 22 let činnosti Ligy Prof. MUDr. Zdeněk Dienstbier, DrSc. Tři hlavní dlouhodobé programy: Soustavná informovanost veřejnosti o nádorové prevenci Snaha o zlepšení kvality života

Více

Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený

Více

Epigenetika mění paradigma současné medicíny i její budoucnost

Epigenetika mění paradigma současné medicíny i její budoucnost Epigenetika mění paradigma současné medicíny i její budoucnost pokračování z čísla 1 a 2 /2014 Epigenetika v onkologii MUDr. Jozef Čupka Společnost všeobecného lékařství ČLS JEP, Sekce preventivní onkologie

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.

Více

Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE

Více

OBOROVÁ RADA BIOCHEMIE A PATOBIOCHEMIE

OBOROVÁ RADA BIOCHEMIE A PATOBIOCHEMIE OBOROVÁ RADA BIOCHEMIE A PATOBIOCHEMIE Předseda: Stanislav Štípek, prof., MUDr., DrSc. Ústav lékařske biochemie a laboratorní disgnostiky 1. LF UK Kateřinská 32, 121 08 Praha 2 tel.: 224 964 283 fax: 224

Více

Inhibitory ATR kinasy v terapii nádorů

Inhibitory ATR kinasy v terapii nádorů Inhibitory ATR kinasy v terapii nádorů J.Vávrová, M Řezáčová Katedra radiobiologie FVZ Hradec Králové UO Brno Ústav lékařské chemie LF Hradec Králové UK Praha Cíl léčby: zničení nádorových buněk zachování

Více

Ondřej Scheinost Nemocnice České Budějovice, a.s.

Ondřej Scheinost Nemocnice České Budějovice, a.s. Ondřej Scheinost Nemocnice České Budějovice, a.s. Nové technologie přelomové období principy technologií klinická použitelnost chips (arrays) sekvenační technologie Důležitost genetických informací i další

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování

Více

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Biologie. Mezipředmětové

Více

DEN OTEVŘENÝCH DVEŘÍ NA ÚMG

DEN OTEVŘENÝCH DVEŘÍ NA ÚMG DEN OTEVŘENÝCH DVEŘÍ NA ÚMG Místo konání: Datum a doba konání: Budova F, Vídeňská 1083, 142 20 Praha 4-Krč 31. 10. 2014 od 9:00 do 16:00 hod. Kontakt pro styk s veřejností: Organizační záležitosti: Leona

Více

Molekulární diagnostika pletencové svalové dystrofie typu 2A

Molekulární diagnostika pletencové svalové dystrofie typu 2A Molekulární diagnostika pletencové svalové dystrofie typu 2A Lenka Fajkusová Centrum molekulární biologie a genové terapie Fakultní nemocnice Brno Pletencové svalové dystrofie (Limb Girdle Muscular Dystrophy

Více

Co to je genetický test?

Co to je genetický test? 12 Co to je genetický test? Vytvořeno podle informačních letáků vypracovaných nemocnicemi Guy's a St. Thomas' Hospital, Londýn. Tato práce byla podpořena projektem Eurogentest v rámci Evropského 6. RP;

Více

Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová

Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR Mgr. Silvie Dudová Centrum základního výzkumu pro monoklonální gamapatie a mnohočetný myelom, ILBIT LF MU Brno Laboratoř experimentální

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100% F8 - hemofilie A monogenní

Více

Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu

Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Srovnal J. 1, Cincibuch J. 2, Cwierkta K. 2, Melichar B. 2, Aujeský R. 3, Vrba R.

