Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC"

Transkript

1 Analýza DNA

2 Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace, které se vyskytují v populaci s frekvencí vyšší než % Podobnost DNA mezi druhy Vlastnosti - koncentraci, čistotu, chemické vazby s proteiny, funkci ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

3 DNA Izolace Detekce DNA Specifické analýzy DNA struktury Hlavní metody pro práci s DNA: PCR sekvenace RFLP DNA hybridizace - blotting

4 Biologický materiál pro izolaci DNA Teoreticky z jakéhokoliv dostupného biologického materiálu (s jádrem)

5 Izolace DNA Specifické postupy pro získání molekul DNA v takové čistotě a koncentraci, aby mohly být dále analyzovány běžně dostupnými molekulárně biologickými metodami

6 Mutace v sekvencích ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC ACGGTCGACTGCGATACTCCC Normální sekvence Jednobodová záměna (SNP) Inzerce TT Delece GA (7. a 8. odzadu)

7 PCR polymerase chain reaction Nobelova cena za její objev v roce 984 Obdoba DNA replikace, která se odehrává v buňkách Amplifikace (zmnožení) vybraných úseků DNA U oblasti, kterou se snažíme amplifikovat musíme znát sekvenci koncových částí 3 Cyklické střídání teplotních kroků Denaturace dvoušroubovice se oddělí na jednotlivá vlákna (teplota; chemická činidla) Annealing (anýlink) navázání primerů ke koncové oblasti vybraného úseku (oligonukleotidy jednovláknové řetězce; cca 20bp ) Elongace prodloužení primeru vkládáním jednotlivých dntp (A,G,C,T) na základě komplementarity k templátové DNA primer

8 Princip PCR Teplotní denaturace Annealing primerů Elongace Teplotní denaturace Annealing primerů Elongace

9 PRINCIP METODY PCR ( MOLEKULA) DENATURACE. CYKLUS PRIMERY Taq POLYMERÁZA (2 MOLEKULY) DENATURACE PRIMERY 2. CYKLUS Taq POLYMERÁZA (4 MOLEKULY) 3. CYKLUS DENATURACE PRIMERY Taq POLYMERÁZA (8 MOLEKUL) 4. CYKLUS (6 MOLEKUL) 5. CYKLUS (32 MOLEKUL)

10 PCR V reakci: templát (DNA), Taqpolymerasa (teplotně stabilní), primery, dntp (jednotlivé dideoxynukleotidy) a vhodný pufr Z jednoho cílového úseku DNA (určený primery) vznikne po cyklu denaturace, annealingu a elongace vždy dvojnásobek DNA fragmentů (velikost fragmentu je dána primery) Možno vyjádřit matematicky 2 n kde n je počet cyklů Kolik bude DNA fragmentů po 8 PCR cyklech? 2 8 = 256

11 Elektroforéza Metoda, která slouží k rozdělení DNA fragmentů o nestejné délce DNA má celkově slabě negativní náboj a v elektrickém poli putuje ke kladné elektrodě Rychlost putování je závislá na její celkové délce Gel (agaróza, polyakrylamid) je ponořen do vhodného pufru mezi elektrody V gelu u záporné elektrody jsou jamky pro vzorky DNA Stejnosměrný elektrický proud Vizualizace fragmentů se provádí např. ethidiumbromidem (interkalačního činidla), které svítí v UV světle

12 Sekvenace - Sangerova metoda Zjištění konkrétní sekvence vybraného úseku DNA řetězce Fragmenty DNA (řetězce) - rozlišení ve své délce i o jeden nukleotid Sangerova metoda - chemicky modifikované dntp (deoxyribonukleosidtrifosfáty) na ddntp (dideoxyribonukleosidtrifosfáty) ddntp postrádají 3'-OH skupinu; za ddntp si při elongaci už nemůže přisednout žádný dntp - dojde k terminaci elongace PCR reakce: a) zkoumaný fragment DNA; pufr, DNA-polymerasa a mix normálních dntp b) radioaktivně značený primer pro jedno vlákno DNA, c) sekvenace se odehrává ve 4 reakčních směsích (ddatp; ddttp; ddctp; ddgtp - odlišně fluorescenčně značeny); Elektroforetická detekce fragmentů v gelu

