Studium genetické predispozice ke vzniku karcinomu prsu

Rozměr: px
Začít zobrazení ze stránky:

Download "Studium genetické predispozice ke vzniku karcinomu prsu"


1 Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie (doc. Pohlreich) Ústav biologie a lékařské genetiky, 1. LF UK Odd. biologie nádorové buňky, ÚMG AVČR

2 Karcinom prsu Nejčastější zhoubný nádor u žen Incidence > 120 / žen / rok ~ 5-10% - dědičná forma C50

3 Genetika dědičného karcinomu prsu Analýza 963 rodin z Prahy a okolí ( ) Bez mutace Geny se střední penetrancí (CHEK2, PALB2, ATM, RAD51C, NBN, ) Vysoko-penetrantní geny (BRCA1, BRCA2, p53, PTEN, STK11) Pohlreich P

4 Genetika dědičného karcinomu prsu Analýza 963 rodin z Prahy a okolí ( ) Bez mutace Geny se střední penetrancí (CHEK2, PALB2, ATM, RAD51C, NBN, ) Vysoko-penetrantní geny (BRCA1, BRCA2, p53, PTEN, STK11) Pohlreich P

5 Genetika dědičného karcinomu prsu Analýza 963 rodin z Prahy a okolí ( ) Negativní Geny se střední penetrancí (CHEK2, PALB2, ATM, RAD51C, NBN, ) Vysoko-penetrantní geny (BRCA1, BRCA2, p53, PTEN, STK11)

6 Genetika dědičného karcinomu prsu Necharakterizované predispoziční varianty Privátní mutace v genech s vysokou penetrancí ( BRCAX ) Doposud necharakterizované variace v genech se střední penetrancí (kandidátní geny) Doposud necharakterizované kombinace variant v genech s nízkou penetrancí

7 Genetika dědičného karcinomu prsu Necharakterizované predispoziční varianty Privátní mutace v genech s vysokou penetrancí ( BRCAX ) Doposud necharakterizované variace v genech se střední penetrancí (kandidátní geny) Doposud necharakterizované kombinace variant v genech s nízkou penetrancí

8 Genetika dědičného karcinomu prsu Analýza predispozičních variant GWAS (celogenomové asociační studie) HTS (high throughput sequencing) Mutační analýza genů kódujících proteiny v společných cestách

9 Genetika dědičného karcinomu prsu Analýza predispozičních variant GWAS (celogenomové asociační studie) HTS (high throughput sequencing) Mutační analýza genů kódujících proteiny v společných cestách

10 Genetika dědičného karcinomu prsu Geny pro DNA-reparační proteiny v predispozici ke vzniku karcinomu prsu -H2AX P P Chk2 P P 53BP1 BRIP1 ATM BRCA1 P P MRE11 RAD50 Nbs1 DNA P p53 P CDC25A P CDC25C P BRCA2 PALB2 RAD51 Regulace buněčného cyklu Apoptóza Reparace DNA (reparace DDSB)

11 Genetika dědičného karcinomu prsu Geny pro DNA-reparační proteiny v predispozici ke vzniku karcinomu prsu -H2AX P WIP1 P Chk2 P P 53BP1 BRIP1 ATM BRCA1 P P MRE11 RAD50 Nbs1 DNA P p53 P CDC25A P CDC25C P BRCA2 PALB2 RAD51 Regulace buněčného cyklu Apoptóza Reparace DNA (reparace DDSB)

12 Mutační analýza genu PPM1D (WIP1) WIP1 Gen PPM1D lokalizován na 17q23.2 Monomerní serin-threoninová fosfatáza Defosforylace proteinů zapojených do reparace DNA (včetně ATM, CHEK1/2, -H2AX a p53) Amplifikace lokusu 17q23 v p53 wt nádorech

13 Mutační analýza genu PPM1D (WIP1) Populace pacientů 330 BRCA1/2 wt HBC/HBOC primární soubor 398 BRCA1/2 wt HBC/HBOC konfirmační soubor 450 kontrol bez onkologického onemocnění panel p53 wt buněčných linií 304 pacientů s neselektovaným C18 C20