Více

TARCEVA klinický registr

TARCEVA klinický registr TARCEVA klinický registr Karcinom pankreatu Stav k datu 10. 4. 2011 Registr Tarceva je podporován výzkumným ý grantem firmy Roche. Česká onkologická společnost Institut biostatistiky a analýz Stav registru

Více

VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CMG CZECH GROUP M Y E L O M A Č ESKÁ MYELOMOVÁ SKUPINA

VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CMG CZECH GROUP M Y E L O M A Č ESKÁ MYELOMOVÁ SKUPINA VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CZECH CMG M Y E L O M A GROUP Č ESKÁ MYELOMOVÁ SKUPINA Zhodnocení spolupráce Přehled molekulárně cytogenetických

Více

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem

Více

Můj život s genetikou

Můj život s genetikou Můj život s genetikou Aneta Mikulášová Molekulární biologie a genetika Přírodovědecká fakulta Masarykova univerzita Univerzitní vzdělávání genetiky 150 roků po Mendelovi Brno, 29. 5. 2015 Studium Molekulární

Více

Patologie a klasifikace karcinomu prostaty, Gleasonův systém. MUDr. Marek Grega. Ústav patologie a molekulární medicíny 2. LF UK a FN v Motole

Patologie a klasifikace karcinomu prostaty, Gleasonův systém. MUDr. Marek Grega. Ústav patologie a molekulární medicíny 2. LF UK a FN v Motole Patologie a klasifikace karcinomu prostaty, Gleasonův systém MUDr. Marek Grega Ústav patologie a molekulární medicíny 2. LF UK a FN v Motole Nádory prostaty v z každé buňky, která vytváří komplexní uspořádání

Více

DNA microarrays Josef Srovnal, Michaela Špenerová, Lenka Radová, Marián Hajdúch, Vladimír Mihál

DNA microarrays Josef Srovnal, Michaela Špenerová, Lenka Radová, Marián Hajdúch, Vladimír Mihál DNA microarrays Josef Srovnal, Michaela Špenerová, Lenka Radová, Marián Hajdúch, Vladimír Mihál Laboratoř experimentální medicíny při Dětské klinice LF UP a FN Olomouc Cíle Seznámit posluchače s: 1. Technologií

Více

seminář ENTOG, 8.10. 2005

seminář ENTOG, 8.10. 2005 Karcinom vaječníků seminář ENTOG, 8.10. 2005 MUDr. Michal Zikán, PhD. Gynekologicko-porodnická klinika 1. LF UK a VFN Ústav biochemie a experimentální onkologie 1. LF UK Incidence 25,3 / 100 000 1323 případů

Více

Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi

Více

Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk. Aleš Hampl

Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk. Aleš Hampl Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk Aleš Hampl Tkáně Orgány Živé buňky, které plní různé funkce (podpora struktury, přijímání živin, lokomoce,

Více

Výroční zpráva Společnosti lékařské genetiky ČLS JEP

Výroční zpráva Společnosti lékařské genetiky ČLS JEP Výroční zpráva Společnosti lékařské genetiky ČLS JEP Členská základna K datu 31.12.2004 byl počet členů Společnosti lékařské genetiky (SLG) celkem 227. Oproti roku 2003 došlo k navýšení o 41 nově přihlášených

Více

2. pražské mezioborové onkologické kolokvium Prague ONCO 2011

2. pražské mezioborové onkologické kolokvium Prague ONCO 2011 Záštitu nad kolokviem převzaly: Evropská onkologická společnost Ministerstvo školství, mládeže a tělovýchovy ČR Ministerstvo zdravotnictví ČR Česká onkologická společnost Česká urologická společnost Česká

Více

Modul obecné onkochirurgie

Modul obecné onkochirurgie Modul obecné onkochirurgie 1. Principy kancerogeneze, genetické a epigenetické faktory 2. Onkogeny, antionkogeny, reparační geny, instabilita nádorového genomu 3. Nádorová proliferace a apoptóza, důsledky

Více

Okruhy otázek ke zkoušce

Okruhy otázek ke zkoušce Okruhy otázek ke zkoušce 1. Úvod do biologie. Vznik života na Zemi. Evoluční vývoj organizmů. Taxonomie organizmů. Původ a vývoj člověka, průběh hominizace a sapientace u předků člověka vyšších primátů.