13 3' 5' Analyzovaná DNA (jednovláknová) 5' * 3' Značený primer DNA-polymerasa, primer, nukleotidy - rozdělení do čtyř zkumavek. Přidány jednotlivé ddntp: ddatp, ddctp, ddgtp, ddttp PCR syntéza komplementárního vlákna (značeno barevně pro jednotlivé ddntp) ve směru 5' 3' * A * C G * * T * A * C * G * T * A * C * G * T Elektroforéza A C G T - + Výsledná sekvence na syntetizovaném vlákně: 5'- C T A G T A G G T C C A - 3' Sekvence analyzované DNA (komplementarita párování basí): 3'- G A T C A T C C A G G T - 5'

14 Sekvenace - Sanger AAGTCCGATCGTTAGCTTCCGAATTGCATGGCAACTGCAGATCGATGCAAGTGCCGATC TTCAGGCTAGCAATCGAAGGCTTAACGTACCGTTGACGTCTAGCTACGTTCACGGCTAG začne probíhat sekvenační PCR s mixem dntp a fluoresčenčně značenými ddntp AAGTCCGATCGTTAGCTTC AAGTCCGATCGTTAGCTTCC AAGTCCGATCGTTAGCTTCCG AAGTCCGATCGTTAGCTTCCGA AAGTCCGATCGTTAGCTTCCGAA AAGTCCGATCGTTAGCTTCCGAAT AAGTCCGATCGTTAGCTTCCGAATT AAGTCCGATCGTTAGCTTCCGAATTG AAGTCCGATCGTTAGCTTCCGAATTGC Nejkratší fragment ve schématu bude svítit červenou barvou a nejdelší také červenou Speciální elektroforéza s laserovou detekcí fluorescenčně barvených ddntp

15 Restrikční endonukleázy - restriktázy Enzymy, které štípou dvouvláknovou molekulu DNA uvnitř řetězce a to vždy v konkrétní pozici, charakteristické pro danou restriktázu (restrikční místo) Např. Eco R restriktáza izolovaná z Escherichia coli, která specificky štípe v sekvenci G^AATTC AATGCTAATGCCTAGTCAAGCTTTCATCGAGAATTCCAGTCGAA TTAGCTTTACGGATCAGTTCGAAAGTAGCTCTTAAGGTCAGCTT AATGCTAATGCCTAGTCAAGCTTTCATCGAG TTAGCTTTACGGATCAGTTCGAAAGTAGCTCTTAA AATTCCAGTCGAA GGTCAGCTT

16 Identifikace restrikčních míst Na uvedeném vlákně najděte restrikční místa pro nabídnuté enzymy restrikční místo Alu I Sau 3AI Msp I AG / CT / GTAC C / CGG 5 G.G.G.C.G.T.A.C.A.T.A.G.C.T.A.A.T.G.G.C.A.A.G.C.T.A.T.G.G.T. 3

17 RFLP restriction fragment length polymorphism Charakteristické fragmenty pro každého jedince po naštípání celkové DNA restriktázami Jednotlivé cílové sekvence vybraných restriktáz mohou být mutovány, nebo v rámci jiných delecí/inzercí posunuty (variabilita restrikčních míst) Každý člověk má proto charakterictické rozložení restrikčních míst pro určitou restriktázu (restrikční mapy) Mendelovská dědičnost délky restrikčních fragmentů EcoRI štípání fragmentů 2 jedinců AGAATTCGCCGATCGATCGATCGATCGATCGATCGATCGATTGAGCTCGAATTCC AGAATTCGCCGATCGATCGATCGATCGATCGATCGATCGATCGATTGAGCTCGAATTCC Na elektroforéze bude mít druhý jedinec delší fragment