14 Mutační analýza genu PPM1D (WIP1) Mutační analýza gen PPM1D (6 exonů; amplifikace v 8 fragmentech) e2-6 HRM analýza e1 + susp. HRM vzorky PCR + přímé sekvenování

15 Mutační analýza genu PPM1D (WIP1) Mutační analýza PPM1D v buněčných liniích U2OS: c.1372c>t (p.r458x) WT-GAGATAGCTCGAGAGAAT Mut-... T... WT/p.E I A R E N 458 Mut/p.E I A X - - HCT116: c.1349delt (p.l450x) WT-AGAATTTTTTAGAGGTTT Mut-... AGAGGTTTC WT/p.N F L E V S 450 Mut/p.N F X - - -

16 Kleiblova et al. J Cell Biol 2013 Mutační analýza genu PPM1D (WIP1) Výsledky pacienti

17 Kleiblova et al. J Cell Biol 2013 Mutační analýza genu PPM1D (WIP1) Výsledky pacienti

18 WT/p. A L T L R I 484 Mut/p. A L T X - - WT/p.N F K R T L 535 Mut/p.N F X Mutační analýza genu PPM1D (WIP1) Výsledky pacienti #BRCA380: c.1601_1615del (p.f534x) WT-AACTTTAAAAGGACATTAGAAGAG Mut-... AAGAGTCCAATTCTGGCCCC #CRC32: c.1372c>t (p.r458x) WT-GAGATAGCTCGAGAGAAT Mut-... T... WT/p.N F K R T L E E 534 Mut/p.N X WT/p.E I A R E N 458 Mut/p.E I A X - - #BRCA1855: c.1451t>g (p.l484x) #CRC145: c.1602dupt (p.k535x) WT-AGCCCTGACTTTAAGGAT WT-AACTTTAAAAGGACATTA Mut-... G... Mut-... TAAAAGGACATT

19 WT/p. A L T L R I 484 Mut/p. A L T X - - Mutační analýza genu PPM1D (WIP1) Výsledky pacienti #BRCA1855: c.1451t>g (p.l484x) WT-AGCCCTGACTTTAAGGAT Mut-... G...

20 WT/p. A L T L R I 484 Mut/p. A L T X - - Mutační analýza genu PPM1D (WIP1) Výsledky pacienti 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% WT Het Mut Mozaicismus? #BRCA1855: c.1451t>g (p.l484x) WT-AGCCCTGACTTTAAGGAT Mut-... G...

21 WT/p. A L T L R I 484 Mut/p. A L T X - - Mutační analýza genu PPM1D (WIP1) Výsledky pacienti 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% WT Het Mut Mozaicismus! nenádorová mamární tkáň WT-AGCCCTGACTTTAAGGATACATGA Mut G #BRCA1855: c.1451t>g (p.l484x) WT-AGCCCTGACTTTAAGGAT Mut-... G... karcinom prsu WT-AGCCCTGACTTTAAGGATACATGA Mut G

22 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu Ruark et al. Nature 2013 Kleiblova et al. J Cell Biol 2013

23 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu Ruark et al. Nature 2013 Kleiblova et al. J Cell Biol 2013 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116) c.1372c>t (p.r458x) WT-GAGATAGCTCGAGAGAAT #CRC32: WT-GAGATAGCTCGAGAGAAT U2OS: Mut-... T... Mut-... T... Kleiblova et al. J Cell Biol 2013 Zajkowicz et al. Mol Biol Rep 2013

24 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu 6 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116) Trunkační mutace: gain-of-function alterace - > biologický poločas WIP1 (in vitro) - funkční inaktivace p53 (ztráta G1-S kontrolního bodu) - zvýšená tolerance poškození DNA (?) - kancerogeneze (?) Kleiblova et al. J Cell Biol 2013

25 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu 6 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116) Trunkační mutace: gain-of-function alterace - > biologický poločas WIP1 (in vitro) - funkční inaktivace p53 (ztráta G1-S kontrolního bodu) - zvýšená tolerance poškození DNA (?) - kancerogeneze (?) U pacientů se tyto mutace vyskytují jako mozaiky Ruark et al. Nature 2013; Kleiblova et al. J Cell Biol 2013