Více

MATEMATICKÁ BIOLOGIE

MATEMATICKÁ BIOLOGIE INSTITUT BIOSTATISTIKY A ANALÝZ Lékařská a Přírodovědecká fakulta, Masarykova univerzita MATEMATICKÁ BIOLOGIE Přírodovědecká fakulta Masarykova univerzita, Brno Studijní obor Matematická biologie Masarykova

Více

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky

Více

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno Zpracování a využití biologického materiálu pro výzkumné účely od nemocných s monoklonální gamapatií Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie,

Více

Biotechnologické a biomedicínské centrum Akademie věd a Univerzity Karlovy ve Vestci BIOCEV

Biotechnologické a biomedicínské centrum Akademie věd a Univerzity Karlovy ve Vestci BIOCEV Biotechnologické a biomedicínské centrum Akademie věd a Univerzity Karlovy ve Vestci BIOCEV BIOCEV ZÁKLADNÍ ÚDAJE 400 výzkumných pracovníků 200 studentů 5 výzkumných programů 54 výzkumných skupin 5 moderních

Více

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH RÁMCOVÝ VZDĚLÁVACÍ PROGRAM PRO ZÍSKÁNÍ SPECIALIZOVANÉ ZPŮSOBILOSTI v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH 1. Cíl specializačního vzdělávání Cílem specializačního vzdělávání

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

1 Biochemické animace na internetu

1 Biochemické animace na internetu 1 Biochemické animace na internetu V dnešní době patří internet mezi nejužívanější zdroje informací. Velmi často lze pomocí internetu legálně stáhnout řadu již vytvořených výukových materiálů sloužících

Více

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza Iveta Valášková ivalskova@fnbrno.cz Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza nejčastěji se vyskytující autozomálně recesivní dědičná metabolická porucha v zakavkazské

Více

Stav screeningu kolorektálního karcinomu v ČR a význam adresného zvaní

Stav screeningu kolorektálního karcinomu v ČR a význam adresného zvaní Ústřední vojenská nemocnice - Vojenská fakultní nemocnice Praha 1. lékařská fakulta Univerzity Karlovy Interní klinika Stav screeningu kolorektálního karcinomu v ČR a význam adresného zvaní M. Zavoral

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Význam prevence a včasného záchytu onemocnění pro zdravotní systém

Význam prevence a včasného záchytu onemocnění pro zdravotní systém INSTITUT BIOSTATISTIKY A ANALÝZ Lékařská fakulta & Přírodovědecká fakulta Masarykova univerzita, Brno www.iba.muni.cz Význam prevence a včasného záchytu onemocnění pro zdravotní systém Národní screeningové

Více

Radiační patofyziologie. Zdroje záření. Typy ionizujícího záření: Jednotky pro měření radiace:

Radiační patofyziologie. Zdroje záření. Typy ionizujícího záření: Jednotky pro měření radiace: Radiační patofyziologie Radiační poškození vzniká účinkem ionizujícího záření. Co se týká jeho původu, ionizující záření vzniká: při radioaktivním rozpadu prvků, přichází z kosmického prostoru, je produkováno

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

NÁDOROVÁ RIZIKA. poznejme OBSAH

NÁDOROVÁ RIZIKA. poznejme OBSAH poznejme NÁDOROVÁ RIZIKA OBSAH Úvod... 3 Proč bychom se měli dozvědět o svých vlastních rizicích?... 4 Jaké jsou naše služby?... 4 Kdo by měl být vyšetřen?... 5 Jaký je postup při vyšetřování?... 6 Informace

Více

Intraduktální proliferující léze mléčné žlázy. Dušan Žiak

Intraduktální proliferující léze mléčné žlázy. Dušan Žiak Intraduktální proliferující léze mléčné žlázy Dušan Žiak Bioptický seminář FN a CGB Ostrava 5.2.2014 2013 Definice Intraduktální proliferujíce léze jsou skupinou cytologicky a architektonicky rozmanitých

Více

Interaktivní nástroje pro výuku léčebných standardů cytostatické léčby zhoubných nádorů Portál DIOS

Interaktivní nástroje pro výuku léčebných standardů cytostatické léčby zhoubných nádorů Portál DIOS Interaktivní nástroje pro výuku léčebných standardů cytostatické léčby zhoubných nádorů Portál DIOS Klimeš D., Dušek L., Kubásek J., Fínek J., Petruželka L., Zoláková A., Vyzula R. Historie projektu Snaha

Více

Poznámky k nutrigenetice

Poznámky k nutrigenetice Poznámky k nutrigenetice Ondřej Šeda Institut klinické a experimentální medicíny, Praha Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Research Centre CHUM, Montreal, Canada Nutrigenetika Jednotlivé

Více

Studijní obor: Bioanalytik odborný pracovník v laboratorních metodách

Studijní obor: Bioanalytik odborný pracovník v laboratorních metodách Magisterský studijní program Biochemie (doplněk ke studijnímu katalogu zveřejněnému na webových stránkách fakultu http://www.sci.muni.cz/katalog/katalog2015/katalogbch.pdf) Garant studijního programu Prof.

