Studium genetické predispozice ke vzniku karcinomu prsu

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Studium genetické predispozice ke vzniku karcinomu prsu"

Transkript

1 Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie (doc. Pohlreich) Ústav biologie a lékařské genetiky, 1. LF UK Odd. biologie nádorové buňky, ÚMG AVČR

2 Karcinom prsu Nejčastější zhoubný nádor u žen Incidence > 120 / žen / rok ~ 5-10% - dědičná forma C50

3 Genetika dědičného karcinomu prsu Analýza 963 rodin z Prahy a okolí ( ) Bez mutace Geny se střední penetrancí (CHEK2, PALB2, ATM, RAD51C, NBN, ) Vysoko-penetrantní geny (BRCA1, BRCA2, p53, PTEN, STK11) Pohlreich P

4 Genetika dědičného karcinomu prsu Analýza 963 rodin z Prahy a okolí ( ) Bez mutace Geny se střední penetrancí (CHEK2, PALB2, ATM, RAD51C, NBN, ) Vysoko-penetrantní geny (BRCA1, BRCA2, p53, PTEN, STK11) Pohlreich P

5 Genetika dědičného karcinomu prsu Analýza 963 rodin z Prahy a okolí ( ) Negativní Geny se střední penetrancí (CHEK2, PALB2, ATM, RAD51C, NBN, ) Vysoko-penetrantní geny (BRCA1, BRCA2, p53, PTEN, STK11)

6 Genetika dědičného karcinomu prsu Necharakterizované predispoziční varianty Privátní mutace v genech s vysokou penetrancí ( BRCAX ) Doposud necharakterizované variace v genech se střední penetrancí (kandidátní geny) Doposud necharakterizované kombinace variant v genech s nízkou penetrancí

7 Genetika dědičného karcinomu prsu Necharakterizované predispoziční varianty Privátní mutace v genech s vysokou penetrancí ( BRCAX ) Doposud necharakterizované variace v genech se střední penetrancí (kandidátní geny) Doposud necharakterizované kombinace variant v genech s nízkou penetrancí

8 Genetika dědičného karcinomu prsu Analýza predispozičních variant GWAS (celogenomové asociační studie) HTS (high throughput sequencing) Mutační analýza genů kódujících proteiny v společných cestách

9 Genetika dědičného karcinomu prsu Analýza predispozičních variant GWAS (celogenomové asociační studie) HTS (high throughput sequencing) Mutační analýza genů kódujících proteiny v společných cestách

10 Genetika dědičného karcinomu prsu Geny pro DNA-reparační proteiny v predispozici ke vzniku karcinomu prsu -H2AX P P Chk2 P P 53BP1 BRIP1 ATM BRCA1 P P MRE11 RAD50 Nbs1 DNA P p53 P CDC25A P CDC25C P BRCA2 PALB2 RAD51 Regulace buněčného cyklu Apoptóza Reparace DNA (reparace DDSB)

11 Genetika dědičného karcinomu prsu Geny pro DNA-reparační proteiny v predispozici ke vzniku karcinomu prsu -H2AX P WIP1 P Chk2 P P 53BP1 BRIP1 ATM BRCA1 P P MRE11 RAD50 Nbs1 DNA P p53 P CDC25A P CDC25C P BRCA2 PALB2 RAD51 Regulace buněčného cyklu Apoptóza Reparace DNA (reparace DDSB)

12 Mutační analýza genu PPM1D (WIP1) WIP1 Gen PPM1D lokalizován na 17q23.2 Monomerní serin-threoninová fosfatáza Defosforylace proteinů zapojených do reparace DNA (včetně ATM, CHEK1/2, -H2AX a p53) Amplifikace lokusu 17q23 v p53 wt nádorech

13 Mutační analýza genu PPM1D (WIP1) Populace pacientů 330 BRCA1/2 wt HBC/HBOC primární soubor 398 BRCA1/2 wt HBC/HBOC konfirmační soubor 450 kontrol bez onkologického onemocnění panel p53 wt buněčných linií 304 pacientů s neselektovaným C18 C20

14 Mutační analýza genu PPM1D (WIP1) Mutační analýza gen PPM1D (6 exonů; amplifikace v 8 fragmentech) e2-6 HRM analýza e1 + susp. HRM vzorky PCR + přímé sekvenování

15 Mutační analýza genu PPM1D (WIP1) Mutační analýza PPM1D v buněčných liniích U2OS: c.1372c>t (p.r458x) WT-GAGATAGCTCGAGAGAAT Mut-... T... WT/p.E I A R E N 458 Mut/p.E I A X - - HCT116: c.1349delt (p.l450x) WT-AGAATTTTTTAGAGGTTT Mut-... AGAGGTTTC WT/p.N F L E V S 450 Mut/p.N F X - - -