26 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu 6 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116) Trunkační mutace: gain-of-function alterace - > biologický poločas WIP1 (in vitro) - funkční inaktivace p53 (ztráta G1-S kontrolního bodu) - zvýšená tolerance poškození DNA (?) - kancerogeneze (?) U pacientů se tyto mutace vyskytují jako mozaiky - Způsob vzniku? - Přenos na další generace? - Klinický význam? Ruark et al. Nature 2013; Kleiblova et al. J Cell Biol 2013

27 Význam mutací genu PPM1D (WIP1) Nejasný mechanizmus a penetrance Negativní Geny se střední penetrancí Geny s vysokou penetrancí

28 Poděkování Ústav biochemie a exp. onkologie, 1. LF UK - Jan Ševčík - Petr Pohlreich - Zdeněk Kleibl Ústav patologie, 1. LF UK - Pavel Dundr Odd. biologie nádorové buňky, ÚMG AVČR - Libor Macůrek - Jan Benada - Soňa Pecháčková - Jiří Bártek The Netherlands Cancer Institute - Indra A. Shaltiel - Emile E. Voest - René H. Medema Grant IGA MZ ČR: NT

Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních


Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ


1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.


Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?


ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii ONKOGENETIKA Spojuje: - lékařskou genetiku - buněčnou biologii - molekulární biologii - cytogenetiku - virologii Důležitost spolupráce různých specialistů při detekci hereditárních forem nádorů - (onkologů,internistů,chirurgů,kožních


Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013 Lékařská genetika a onkologie Renata Gaillyová OLG a LF MU Brno 2012/2013 *genetické souvislosti *onkogenetická vyšetření u onkologických onemocnění * genetické vyšetření u hereditárních nádorů *presymptomatické


ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen

ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen Dědičný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 genů. Foretová L., Macháčková E. Oddělení epidemiologie a genetiky nádorů, Masarykův onkologický ústav, Brno


Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.


Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární






RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Tekuté biopsie u mnohočetného myelomu

Tekuté biopsie u mnohočetného myelomu Tekuté biopsie u mnohočetného myelomu Mgr. Veronika Kubaczková Babákova myelomová skupina ÚPF LF MU Pacientský seminář 11. května 2016, Brno Co jsou tekuté biopsie? Představují méně zatěžující vyšetření


Výuka genetiky na Přírodovědecké fakultě MU

Výuka genetiky na Přírodovědecké fakultě MU MASARYKOVA UNIVERZITA Přírodovědecká fakulta Výuka genetiky na Přírodovědecké fakultě MU Jiří Doškař Ústav experimentální biologie, Oddělení genetiky a molekulární biologie 1 V akademickém roce 1964/1965



EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence


Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk


Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady


Senescence v rozvoji a léčbě nádorů. Řezáčová Martina

Senescence v rozvoji a léčbě nádorů. Řezáčová Martina Senescence v rozvoji a léčbě nádorů Řezáčová Martina Replikační senescence Alexis Carrel vs. Leonard Hayflick and Paul Moorhead Diferencované bb mohou prodělat pouze omezený počet dělení - Hayflickův limit


Přehled výzkumných aktivit

Přehled výzkumných aktivit Přehled výzkumných aktivit ROK 2004 Lenka Zahradová Laboratoř experimentální hematologie a buněčné imunoterapie Oddělení klinické hematologie FNB Bohunice Přednosta: prof. MUDr. M. Penka, CSc. Oddělení


,, Cesta ke zdraví mužů

,, Cesta ke zdraví mužů PREZENTACE VÝSLEDKŮ ŘEŠENÍ PILOTNÍHO PROJEKTU PREVENTIVNÍ PÉČE PRO MUŢE,, Cesta ke zdraví mužů prim. MUDr. Monika Koudová GHC GENETICS, s.r.o.- NZZ, Praha Projekt byl realizován ve dvou etapách: I. etapa


Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený





Epigenetika mění paradigma současné medicíny i její budoucnost

Epigenetika mění paradigma současné medicíny i její budoucnost Epigenetika mění paradigma současné medicíny i její budoucnost pokračování z čísla 1 a 2 /2014 Epigenetika v onkologii MUDr. Jozef Čupka Společnost všeobecného lékařství ČLS JEP, Sekce preventivní onkologie


Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní


CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.