Více

Proteinové znaky dětské leukémie identifikované pomocí genových expresních profilů

Proteinové znaky dětské leukémie identifikované pomocí genových expresních profilů Proteinové znaky dětské leukémie identifikované pomocí genových expresních profilů M.Vášková a spol. Klinika dětské hematologie a onkologie 2.LF UK a FN Motol Childhood Leukemia Investigation Prague Průtoková

Více

Výstavní plocha pokladna

Výstavní plocha pokladna Nabídka pro vystavovatele Základní informace Programové zaměření Výstavní plocha Obchodní nabídka Základní informace MÍSTO KONÁNÍ: Regionální centrum Olomouc GARANTI AKCE: doc. MUDr. Marián Hajdúch, Ph.D.

Více

Nelékařské obory: 2. ročník 1.LF UK ECMO ve fakultní nemocnici Plzeň. Mimořádná cena GALEN: Bc. Hana Buriánková

Nelékařské obory: 2. ročník 1.LF UK ECMO ve fakultní nemocnici Plzeň. Mimořádná cena GALEN: Bc. Hana Buriánková Nelékařské obory: Bc. Lada Zlochová 2. ročník 1.LF UK ECMO ve fakultní nemocnici Plzeň Mimořádná cena GALEN: Bc. Hana Buriánková 2. ročník 1.LF UK Informovanost veřejnosti o problematice darování kostní

Více

12. CELOSTÁTNÍ KONFERENCI O NEMOCECH PRSU

12. CELOSTÁTNÍ KONFERENCI O NEMOCECH PRSU Senologická sekce ČGPS ČLS JEP Gynekologicko - porodnická klinika 2. LF UK a FN Motol pořádají 12. CELOSTÁTNÍ KONFERENCI O NEMOCECH PRSU Komplikace diagnostiky a léčby nemocí prsu Senologie pro praxi Hormony

Více

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11.

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. Personalizovaná medicína Roche v oblasti onkologie Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. listopadu 2013 Personalizovaná vs standardní péče Cílená léčba Spojení diagnostiky

Více

První anonce. 2. pražské mezioborové onkologické kolokvium. 1. LF UK pořádá ve spolupráci s 2. a 3. LF UK

První anonce. 2. pražské mezioborové onkologické kolokvium. 1. LF UK pořádá ve spolupráci s 2. a 3. LF UK Pod záštitou Evropské onkologické společnosti Záštitu nad kolokviem dále převzaly: Ministerstvo školství, mládeže a tělovýchovy ČR Ministerstvo zdravotnictví ČR První anonce 1. LF UK pořádá ve spolupráci

Více

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Dle čl. 7 odst. 2 Směrnice děkana pro realizaci bakalářských

Více

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení

Více

(odbornost 816; aktualizovaná verze, schválená výborem SLG.cz - per rollam) Praha 16. listopadu 2015

(odbornost 816; aktualizovaná verze, schválená výborem SLG.cz - per rollam) Praha 16. listopadu 2015 Informace pro revizní pracovníky VZP ČR ke kontrole indikací, správnosti a oprávněnosti provádění (a vykazování k úhradě) laboratorních genetických vyšetření a vedení zdravotnické dokumentace u těchto

Více

Genetika dědičných neuropatií

Genetika dědičných neuropatií Genetika dědičných neuropatií P. Seeman Klinika dětské neurologie, DNA laboratoř, UK 2. LF a FN Motol Praha a CMT tým UK 2. LF a FNM CMT - dědičná choroba Známo již od Charcota, Marie a Tootha téměř 130

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII

VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII Plíšková L., Hrochová K., Kutová R. Ústav klinické biochemie a diagnostiky FN Hradec Králové PREANALYTICKÁ FÁZE V MOLEKULÁRNÍ BIOLOGII

Více

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI INDUKOVANÉ PŮSOBENÍM ORGANICKÝCH LÁTEK Z PRACHOVÝCH ČÁSTIC V OVZDUŠÍ Kateřina Hanzalová Oddělení genetické ekotoxikologie Ústav experimentální medicíny AV ČR v.v.i.