16 Kleiblova et al. J Cell Biol 2013 Mutační analýza genu PPM1D (WIP1) Výsledky pacienti

17 Kleiblova et al. J Cell Biol 2013 Mutační analýza genu PPM1D (WIP1) Výsledky pacienti

18 WT/p. A L T L R I 484 Mut/p. A L T X - - WT/p.N F K R T L 535 Mut/p.N F X Mutační analýza genu PPM1D (WIP1) Výsledky pacienti #BRCA380: c.1601_1615del (p.f534x) WT-AACTTTAAAAGGACATTAGAAGAG Mut-... AAGAGTCCAATTCTGGCCCC #CRC32: c.1372c>t (p.r458x) WT-GAGATAGCTCGAGAGAAT Mut-... T... WT/p.N F K R T L E E 534 Mut/p.N X WT/p.E I A R E N 458 Mut/p.E I A X - - #BRCA1855: c.1451t>g (p.l484x) #CRC145: c.1602dupt (p.k535x) WT-AGCCCTGACTTTAAGGAT WT-AACTTTAAAAGGACATTA Mut-... G... Mut-... TAAAAGGACATT

19 WT/p. A L T L R I 484 Mut/p. A L T X - - Mutační analýza genu PPM1D (WIP1) Výsledky pacienti #BRCA1855: c.1451t>g (p.l484x) WT-AGCCCTGACTTTAAGGAT Mut-... G...

20 WT/p. A L T L R I 484 Mut/p. A L T X - - Mutační analýza genu PPM1D (WIP1) Výsledky pacienti 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% WT Het Mut Mozaicismus? #BRCA1855: c.1451t>g (p.l484x) WT-AGCCCTGACTTTAAGGAT Mut-... G...

21 WT/p. A L T L R I 484 Mut/p. A L T X - - Mutační analýza genu PPM1D (WIP1) Výsledky pacienti 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% WT Het Mut Mozaicismus! nenádorová mamární tkáň WT-AGCCCTGACTTTAAGGATACATGA Mut G #BRCA1855: c.1451t>g (p.l484x) WT-AGCCCTGACTTTAAGGAT Mut-... G... karcinom prsu WT-AGCCCTGACTTTAAGGATACATGA Mut G

22 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu Ruark et al. Nature 2013 Kleiblova et al. J Cell Biol 2013

23 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu Ruark et al. Nature 2013 Kleiblova et al. J Cell Biol 2013 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116) c.1372c>t (p.r458x) WT-GAGATAGCTCGAGAGAAT #CRC32: WT-GAGATAGCTCGAGAGAAT U2OS: Mut-... T... Mut-... T... Kleiblova et al. J Cell Biol 2013 Zajkowicz et al. Mol Biol Rep 2013

24 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu 6 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116) Trunkační mutace: gain-of-function alterace - > biologický poločas WIP1 (in vitro) - funkční inaktivace p53 (ztráta G1-S kontrolního bodu) - zvýšená tolerance poškození DNA (?) - kancerogeneze (?) Kleiblova et al. J Cell Biol 2013

25 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu 6 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116) Trunkační mutace: gain-of-function alterace - > biologický poločas WIP1 (in vitro) - funkční inaktivace p53 (ztráta G1-S kontrolního bodu) - zvýšená tolerance poškození DNA (?) - kancerogeneze (?) U pacientů se tyto mutace vyskytují jako mozaiky Ruark et al. Nature 2013; Kleiblova et al. J Cell Biol 2013

26 Význam mutací genu PPM1D (WIP1) Trunkační mutace postihují výlučně oblast exonu 6 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116) Trunkační mutace: gain-of-function alterace - > biologický poločas WIP1 (in vitro) - funkční inaktivace p53 (ztráta G1-S kontrolního bodu) - zvýšená tolerance poškození DNA (?) - kancerogeneze (?) U pacientů se tyto mutace vyskytují jako mozaiky - Způsob vzniku? - Přenos na další generace? - Klinický význam? Ruark et al. Nature 2013; Kleiblova et al. J Cell Biol 2013

27 Význam mutací genu PPM1D (WIP1) Nejasný mechanizmus a penetrance Negativní Geny se střední penetrancí Geny s vysokou penetrancí

28 Poděkování Ústav biochemie a exp. onkologie, 1. LF UK - Jan Ševčík - Petr Pohlreich - Zdeněk Kleibl Ústav patologie, 1. LF UK - Pavel Dundr Odd. biologie nádorové buňky, ÚMG AVČR - Libor Macůrek - Jan Benada - Soňa Pecháčková - Jiří Bártek The Netherlands Cancer Institute - Indra A. Shaltiel - Emile E. Voest - René H. Medema Grant IGA MZ ČR: NT

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013 Lékařská genetika a onkologie Renata Gaillyová OLG a LF MU Brno 2012/2013 *genetické souvislosti *onkogenetická vyšetření u onkologických onemocnění * genetické vyšetření u hereditárních nádorů *presymptomatické

Více

Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární

Více

Výuka genetiky na Přírodovědecké fakultě MU

Výuka genetiky na Přírodovědecké fakultě MU MASARYKOVA UNIVERZITA Přírodovědecká fakulta Výuka genetiky na Přírodovědecké fakultě MU Jiří Doškař Ústav experimentální biologie, Oddělení genetiky a molekulární biologie 1 V akademickém roce 1964/1965

Více

Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Přehled výzkumných aktivit

Přehled výzkumných aktivit Přehled výzkumných aktivit ROK 2004 Lenka Zahradová Laboratoř experimentální hematologie a buněčné imunoterapie Oddělení klinické hematologie FNB Bohunice Přednosta: prof. MUDr. M. Penka, CSc. Oddělení

Více

,, Cesta ke zdraví mužů

,, Cesta ke zdraví mužů PREZENTACE VÝSLEDKŮ ŘEŠENÍ PILOTNÍHO PROJEKTU PREVENTIVNÍ PÉČE PRO MUŢE,, Cesta ke zdraví mužů prim. MUDr. Monika Koudová GHC GENETICS, s.r.o.- NZZ, Praha Projekt byl realizován ve dvou etapách: I. etapa

Více

Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.