Onkologický komplexní program

Onkologický komplexní program PRVOUK-27: Onkologický komplexní program Koordinátor: Prof. MUDr. Aleksi Šedo, DrSc. 1. LF UK PRVOUK na 1.LF UK Kontext v rámci Vědeckých škol 1.LF UK - interní hodnocení vědeckého výkonu Motivační distribuce


Liga proti rakovině Praha

Liga proti rakovině Praha Liga proti rakovině Praha 22 let činnosti Ligy Prof. MUDr. Zdeněk Dienstbier, DrSc. Tři hlavní dlouhodobé programy: Soustavná informovanost veřejnosti o nádorové prevenci Snaha o zlepšení kvality života


Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE


Inhibitory ATR kinasy v terapii nádorů

Inhibitory ATR kinasy v terapii nádorů Inhibitory ATR kinasy v terapii nádorů J.Vávrová, M Řezáčová Katedra radiobiologie FVZ Hradec Králové UO Brno Ústav lékařské chemie LF Hradec Králové UK Praha Cíl léčby: zničení nádorových buněk zachování


Ondřej Scheinost Nemocnice České Budějovice, a.s.

Ondřej Scheinost Nemocnice České Budějovice, a.s. Ondřej Scheinost Nemocnice České Budějovice, a.s. Nové technologie přelomové období principy technologií klinická použitelnost chips (arrays) sekvenační technologie Důležitost genetických informací i další


Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi



OBOROVÁ RADA BIOCHEMIE A PATOBIOCHEMIE OBOROVÁ RADA BIOCHEMIE A PATOBIOCHEMIE Předseda: Stanislav Štípek, prof., MUDr., DrSc. Ústav lékařske biochemie a laboratorní disgnostiky 1. LF UK Kateřinská 32, 121 08 Praha 2 tel.: 224 964 283 fax: 224


Obecná biologie a genetika B53 volitelný předmět pro 4. ročník

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Biologie. Mezipředmětové


Molekulární diagnostika pletencové svalové dystrofie typu 2A

Molekulární diagnostika pletencové svalové dystrofie typu 2A Molekulární diagnostika pletencové svalové dystrofie typu 2A Lenka Fajkusová Centrum molekulární biologie a genové terapie Fakultní nemocnice Brno Pletencové svalové dystrofie (Limb Girdle Muscular Dystrophy



BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY 1 VÝZNAM BUNĚČNÉ TRANSFORMACE V MEDICÍNĚ Příklad: Buněčná transformace: postupná kumulace genetických změn Nádorové onemocnění: kolorektální karcinom 2 3 BUNĚČNÁ TRANSFORMACE


prof. RNDr. Jiří Doškař, CSc. Oddělení genetiky a molekulární biologie

prof. RNDr. Jiří Doškař, CSc. Oddělení genetiky a molekulární biologie prof. RNDr. Jiří Doškař, CSc. Oddělení genetiky a molekulární biologie Oddělení genetiky a molekulární biologie Profesoři prof. RNDr. Jiří Doškař, CSc. prof. RNDr. Jiřina Relichová, CSc. (emeritní) prof.