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň

Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň Laboratoř uplatňuje flexibilní přístup k rozsahu akreditace upřesněný v dodatku. Aktuální seznam činností prováděných v rámci požadovaného flexibilního rozsahu je k dispozici na webových stránkách laboratoře

Více

VÝZNAM REGULACE APOPTÓZY V MEDICÍNĚ

VÝZNAM REGULACE APOPTÓZY V MEDICÍNĚ REGULACE APOPTÓZY 1 VÝZNAM REGULACE APOPTÓZY V MEDICÍNĚ Příklad: Regulace apoptózy: protein p53 je klíčová molekula regulace buněčného cyklu a regulace apoptózy Onemocnění: více než polovina (70-75%) nádorů

Více

Rozbor léčebné zátěže Thomayerovy nemocnice onkologickými pacienty a pilotní prezentace výsledků péče

Rozbor léčebné zátěže Thomayerovy nemocnice onkologickými pacienty a pilotní prezentace výsledků péče Rozbor léčebné zátěže Thomayerovy nemocnice onkologickými pacienty a pilotní prezentace výsledků péče Výstupy analýzy dat zdravotnického zařízení a Národního onkologického registru ČR Prof. MUDr. Jitka

Více

Zkušenosti pracovišť LF UK a FN v Hradci Králové ze spolupráce s COC, s. r. o., Rybitví, při řešení společného výzkumného projektu

Zkušenosti pracovišť LF UK a FN v Hradci Králové ze spolupráce s COC, s. r. o., Rybitví, při řešení společného výzkumného projektu Zkušenosti pracovišť LF UK a FN v Hradci Králové ze spolupráce s COC, s. r. o., Rybitví, při řešení společného výzkumného projektu R. Slezák 1, V. Buchta 2, L. Ryšková 2, D. Slížová 3, O. Krs 3, M. Karásková

Více

Papillomaviry. Eva Hamšíková. ÚHKT, oddělení experimentální virologie

Papillomaviry. Eva Hamšíková. ÚHKT, oddělení experimentální virologie Papillomaviry Eva Hamšíková ÚHKT, oddělení experimentální virologie Viry nitrobuněční parazité, životní cyklus závislý na buněčném aparátu, v současnosti známo asi 5 000 typů virů Papillomaviry malé viry

Více

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty J.Berkovcová, M.Dziechciarková, M.Staňková, A.Janošťáková, D.Dvořáková, M.Hajdúch Laboratoř

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

1 Buněčný cyklus a apoptóza (z. Kleibi)..

1 Buněčný cyklus a apoptóza (z. Kleibi).. 1 Buněčný cyklus a apoptóza (z. Kleibi).. 1.1 Buněčný cyklus 1.1.1 Mitogenní signalizace a zahájení buněčného cyklu 1.1.2 G1 fáze buněčného cyklu a její reštrikční bod 1.1.3 S fáze: replikace DNA 1.1.4

Více

Rizikové faktory, vznik a možnosti prevence nádorů močového měchýře

Rizikové faktory, vznik a možnosti prevence nádorů močového měchýře Rizikové faktory, vznik a možnosti prevence nádorů močového měchýře MUDr. Libor Zámečník, Ph.D., FEBU, FECSM Urologická klinika VFN a 1.LF UK Praha Epidemiologie Zhoubné nádory močového měchýře jsou 9.