Více

Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE

Více

Liga proti rakovině Praha

Liga proti rakovině Praha Liga proti rakovině Praha 22 let činnosti Ligy Prof. MUDr. Zdeněk Dienstbier, DrSc. Tři hlavní dlouhodobé programy: Soustavná informovanost veřejnosti o nádorové prevenci Snaha o zlepšení kvality života

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

Můj život s genetikou

Můj život s genetikou Můj život s genetikou Aneta Mikulášová Molekulární biologie a genetika Přírodovědecká fakulta Masarykova univerzita Univerzitní vzdělávání genetiky 150 roků po Mendelovi Brno, 29. 5. 2015 Studium Molekulární

Více

OBOROVÁ RADA BIOCHEMIE A PATOBIOCHEMIE

OBOROVÁ RADA BIOCHEMIE A PATOBIOCHEMIE OBOROVÁ RADA BIOCHEMIE A PATOBIOCHEMIE Předseda: Stanislav Štípek, prof., MUDr., DrSc. Ústav lékařske biochemie a laboratorní disgnostiky 1. LF UK Kateřinská 32, 121 08 Praha 2 tel.: 224 964 283 fax: 224

Více

DEN OTEVŘENÝCH DVEŘÍ NA ÚMG

DEN OTEVŘENÝCH DVEŘÍ NA ÚMG DEN OTEVŘENÝCH DVEŘÍ NA ÚMG Místo konání: Datum a doba konání: Budova F, Vídeňská 1083, 142 20 Praha 4-Krč 31. 10. 2014 od 9:00 do 16:00 hod. Kontakt pro styk s veřejností: Organizační záležitosti: Leona

Více

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem

Více

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100% F8 - hemofilie A monogenní

Více

MATEMATICKÁ BIOLOGIE

MATEMATICKÁ BIOLOGIE INSTITUT BIOSTATISTIKY A ANALÝZ Lékařská a Přírodovědecká fakulta, Masarykova univerzita MATEMATICKÁ BIOLOGIE Přírodovědecká fakulta Masarykova univerzita, Brno Studijní obor Matematická biologie Masarykova

Více

Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu

Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Srovnal J. 1, Cincibuch J. 2, Cwierkta K. 2, Melichar B. 2, Aujeský R. 3, Vrba R.

Více

VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CMG CZECH GROUP M Y E L O M A Č ESKÁ MYELOMOVÁ SKUPINA

VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CMG CZECH GROUP M Y E L O M A Č ESKÁ MYELOMOVÁ SKUPINA VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CZECH CMG M Y E L O M A GROUP Č ESKÁ MYELOMOVÁ SKUPINA Zhodnocení spolupráce Přehled molekulárně cytogenetických

Více

Modul obecné onkochirurgie

Modul obecné onkochirurgie Modul obecné onkochirurgie 1. Principy kancerogeneze, genetické a epigenetické faktory 2. Onkogeny, antionkogeny, reparační geny, instabilita nádorového genomu 3. Nádorová proliferace a apoptóza, důsledky

Více

seminář ENTOG, 8.10. 2005

seminář ENTOG, 8.10. 2005 Karcinom vaječníků seminář ENTOG, 8.10. 2005 MUDr. Michal Zikán, PhD. Gynekologicko-porodnická klinika 1. LF UK a VFN Ústav biochemie a experimentální onkologie 1. LF UK Incidence 25,3 / 100 000 1323 případů

Více

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno Zpracování a využití biologického materiálu pro výzkumné účely od nemocných s monoklonální gamapatií Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie,

Více

TARCEVA klinický registr

TARCEVA klinický registr TARCEVA klinický registr Karcinom pankreatu Stav k datu 10. 4. 2011 Registr Tarceva je podporován výzkumným ý grantem firmy Roche. Česká onkologická společnost Institut biostatistiky a analýz Stav registru

Více

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza Iveta Valášková ivalskova@fnbrno.cz Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza nejčastěji se vyskytující autozomálně recesivní dědičná metabolická porucha v zakavkazské

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Co se děje v genetické laboratoři?

Co se děje v genetické laboratoři? 12 Co se děje v genetické laboratoři? Tento letáček byl vytvořen s pomocí Dr Iana M Fraylinga, Institute of Medical Genetics, University Hospital of Wales, Cardiff, UK; Dr Domenica Coviella, Laboratory

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Nelékařské obory: 2. ročník 1.LF UK ECMO ve fakultní nemocnici Plzeň. Mimořádná cena GALEN: Bc. Hana Buriánková

Nelékařské obory: 2. ročník 1.LF UK ECMO ve fakultní nemocnici Plzeň. Mimořádná cena GALEN: Bc. Hana Buriánková Nelékařské obory: Bc. Lada Zlochová 2. ročník 1.LF UK ECMO ve fakultní nemocnici Plzeň Mimořádná cena GALEN: Bc. Hana Buriánková 2. ročník 1.LF UK Informovanost veřejnosti o problematice darování kostní