DEN OTEVŘENÝCH DVEŘÍ NA ÚMG DEN OTEVŘENÝCH DVEŘÍ NA ÚMG Místo konání: Datum a doba konání: Budova F, Vídeňská 1083, 142 20 Praha 4-Krč 31. 10. 2014 od 9:00 do 16:00 hod. Kontakt pro styk s veřejností: Organizační záležitosti: Leona


Úvod do nonhla-dq genetiky celiakie

Úvod do nonhla-dq genetiky celiakie Úvod do nonhla-dq genetiky celiakie František Mrázek HLA laboratoř, Ústav Imunologie LF UP a FN Olomouc Celiakie - časté chronické zánětlivé onemocnění tenkého střeva s autoimunitní a systémovou složkou


Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE

Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE BiochemNet vytvoření sítě pro podporu spolupráce biomedicínských pracovišť a zvýšení uplatnitelnosti absolventů biochemických oborů v praxi Laboratorní workshop s teoreticko praktickou ukázkou molekulárně



Jana Krejčová MOLEKULÁRNÍ PATOLOGIE ZAČÁTKU III. TISÍCILETÍ: VYUŽITÍ BIOPTICKÝCH VZORKŮ PRO MOLEKULÁRNÍ ANALÝZU. Workshop dubna 2005 Olomouc Jana Krejčová Pracovní skupina molekulární patologie České lékařské společnosti Jana Evangelisty Purkyně Společnost patologů České lékařské společnosti Jana Evangelisty Purkyně Laboratoř molekulární patologie


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Chromozomální aberace nalezené u párů s poruchou reprodukce v letech

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech Chromozomální aberace nalezené u párů s poruchou reprodukce v letech 2000-2005 Jak přistupovat k nálezům minoritních gonozomálních mozaik? Šantavá A., Adamová, K.,Čapková P., Hyjánek J. Ústav lékařské


Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray


Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování


Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem


2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou


Univerzita Karlova v Praze 1. lékařská fakulta

Univerzita Karlova v Praze 1. lékařská fakulta Univerzita Karlova v Praze 1. lékařská fakulta Doktorské studijní programy v biomedicíně Studijní obor: Biochemie a patobiochemie Mgr. Ivana Tichá GENETICKÉ FAKTORY ODPOVĚDNÉ ZA VÝVOJ DĚDIČNÉHO KARCINOMU


Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová

Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR Mgr. Silvie Dudová Centrum základního výzkumu pro monoklonální gamapatie a mnohočetný myelom, ILBIT LF MU Brno Laboratoř experimentální


Můj život s genetikou

Můj život s genetikou Můj život s genetikou Aneta Mikulášová Molekulární biologie a genetika Přírodovědecká fakulta Masarykova univerzita Univerzitní vzdělávání genetiky 150 roků po Mendelovi Brno, 29. 5. 2015 Studium Molekulární


seminář ENTOG, 8.10. 2005

seminář ENTOG, 8.10. 2005 Karcinom vaječníků seminář ENTOG, 8.10. 2005 MUDr. Michal Zikán, PhD. Gynekologicko-porodnická klinika 1. LF UK a VFN Ústav biochemie a experimentální onkologie 1. LF UK Incidence 25,3 / 100 000 1323 případů



VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita Všechny nádory mají genetický podtext, ale některé mají tento podtext


DNA microarrays Josef Srovnal, Michaela Špenerová, Lenka Radová, Marián Hajdúch, Vladimír Mihál

DNA microarrays Josef Srovnal, Michaela Špenerová, Lenka Radová, Marián Hajdúch, Vladimír Mihál DNA microarrays Josef Srovnal, Michaela Špenerová, Lenka Radová, Marián Hajdúch, Vladimír Mihál Laboratoř experimentální medicíny při Dětské klinice LF UP a FN Olomouc Cíle Seznámit posluchače s: 1. Technologií


Laboratorní příručka

Laboratorní příručka STRANA: 1/24 Laboratorní příručka Pro uživatele služeb Oddělení epidemiologie a genetiky nádorů - laboratoře, spadajících do odbornosti 816 Laboratoř lékařské genetiky Vypracovali: RNDr. Eva Macháčková,


Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk. Aleš Hampl

Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk. Aleš Hampl Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk Aleš Hampl Tkáně Orgány Živé buňky, které plní různé funkce (podpora struktury, přijímání živin, lokomoce,





Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu

Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Srovnal J. 1, Cincibuch J. 2, Cwierkta K. 2, Melichar B. 2, Aujeský R. 3, Vrba R.





HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100% F8 - hemofilie A monogenní


2. pražské mezioborové onkologické kolokvium Prague ONCO 2011

2. pražské mezioborové onkologické kolokvium Prague ONCO 2011 Záštitu nad kolokviem převzaly: Evropská onkologická společnost Ministerstvo školství, mládeže a tělovýchovy ČR Ministerstvo zdravotnictví ČR Česká onkologická společnost Česká urologická společnost Česká


Nano World Cancer Day 2014

Nano World Cancer Day 2014 31. ledna 2014 Celoevropská akce ETPN pořádaná současně ve 13 členských zemích Evropské unie Rakousko (Štýrský Hradec), Česká republika (Praha), Finsko (Helsinky), Francie (Paříž), Německo (Erlangen),


Patologie a klasifikace karcinomu prostaty, Gleasonův systém. MUDr. Marek Grega. Ústav patologie a molekulární medicíny 2. LF UK a FN v Motole

Patologie a klasifikace karcinomu prostaty, Gleasonův systém. MUDr. Marek Grega. Ústav patologie a molekulární medicíny 2. LF UK a FN v Motole Patologie a klasifikace karcinomu prostaty, Gleasonův systém MUDr. Marek Grega Ústav patologie a molekulární medicíny 2. LF UK a FN v Motole Nádory prostaty v z každé buňky, která vytváří komplexní uspořádání


TARCEVA klinický registr

TARCEVA klinický registr TARCEVA klinický registr Karcinom pankreatu Stav k datu 10. 4. 2011 Registr Tarceva je podporován výzkumným ý grantem firmy Roche. Česká onkologická společnost Institut biostatistiky a analýz Stav registru


ONKOGYNEKOLOGIE. Prof. MUDr. David Cibula, CSc., prof. MUDr. Luboš Petruželka, CSc., a kolektiv

ONKOGYNEKOLOGIE. Prof. MUDr. David Cibula, CSc., prof. MUDr. Luboš Petruželka, CSc., a kolektiv Prof. MUDr. David Cibula, CSc., prof. MUDr. Luboš Petruželka, CSc., a kolektiv ONKOGYNEKOLOGIE Autorský kolektiv: doc. MUDr. Otakar Bìlohlávek, CSc. MUDr. Jiøí Bouda, Ph.D. MUDr. Andrea Burgetová prof.


Co to je genetický test?

Co to je genetický test? 12 Co to je genetický test? Vytvořeno podle informačních letáků vypracovaných nemocnicemi Guy's a St. Thomas' Hospital, Londýn. Tato práce byla podpořena projektem Eurogentest v rámci Evropského 6. RP;


Modul obecné onkochirurgie

Modul obecné onkochirurgie Modul obecné onkochirurgie 1. Principy kancerogeneze, genetické a epigenetické faktory 2. Onkogeny, antionkogeny, reparační geny, instabilita nádorového genomu 3. Nádorová proliferace a apoptóza, důsledky


Pohled genetika na racionální vyšetřování v preventivní kardiologii

Pohled genetika na racionální vyšetřování v preventivní kardiologii Pohled genetika na racionální vyšetřování v preventivní kardiologii Tomáš Freiberger Genetická laboratoř, Centrum kardiovaskulární a transplantační chirurgie Brno, ČR Osnova Genetické faktory vzniku KV


Genotypování markerů užitkovosti a zdraví u skotu

Genotypování markerů užitkovosti a zdraví u skotu Mezinárodní odborný seminář Využití chovatelských dat onemocnění skotu pro management stád, šlechtění a pro racionální užívání antimikrobik. Genotypování markerů užitkovosti a zdraví u skotu Jitka Kyseľová





Okruhy otázek ke zkoušce

Okruhy otázek ke zkoušce Okruhy otázek ke zkoušce 1. Úvod do biologie. Vznik života na Zemi. Evoluční vývoj organizmů. Taxonomie organizmů. Původ a vývoj člověka, průběh hominizace a sapientace u předků člověka vyšších primátů.