Více

Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc

Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie a myelodysplastický syndrom Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie (AL) Představují heterogenní skupinu chorob charakterizovaných kumulací klonu nevyzrálých, nádorově

Více

Současné trendy v epidemiologii nádorů se zaměřením na Liberecký kraj

Současné trendy v epidemiologii nádorů se zaměřením na Liberecký kraj Institut biostatistiky a analýz, Lékařská a přírodovědecká fakulta, Masarykova univerzita, Brno Současné trendy v epidemiologii nádorů se zaměřením na Mužík J. Epidemiologie nádorů v ČR Epidemiologická

Více

Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů

Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů Ústav úspěšně dokončil realizaci dvou investičních projektů s využitím prostředků z Operačního

Více

Screening zhoubných nádorů a adresné zvaní z pohledu SZP ČR MUDr. Renata Knorová, MBA ČPZP za SZP ČR

Screening zhoubných nádorů a adresné zvaní z pohledu SZP ČR MUDr. Renata Knorová, MBA ČPZP za SZP ČR Screening zhoubných nádorů a adresné zvaní z pohledu SZP ČR MUDr. Renata Knorová, MBA ČPZP za SZP ČR 5.12. 2013 Seminář stav screeningových programů zhoubných nádorů v ČR a význam adresného zvaní občanů

Více

Zpřístupnění populačních epidemiologických registrů pro výuku: Národní onkologický registr ČR on-line

Zpřístupnění populačních epidemiologických registrů pro výuku: Národní onkologický registr ČR on-line Institut biostatistiky a analýz, Masarykova univerzita, Brno Zpřístupnění populačních epidemiologických registrů pro výuku: Národní onkologický registr ČR on-line Mužík J., Dušek L., Kubásek M., Koptíková

Více

Biologická léčba karcinomu prsu. Prof. MUDr. Jitka Abrahámová, DrSc. Onkologická klinika 1.LF UK a TN KOC (NNB+VFN+TN)

Biologická léčba karcinomu prsu. Prof. MUDr. Jitka Abrahámová, DrSc. Onkologická klinika 1.LF UK a TN KOC (NNB+VFN+TN) Biologická léčba karcinomu prsu Prof. MUDr. Jitka Abrahámová, DrSc. Onkologická klinika 1.LF UK a TN KOC (NNB+VFN+TN) Cílená léčba Ca prsu Trastuzumab (HercepNn) AnN HER2 neu pronlátka LapaNnib (Tyverb)

Více

NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ

NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ Doc. MUDr. A. Šantavá, CSc. Ústav lékařské genetiky a fetální medicíny LF a UP Olomouc Význam genetiky v diagnostice neuromuskulárních onemocnění Podílí

Více

ZÁPIS z XIX. pracovního setkání fóra onkologů a zástupců zdravotních pojišťoven Brno 27. 5. 2011

ZÁPIS z XIX. pracovního setkání fóra onkologů a zástupců zdravotních pojišťoven Brno 27. 5. 2011 ZÁPIS z XIX. pracovního setkání fóra onkologů a zástupců zdravotních pojišťoven Brno 27. 5. 2011 Téma: Molekulární diagnostika v onkologii vliv na efektivitu a náklady onkologické léčby Účastníci: přednostové

Více

NÁDORY HLAVY A KRKU 2014

NÁDORY HLAVY A KRKU 2014 MEZIOBOROVÁ KONFERENCE CHIRURGIE HLAVY A KRKU, PATOLOGIE & ONKOLOGIE ODBORNÝ PROGRAM HRADEC KRÁLOVÉ 28. - 29. března 204 Organizátoři: Univerzita Karlova v Praze, Lékařská fakulta v Hradci Králové Onkologická

Více

Karcinom vaječníků. Představení nemoci

Karcinom vaječníků. Představení nemoci Karcinom vaječníků Představení nemoci Anatomie pánve a břicha Ženský reprodukční systém Vaječníky jsou párový orgán o velikosti 2 4 cm v průměru Vejcovod Řasinky Vaječník Ligamentum Kůra vaječníku Děloha

Více

Co se děje v genetické laboratoři?

Co se děje v genetické laboratoři? 12 Co se děje v genetické laboratoři? Tento letáček byl vytvořen s pomocí Dr Iana M Fraylinga, Institute of Medical Genetics, University Hospital of Wales, Cardiff, UK; Dr Domenica Coviella, Laboratory

Více