Více

NÁDOROVÁ RIZIKA. poznejme OBSAH

NÁDOROVÁ RIZIKA. poznejme OBSAH poznejme NÁDOROVÁ RIZIKA OBSAH Úvod... 3 Proč bychom se měli dozvědět o svých vlastních rizicích?... 4 Jaké jsou naše služby?... 4 Kdo by měl být vyšetřen?... 5 Jaký je postup při vyšetřování?... 6 Informace

Více

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty J.Berkovcová, M.Dziechciarková, M.Staňková, A.Janošťáková, D.Dvořáková, M.Hajdúch Laboratoř

Více

Interaktivní nástroje pro výuku léčebných standardů cytostatické léčby zhoubných nádorů Portál DIOS

Interaktivní nástroje pro výuku léčebných standardů cytostatické léčby zhoubných nádorů Portál DIOS Interaktivní nástroje pro výuku léčebných standardů cytostatické léčby zhoubných nádorů Portál DIOS Klimeš D., Dušek L., Kubásek J., Fínek J., Petruželka L., Zoláková A., Vyzula R. Historie projektu Snaha

Více

VÝZNAM REGULACE APOPTÓZY V MEDICÍNĚ

VÝZNAM REGULACE APOPTÓZY V MEDICÍNĚ REGULACE APOPTÓZY 1 VÝZNAM REGULACE APOPTÓZY V MEDICÍNĚ Příklad: Regulace apoptózy: protein p53 je klíčová molekula regulace buněčného cyklu a regulace apoptózy Onemocnění: více než polovina (70-75%) nádorů

Více

Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc

Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie a myelodysplastický syndrom Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie (AL) Představují heterogenní skupinu chorob charakterizovaných kumulací klonu nevyzrálých, nádorově

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

Výroční zpráva Společnosti lékařské genetiky ČLS JEP za rok 2006

Výroční zpráva Společnosti lékařské genetiky ČLS JEP za rok 2006 Výroční zpráva Společnosti lékařské genetiky ČLS JEP za rok 2006 Výbor Společnosti lékařské genetiky si dovoluje předložit svým členům Výroční zprávu za rok 2006. Tato zpráva je stručným výčtem aktivit

Více

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11.

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. Personalizovaná medicína Roche v oblasti onkologie Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. listopadu 2013 Personalizovaná vs standardní péče Cílená léčba Spojení diagnostiky

Více

Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň

Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň Laboratoř uplatňuje flexibilní přístup k rozsahu akreditace upřesněný v dodatku. Aktuální seznam činností prováděných v rámci požadovaného flexibilního rozsahu je k dispozici na webových stránkách laboratoře

Více

Rozbor léčebné zátěže Thomayerovy nemocnice onkologickými pacienty a pilotní prezentace výsledků péče

Rozbor léčebné zátěže Thomayerovy nemocnice onkologickými pacienty a pilotní prezentace výsledků péče Rozbor léčebné zátěže Thomayerovy nemocnice onkologickými pacienty a pilotní prezentace výsledků péče Výstupy analýzy dat zdravotnického zařízení a Národního onkologického registru ČR Prof. MUDr. Jitka

Více

MODERNÍ VÝUKA ONKOLOGIE JAKO SOUČÁST NÁRODNÍHO ONKOLOGICKÉHO PROGRAMU. J. Vorlíček Česká onkologická společnost ČLS JEP

MODERNÍ VÝUKA ONKOLOGIE JAKO SOUČÁST NÁRODNÍHO ONKOLOGICKÉHO PROGRAMU. J. Vorlíček Česká onkologická společnost ČLS JEP MODERNÍ VÝUKA ONKOLOGIE JAKO SOUČÁST NÁRODNÍHO ONKOLOGICKÉHO PROGRAMU J. Vorlíček Česká onkologická společnost ČLS JEP I. Proč je v současné onkologii tak potřebná výuka S čím dnes musí počítat řízení

Více

Současné trendy v epidemiologii nádorů se zaměřením na Liberecký kraj

Současné trendy v epidemiologii nádorů se zaměřením na Liberecký kraj Institut biostatistiky a analýz, Lékařská a přírodovědecká fakulta, Masarykova univerzita, Brno Současné trendy v epidemiologii nádorů se zaměřením na Mužík J. Epidemiologie nádorů v ČR Epidemiologická

Více

Informace VZP ČR k indikaci a vykazování laboratorních genetických vyšetření (odbornost 816)

Informace VZP ČR k indikaci a vykazování laboratorních genetických vyšetření (odbornost 816) Příloha č.1 Informace VZP ČR k indikaci a vykazování laboratorních genetických vyšetření (odbornost 816) Upozorňujeme smluvní partnery, lékaře i laboratoře, na základní pravidla a postupy při indikaci

Více

Biologická léčba karcinomu prsu. Prof. MUDr. Jitka Abrahámová, DrSc. Onkologická klinika 1.LF UK a TN KOC (NNB+VFN+TN)

Biologická léčba karcinomu prsu. Prof. MUDr. Jitka Abrahámová, DrSc. Onkologická klinika 1.LF UK a TN KOC (NNB+VFN+TN) Biologická léčba karcinomu prsu Prof. MUDr. Jitka Abrahámová, DrSc. Onkologická klinika 1.LF UK a TN KOC (NNB+VFN+TN) Cílená léčba Ca prsu Trastuzumab (HercepNn) AnN HER2 neu pronlátka LapaNnib (Tyverb)