MATEMATICKÁ BIOLOGIE INSTITUT BIOSTATISTIKY A ANALÝZ Lékařská a Přírodovědecká fakulta, Masarykova univerzita MATEMATICKÁ BIOLOGIE Přírodovědecká fakulta Masarykova univerzita, Brno Studijní obor Matematická biologie Masarykova


Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno Zpracování a využití biologického materiálu pro výzkumné účely od nemocných s monoklonální gamapatií Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie,


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). Orphanet - Volně přístupné webové stránky s informacemi


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.





Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky



DMPK (ZNF9) V DIFERENCOVANÝCH. Z, Kroupová I, Falk M* M FISH ANALÝZA m-rna DMPK (ZNF9) V DIFERENCOVANÝCH TKÁNÍCH PACIENT IENTŮ S MYOTONICKOU DYSTROFI FIÍ Lukáš Z, Kroupová I, Falk M* M Ústav patologie FN Brno *Biofyzikáln lní ústav AVČR R Brno Definice MD Myotonická


1 Biochemické animace na internetu

1 Biochemické animace na internetu 1 Biochemické animace na internetu V dnešní době patří internet mezi nejužívanější zdroje informací. Velmi často lze pomocí internetu legálně stáhnout řadu již vytvořených výukových materiálů sloužících


Výroční zpráva Společnosti lékařské genetiky ČLS JEP

Výroční zpráva Společnosti lékařské genetiky ČLS JEP Výroční zpráva Společnosti lékařské genetiky ČLS JEP Členská základna K datu 31.12.2004 byl počet členů Společnosti lékařské genetiky (SLG) celkem 227. Oproti roku 2003 došlo k navýšení o 41 nově přihlášených


Všechno co jste kdy chtěli vědět o onkologii, ale báli jste se zeptat. David Feltl Fakultní nemocnice Ostrava

Všechno co jste kdy chtěli vědět o onkologii, ale báli jste se zeptat. David Feltl Fakultní nemocnice Ostrava Všechno co jste kdy chtěli vědět o onkologii, ale báli jste se zeptat. David Feltl Fakultní nemocnice Ostrava Obsah Proč jsou zhoubné nádory zhoubné? Stručná historie oboru a jednotlivých léčebných metod


Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Mgr. Klára Vilimovská Dědečková, Ph.D. Synlab genetics s.r.o. Molekulární


Cystická fibróza. Iveta Valášková Fakultní nemocnice Brno Oddělení lékařské genetiky

Cystická fibróza. Iveta Valášková Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza Iveta Valášková Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza nejčastěji se vyskytující autozomálně recesivní dědičná metabolická porucha v zakavkazské



ÚSTAV LÉKAŘSKÉ CHEMIE A BIOCHEMIE Univerzita Palackého v Olomouci ÚSTAV LÉKAŘSKÉ CHEMIE A BIOCHEMIE Laboratoř buněčných kultur Hněvotínská 3, 775 15 Olomouc, Česká republika : +420-585 632 301 Fax: +420-585 632 302


Stav screeningu kolorektálního karcinomu v ČR a význam adresného zvaní

Stav screeningu kolorektálního karcinomu v ČR a význam adresného zvaní Ústřední vojenská nemocnice - Vojenská fakultní nemocnice Praha 1. lékařská fakulta Univerzity Karlovy Interní klinika Stav screeningu kolorektálního karcinomu v ČR a význam adresného zvaní M. Zavoral


Radiační patofyziologie. Zdroje záření. Typy ionizujícího záření: Jednotky pro měření radiace:

Radiační patofyziologie. Zdroje záření. Typy ionizujícího záření: Jednotky pro měření radiace: Radiační patofyziologie Radiační poškození vzniká účinkem ionizujícího záření. Co se týká jeho původu, ionizující záření vzniká: při radioaktivním rozpadu prvků, přichází z kosmického prostoru, je produkováno


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných



ZÁKLADY KLINICKÉ ONKOLOGIE Pavel Klener ZÁKLADY KLINICKÉ ONKOLOGIE Galén Autor prof. MUDr. Pavel Klener, DrSc. I. interní klinika klinika hematologie 1. LF UK a VFN, Praha Recenzenti MUDr. Eva Helmichová, CSc. Homolka Premium Care


Karcinomy u dětí a dospívajících v letech na Klinice dětské hematologie a onkologie 2. LF UK a FN Motol

Karcinomy u dětí a dospívajících v letech na Klinice dětské hematologie a onkologie 2. LF UK a FN Motol Karcinomy u dětí a dospívajících v letech 2007-2012 na Klinice dětské hematologie a onkologie 2. LF UK a FN Motol L. Cingrošová 1, V. Šmelhaus 1 D. Sumerauer 1, J. Šnajdauf 2, P. Vlček 3, M. Kynčl 4, R.