Více

Lékařská sekce... 3 Středa 22. 1. 2014... 3 17:00 18:30 Aktuálně z kongresu ASCO GIT 2014 HOT NEWS... 3 Čtvrtek 23. 1. 2014... 3 08:30 Slavnostní

Lékařská sekce... 3 Středa 22. 1. 2014... 3 17:00 18:30 Aktuálně z kongresu ASCO GIT 2014 HOT NEWS... 3 Čtvrtek 23. 1. 2014... 3 08:30 Slavnostní Lékařská sekce... 3 Středa 22. 1. 2014... 3 17:00 18:30 Aktuálně z kongresu ASCO GIT 2014 HOT NEWS... 3 Čtvrtek 23. 1. 2014... 3 08:30 Slavnostní zahájení... 3 09:00 10:30 State of Art v onkologii... 3

Více

Pavlína Tinavská Laboratoř imunologie, Nemocnice České Budějovice

Pavlína Tinavská Laboratoř imunologie, Nemocnice České Budějovice Pavlína Tinavská Laboratoř imunologie, Nemocnice České Budějovice nízce agresivní lymfoproliferativní onemocnění základem je proliferace a akumulace klonálních maligně transformovaných vyzrálých B lymfocytů

Více

Léčebné predikce u karcinomu prsu pro rok 2013 chystané novinky

Léčebné predikce u karcinomu prsu pro rok 2013 chystané novinky Léčebné predikce u karcinomu prsu pro rok 2013 chystané novinky Prof. MUDr. Jitka Abrahámová, DrSc Onkologická klinika TN a 1. LF UK KOC (NNB + VFN + TN) St Gallén 2011 Rozsah onemocnění T, N, M ER, PgR

Více

Výroční zpráva Nadačního fondu Pomoc lidem s leukémií při Interní hematoonkologické klinice FN Brno za rok 2014

Výroční zpráva Nadačního fondu Pomoc lidem s leukémií při Interní hematoonkologické klinice FN Brno za rok 2014 Výroční zpráva Nadačního fondu Pomoc lidem s leukémií při Interní hematoonkologické klinice FN Brno za rok 2014 I.Úvod Sídlo: Jihlavská 20, 625 00, Brno Registrace: zapsaný od 2. března 1999 v nadačním

Více

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Centrum nádorové cytogenetiky Ústav klinické biochemie a laboratorní diagnostiky VFN a 1. LF UK v Praze Klinický význam cytogenetických

Více

UPOZORNĚNÍ PRO STUDENTY

UPOZORNĚNÍ PRO STUDENTY UPOZORNĚNÍ PRO STUDENTY Abychom vyhověli žádostem zřad studentů, předkládáme textovou část prezentací vybraných přednášek z patologie pro usnadnění orientace v přednášené látce. Nejedná se v žádném ohledu

Více

Život s karcinomem ledviny

Život s karcinomem ledviny Život s karcinomem ledviny Život s karcinomem ledviny není lehký. Ale nikdo na to nemusí být sám. Rodina, přátelé i poskytovatelé zdravotní péče, všichni mohou pomoci. Péče o pacienta s karcinomem buněk

Více

Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku

Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku 22. ledna 2015 EMA/PRAC/63322/2015 Farmakovigilanční výbor pro posuzování rizik léčiv Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku

Více

Příčiny a projevy abnormálního vývoje

Příčiny a projevy abnormálního vývoje Příčiny a projevy abnormálního vývoje Ústav histologie a embryologie 1. LF UK v Praze MUDr. Filip Wagner Předmět: Obecná histologie a obecná embryologie (B02241) 1 Vrozené vývojové vady vývojové poruchy

Více

Výsledky CRP MEFANET 2009 na 3.LF UK v Praze

Výsledky CRP MEFANET 2009 na 3.LF UK v Praze 3. lékařská fakulta Univerzita Karlova v Praze Výsledky CRP MEFANET 2009 na 3.LF UK v Praze E. Kvašňák Konference MEFANET 2009, Brno 26.11.2009 Obecná předsevzetí na r.2009 Zaškolit pedagogy v tvorbě e-kurzů

Více

FLUORESCENČNÍ MIKROSKOP

FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po

Více

Nádorové prediktivní testování

Nádorové prediktivní testování Nádorové prediktivní testování Informace pro pacienty a rodiny 2 Nádorové prediktivní testování Toto je informace o prediktivním genetickém testování u dědičných nádorových onemocnění. Napsali jsme ji

Více

VITAMIN D Z POHLEDU FUNKCE A VÝŽIVY

VITAMIN D Z POHLEDU FUNKCE A VÝŽIVY VITAMIN D Z POHLEDU FUNKCE A VÝŽIVY Mgr. Jitka Pokorná, Prof. MVDr. Jiří Ruprich, CSc. Státní zdravotní ústav, Centrum zdraví, výživy a potravin Palackého 3a, 612 42 Brno www.szu.cz, e-mail: pokorna@chpr.szu.cz

Více

Systém podpory prevence vybraných nádorových onemocnění v ČR screeningové programy

Systém podpory prevence vybraných nádorových onemocnění v ČR screeningové programy Příloha č. 4 - Vzorové dopisy a) Přední strana Zde vedle loga MZ Vážený pane, muž varianta 1 (50-70 let; bez K) neabsolvoval toto pro Vaše zdraví důležité preventivní vyšetření: V České republice každoročně

Více

Vliv moderních operačních metod na indikaci lázeňské péče

Vliv moderních operačních metod na indikaci lázeňské péče Michálkovická 18, Slezská Ostrava Vliv moderních operačních metod na indikaci lázeňské péče Bouřlivý rozvoj medicíny, jehož jsme v posledních několika desetiletích svědky, s sebou přináší nové operační

Více

INOVATIVNÍ KURZY IMUNOANALÝZY A ENDOKRINOLOGIE PRO VĚDECKÉ PRACOVNÍKY- PILOTNÍ ZKUŠENOSTI LÉKAŘSKÉ FAKULTY V PLZNI

INOVATIVNÍ KURZY IMUNOANALÝZY A ENDOKRINOLOGIE PRO VĚDECKÉ PRACOVNÍKY- PILOTNÍ ZKUŠENOSTI LÉKAŘSKÉ FAKULTY V PLZNI INOVATIVNÍ KURZY IMUNOANALÝZY A ENDOKRINOLOGIE PRO VĚDECKÉ PRACOVNÍKY- PILOTNÍ ZKUŠENOSTI LÉKAŘSKÉ FAKULTY V PLZNI RNDr. Marie Karlíková, PhD. Prof. MUDr. Ondřej Topolčan, CSc. Univerzita Karlova - Lékařská

Více

Onkologické centrum Fakultní nemocnice Královské Vinohrady

Onkologické centrum Fakultní nemocnice Královské Vinohrady Onkologické centrum Fakultní nemocnice Královské Vinohrady Historie: Onkologické oddělení bylo otevřeno v nemocnici Na Královských Vinohradech již v roce 1949 a později se stalo součástí Radiologické kliniky

Více

Maligní fibrózní histiocytom retroperitonea u mladého nemocného

Maligní fibrózní histiocytom retroperitonea u mladého nemocného Maligní fibrózní histiocytom retroperitonea u mladého nemocného Hána L., Pudil J., Bělina F., Buřič I.*, Martínek J.** Chirurgická klinika ÚVN a 2. LF UK *Radiodiagnostické oddělení ÚVN **Interní klinika

Více

Liga proti rakovině Praha

Liga proti rakovině Praha Liga proti rakovině Praha 24 let činnosti Ligy proti rakovině Praha Hlavní cíl snížení úmrtnosti na nádorová onemocnění v České republice Tři hlavní dlouhodobé programy: Soustavná informovanost veřejnosti

Více

Studie zdravotního stavu dětí

Studie zdravotního stavu dětí Studie zdravotního stavu dětí z Radvanic a Bartovic Miroslav Dostál Ústav experimentální mediciny AV ČR, v.v.i., Praha 1 Zdravotní stav dětí Cíl porovnat zdravotní stav dětí žijících v Radvanicích & Bartovicích

Více

Adobe Captivate Wednesday, January 09, 2013. Slide 1 - Zhoubné nádory u dětí epidemiologie, odlišnosti od nádorů dospělých, nádorové markery

Adobe Captivate Wednesday, January 09, 2013. Slide 1 - Zhoubné nádory u dětí epidemiologie, odlišnosti od nádorů dospělých, nádorové markery Slide 1 - Zhoubné nádory u dětí epidemiologie, odlišnosti od nádorů dospělých, nádorové markery Page 1 of 45 Slide 2 - Zastoupení nádorů u dětí Page 2 of 45 Slide 3 - Epidemiologie nádorů dětského věku

Více

Program na podporu zdravotnického aplikovaného výzkumu na léta 2015 2022

Program na podporu zdravotnického aplikovaného výzkumu na léta 2015 2022 Program na podporu zdravotnického aplikovaného výzkumu na léta 2015 2022 Ukončení příjmů projektů: 30. 6. 2015 Délka trvání řešení projektů: 45 měsíců Místo realizace: Celá ČR Oblast působení: Výzkum a

Více

Výroční zpráva Společnosti lékařské genetiky ČLS JEP za rok 2009

Výroční zpráva Společnosti lékařské genetiky ČLS JEP za rok 2009 Výroční zpráva Společnosti lékařské genetiky ČLS JEP za rok 2009 Výbor Společnosti lékařské genetiky si dovoluje předložit svým členům Výroční zprávu za rok 2009. Tato zpráva je stručným výčtem aktivit

Více

PROGRAM ACTIVITYDETERMINATION PRO DOPORUČENÍ AKTIVITY 131 I PRO LÉČBU PACIENTŮ S DIFERENCOVANÝM KARCINOMEM ŠTÍTNÉ ŽLÁZY

PROGRAM ACTIVITYDETERMINATION PRO DOPORUČENÍ AKTIVITY 131 I PRO LÉČBU PACIENTŮ S DIFERENCOVANÝM KARCINOMEM ŠTÍTNÉ ŽLÁZY PROGRAM ACTIVITYDETERMINATION PRO DOPORUČENÍ AKTIVITY 131 I PRO LÉČBU PACIENTŮ S DIFERENCOVANÝM KARCINOMEM ŠTÍTNÉ ŽLÁZY DEMONSTRACE PROGRAMU J.ZIMÁK, P. VLČEK, J. VEJVALKA, K. PERSONOVÁ, K. TÁBORSKÁ KLINIKA