Onkogeny a nádorové supresory

Onkogeny a nádorové supresory Onkogeny a nádorové supresory Historie Francis) Peyton Rous (October 5, 1879 February 16, 1970) He made his seminal observation, that a malignant tumor growing on a domestic chicken could be transferred


Základy molekulární patologie nádorových onemocnění. Molekulárně biologické metody používané v molekulární patologii.

Základy molekulární patologie nádorových onemocnění. Molekulárně biologické metody používané v molekulární patologii. Základy molekulární patologie nádorových onemocnění. Molekulárně biologické metody používané v molekulární patologii. Ivana Tichá RNDr. Ivana Tichá, Ph.D. (, Laboratoř molekulární patologie


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Význam prevence a včasného záchytu onemocnění pro zdravotní systém

Význam prevence a včasného záchytu onemocnění pro zdravotní systém INSTITUT BIOSTATISTIKY A ANALÝZ Lékařská fakulta & Přírodovědecká fakulta Masarykova univerzita, Brno Význam prevence a včasného záchytu onemocnění pro zdravotní systém Národní screeningové


Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka


Interaktivní nástroje pro výuku léčebných standardů cytostatické léčby zhoubných nádorů Portál DIOS

Interaktivní nástroje pro výuku léčebných standardů cytostatické léčby zhoubných nádorů Portál DIOS Interaktivní nástroje pro výuku léčebných standardů cytostatické léčby zhoubných nádorů Portál DIOS Klimeš D., Dušek L., Kubásek J., Fínek J., Petruželka L., Zoláková A., Vyzula R. Historie projektu Snaha


Poznámky k nutrigenetice

Poznámky k nutrigenetice Poznámky k nutrigenetice Ondřej Šeda Institut klinické a experimentální medicíny, Praha Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Research Centre CHUM, Montreal, Canada Nutrigenetika Jednotlivé


Výskyt MHC molekul. RNDr. Ivana Fellnerová, Ph.D. ajor istocompatibility omplex. Funkce MHC glykoproteinů

Výskyt MHC molekul. RNDr. Ivana Fellnerová, Ph.D. ajor istocompatibility omplex. Funkce MHC glykoproteinů RNDr. Ivana Fellnerová, Ph.D. Katedra zoologie, PřF UP Olomouc = ajor istocompatibility omplex Skupina genů na 6. chromozomu (u člověka) Kódují membránové glykoproteiny, tzv. MHC molekuly, MHC molekuly


Proteinové znaky dětské leukémie identifikované pomocí genových expresních profilů

Proteinové znaky dětské leukémie identifikované pomocí genových expresních profilů Proteinové znaky dětské leukémie identifikované pomocí genových expresních profilů M.Vášková a spol. Klinika dětské hematologie a onkologie 2.LF UK a FN Motol Childhood Leukemia Investigation Prague Průtoková


Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8


Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11.

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. Personalizovaná medicína Roche v oblasti onkologie Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. listopadu 2013 Personalizovaná vs standardní péče Cílená léčba Spojení diagnostiky


Co mě může potkat při návratu onemocnění. Nové přístupy biologická léčba karcinomu prostaty. MUDr. Hana Študentová, Ph.D.

Co mě může potkat při návratu onemocnění. Nové přístupy biologická léčba karcinomu prostaty. MUDr. Hana Študentová, Ph.D. Co mě může potkat při návratu onemocnění. Nové přístupy biologická léčba karcinomu prostaty MUDr. Hana Študentová, Ph.D. Obsah Obecný úvod Androgenní signalizace Možnosti systémové léčby Závěr Koho se