Více

Benefiční výstava pro Nadaci Rakovina věc veřejná Pavel Grégr, Martin Paladino, Ondřej Růžička

Benefiční výstava pro Nadaci Rakovina věc veřejná Pavel Grégr, Martin Paladino, Ondřej Růžička Benefiční výstava pro Nadaci Rakovina věc veřejná Pavel Grégr, Martin Paladino, Ondřej Růžička 4. 11. 2009 23. 12. 2009 Restaurace Fluidum Lucemburská 6, Praha 3-Vinohrady Pavel Grégr, Léto 100x120 cm

Více

úč úč ž ů ž Č Č č č ů ž úč č úč ť Ň č ú Ý č č Ú Ú ť ú č ď ů ž š úč ž úč úč ž ť ď ť ď ž ú č č úč š ž Ů č č ú úč ž ů ť úč ž ž ž Ů č ž ú č Š úč č Úč Č Č š ď š Š š Ó Ó ž ůč ú Ď ť ž ů ů č ů Č ů ž úč Ý č ž úč

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

Evropský den onemocnění prostaty 15. září 2005 Aktivita Evropské urologické asociace a České urologické společnosti

Evropský den onemocnění prostaty 15. září 2005 Aktivita Evropské urologické asociace a České urologické společnosti Evropský den onemocnění prostaty 15. září 2005 Aktivita Evropské urologické asociace a České urologické společnosti prim. MUDr. Jan Mečl Urologické oddělení Krajská nemocnice Liberec Co je to prostata?

Více

O původu života na Zemi Václav Pačes

O původu života na Zemi Václav Pačes O původu života na Zemi Václav Pačes Ústav molekulární genetiky Akademie věd ČR centrální dogma replikace transkripce DNA RNA protein reverzní transkripce translace informace funkce Exon 1 Intron (413

Více

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor Moto: Nejvyšším štěstím každé rodiny je zdravé dítě Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor ČLK, 14. února 2013 Úvod Od poznání možností, které nám nabízí prenatální diagnostika, se embryo či později

Více

PŘEHLEDOVÉ ČLÁNKY. Lenka Foretová Oddělení epidemiologie a genetiky nádorů, Masarykův onkologický ústav, Brno

PŘEHLEDOVÉ ČLÁNKY. Lenka Foretová Oddělení epidemiologie a genetiky nádorů, Masarykův onkologický ústav, Brno GENETIKA NÁDORŮ PRSU Lenka Foretová Oddělení epidemiologie a genetiky nádorů, Masarykův onkologický ústav, Brno Nádorová onemocnění prsu se v 5 10 % případů vyskytují na podkladě monogenní dědičné dispozice.

Více

STUDIE 2014 KLINIKA ONKOLOGIE A RADIOTERAPIE AKTIVNÍ NÁBOR PACIENTŮ

STUDIE 2014 KLINIKA ONKOLOGIE A RADIOTERAPIE AKTIVNÍ NÁBOR PACIENTŮ STUDIE 2014 KLINIKA ONKOLOGIE A RADIOTERAPIE AKTIVNÍ NÁBOR PACIENTŮ KARCINOM PRSU Spoluzkoušející: MUDr.Iva Slánská, MUDr.Peter Priester,MUDr.Adam Paulík Název studie : PH3-01 Studie Present Prevence recidivy

Více

Epidemiologie zhoubných nádorů. regionu v rámci r. Mužík J. Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti

Epidemiologie zhoubných nádorů. regionu v rámci r. Mužík J. Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Institut biostatistiky a analýz Lékařská a Přírodovědecká fakulta Masarykova univerzita, Brno Evropský sociální fond & EU: Investujeme do vaší budoucnosti Epidemiologie nádorů rekta (dg. C0) - pozice Pražsk

Více

Informace pro pacienty a rodiny

Informace pro pacienty a rodiny 16 Nádorové prediktivní testování Vytvořila skupina The Genetic Interest Group. Překlad: Ústav biologie a lékařské genetiky UK 2. LF a FN v Motole Únor 2009 Ilustrace: Rebecca J Kent www.rebeccajkent.com

Více

Genetická "oblast nejasnosti" u HCH: co to znamená? Genetický základ

Genetická oblast nejasnosti u HCH: co to znamená? Genetický základ Novinky ve výzkumu Huntingtonovy nemoci. Ve srozumitelném jazyce. Napsáno vědci. Určeno široké huntingtonské veřejnosti. Genetická "oblast nejasnosti" u HCH: co to znamená? Přechodní alely a alely s redukovanou

Více

Buněčné kultury. Kontinuální kultury

Buněčné kultury. Kontinuální kultury Buněčné kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace

Více

Semestrální přednášky a kurzy ve školním roce 2013/2014

Semestrální přednášky a kurzy ve školním roce 2013/2014 Semestrální přednášky a kurzy ve školním roce 2013/2014 Základy molekulární biologie - 17AMBZMB, zimní semestr (ZS), 2+2 hod. týdně, Fakulta biomedicínského inženýrství (FBMI), ČVUT v Praze. Kurz seznamuje

Více

Rakovina tlustého stfieva a koneãníku. Doc. MUDr. Jitka Abrahámová, DrSc. MUDr. Ludmila Boublíková MUDr. Drahomíra Kordíková

Rakovina tlustého stfieva a koneãníku. Doc. MUDr. Jitka Abrahámová, DrSc. MUDr. Ludmila Boublíková MUDr. Drahomíra Kordíková TRITON Rakovina tlustého stfieva a koneãníku Doc. MUDr. Jitka Abrahámová, DrSc. MUDr. Ludmila Boublíková MUDr. Drahomíra Kordíková Jitka Abrahámová, Ludmila Boublíková, Drahomíra Kordíková Rakovina tlustého

Více

ÚVOD DO PROBLEMATIKY DĚTSKÉ ONKOLOGIE

ÚVOD DO PROBLEMATIKY DĚTSKÉ ONKOLOGIE ÚVOD DO PROBLEMATIKY DĚTSKÉ ONKOLOGIE prof. MUDr. Štěrba Jaroslav, Ph.D. Klinika dětské onkologie LF MU a FN Brno Dětská onkologie na počátku třetího tisícií Každý rok je v ČR diagnostikováno více než

Více

UROLOGY WEEK 2012 Urologická klinika VFN a 1. LF UK v Praze

UROLOGY WEEK 2012 Urologická klinika VFN a 1. LF UK v Praze Urologická klinika VFN a 1. LF UK v Praze MUDr. Libor Zámečník, Ph.D., FEBU Urologická klinika VFN a 1. LF UK v Praze přednosta prof. MUDr. Tomáš Hanuš, DrSc. Urologická klinika VFN a 1. LF UK se letos

Více

KOLOREKTÁLNÍ KARCINOM: VÝZVA PRO ZDRAVÝ ŽIVOTNÍ STYL, SCREENING A ORGANIZACI LÉČEBNÉ PÉČE

KOLOREKTÁLNÍ KARCINOM: VÝZVA PRO ZDRAVÝ ŽIVOTNÍ STYL, SCREENING A ORGANIZACI LÉČEBNÉ PÉČE KOLOREKTÁLNÍ KARCINOM: VÝZVA PRO ZDRAVÝ ŽIVOTNÍ STYL, SCREENING A ORGANIZACI LÉČEBNÉ PÉČE Brno, 29. května 2015: Moravská metropole se již počtvrté stává hostitelem mezinárodní konference Evropské dny

Více

Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) www.uhkt.cz/nrl/db Chromosomové změny Unique - Britská svépomocná skupina

Více

Chirurgické možnosti řešení rhabdomyosarkomu pánve u mladé pacientky v rámci multimodálního přístupu

Chirurgické možnosti řešení rhabdomyosarkomu pánve u mladé pacientky v rámci multimodálního přístupu Chirurgické možnosti řešení rhabdomyosarkomu pánve u mladé pacientky v rámci multimodálního přístupu Macík D. 1, Doležel J. 1, Múdry P. 2, Zerhau P. 3, Staník M. 1, Čapák I. 1 1 ODDĚLENÍ UROLOGICKÉ ONKOLOGIE,

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

ř š ú š Č š ž ř š Š Š Í ú š ď ř š ú Š ů ú ř ř ř ř ů ř Ž š ů ú ů ř Š Š Š ř ů řň ň řň řň ů ř ř š Í ř ř ř ř ř ř ř ř Ž Ž ř ú ů ú ú š Ú ú ú Í Ž Ž ů Ž Ž Č ň Ú řš ř řš ú Ž ú ť ň Í ř ř ů ť š š ř Í řš ú Ý Í ť ú

Více

Bioinformatika. hledání významu biologických dat. Marian Novotný. Friday, April 24, 15

Bioinformatika. hledání významu biologických dat. Marian Novotný. Friday, April 24, 15 Bioinformatika hledání významu biologických dat Marian Novotný Bioinformatika sběr biologických dat archivace biologických dat organizace biologických dat interpretace biologických dat 2 Biologové sbírají

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 10 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 26.06.2014 Ročník: 6AF, 6BF Anotace DUMu: Procesy následující bezprostředně po transkripci.

Více

VZTAHY AMBULANTNÍCH LÉKAŘŮ A LABORATORNÍ MEDICÍNY

VZTAHY AMBULANTNÍCH LÉKAŘŮ A LABORATORNÍ MEDICÍNY VZTAHY AMBULANTNÍCH LÉKAŘŮ A LABORATORNÍ MEDICÍNY Bohumil Seifert Ústav všeobecného lékařství 1. LF UK v Praze Společnost všeobecného lékařství ČLS JEP 22. září 2014 FONS 2014 Osnova Ambulantní / praktický

Více

Zjišťování toxicity látek

Zjišťování toxicity látek Zjišťování toxicity látek 1. Úvod 2. Literární údaje 3. Testy in vitro 4. Testy na zvířatech in vivo 5. Epidemiologické studie 6. Zjišťování úrovně expozice Úvod Je známo 2 10 7 chemických látek. Prostudování

Více

Vzdělávací program specializačního vzdělávání v oboru

Vzdělávací program specializačního vzdělávání v oboru Vzdělávací program specializačního vzdělávání v oboru 1 Cíl specializačního vzdělávání... 2 2 Minimální požadavky na specializační vzdělávání... 2 2.1 Základní kmen pro klinické laboratorní obory klinická

Více