18 RFLP restriction fragment length polymorphism Variabilita RFLP Vzorek DNA 2 a 5 má typickou délku fragmentu Vzorek DNA a 3 má navíc jedno nové restrikční místo (v jiné oblasti) Vzorek DNA 4 je variantou vzorku 3, kdy vzniklo další restrikční místo Nová restrikční místa vznikají např. záměnou nukleotidů

19 Southern - blotting Jméno po objeviteli Southernovi; umožňuje z velkého množství fragmentů (např. po štěpení celkové DNA restrikčními endonukleázami) specificky detekovat DNA fragment V doslovném překladu pijákování tzn. nasátí PCR produktů z elektroforetického gelu na membránu (nylonovou) a jejich následná analýza Hybridizace = spojení dvou jednovláknových DNA podle pravidla komplementarity Gel se denaturuje v chemickém činidlu denaturuje se i dvouvláknová DNA; na membránu jsou blottována jen jednořetězcová vlákna - v uspořádání, v jakém byla na elektroforetickém gelu Hybridizace s radioaktivně značenou próbou membrána je ponořena do roztoku s jednovláknovým radioaktivně značeným řetězcem DNA Na základě komplementarity basí dojde k hybridizaci Nenavázaná próba je odmyta V případě úspěšné hybridizace svítí na membráně fragment tvořený jedním vláknem DNA a jedním vláknem próby

20 Southern - blotting

21 Southern blot hybridizace sondy DNA Sonda Zahřátí (denaturace) Ochlazení (renaturace)

22 Fenylketonurie - PAH gen Fenylketonurie Defekt genu pro fenylalaninhydroxylasu (PAH) AR onemocnění PAH 3 exonů Mnoho mutací (více než 400 známých v roce 2000) Oblast mutace (delece) Mutace - např. delece v 2. exonu; detekce systémem restrikční endonukleasy (viz obrázek) Rodiče Při negativním výsledku vyšetření jednoho exonu vyšetření mutací v dalších exonech Děti Děti

23 RFLP metoda Autosomálně recesivní onemocnění (např. cystická fibróza, fenylketonurie) Vyšetření je informativní Druhá dcera má genotyp Aa

24 RFLP prenatální vyšetření Fenylketonurie - AR A) B) Vyšetření je informativní Plod heterozygot - zdravý

25 RFLP metoda Polycystická choroba ledvin - AD Vyšetření je informativní Prenatální diagnostika - genotyp aa

26 RFLP metoda GR onemocnění hemofilie (obdobné pro barvoslepost)? Dcera zdravá Genotyp X + X h Přenašečka

27 I 2 II A a aa AA A a Jsou jedinci II/2 a II/3 heterozygoti pro mutovanou alelu sledovaného AR onemocnění? (vazba úplná)

28 I 2 II a A aa AA A a a A Jsou jedinci II/2 a II/3 heterozygoti pro mutovanou alelu sledovaného AR onemocnění? (vazba úplná) II/2 ne II/3 ano

29 I 2 II Aa a a Aa Jsou jedinci II/2 a II/3 heterozygoti pro mutovanou alelu sledovaného AR onemocnění? (vazba úplná) II/2 AA nebo Aa II/3 AA nebo Aa Vyšetření je neúspěšné (neinformativní z hlediska určení heterozygocie jedinců II/2 a II/3).

30 I X + Y 2 X + X h II 2 X h Y X + Y 2 3 X + X + X + X h X + X h X h Je dcera II/3 přenašečkou (heterozygot) pro mutovanou alelu sledovaného GR onemocnění? (vazba úplná) II/3 ano

31 I 2 II X + X h X + X + X + X h X + Je dcera II/3 přenašečkou (heterozygot) pro mutovanou alelu sledovaného GR onemocnění? (vazba úplná) II/3 ne

32 Polycystická choroba ledvin (AD, p = 5cM) I Aa aa 2 II A B C D a) Riziko postižení pro II/3 i II/4 je 50%. 32

33 Polycystická choroba ledvin (AD, p = 5cM) I Aa aa 2 II A B C D A a A a a a a a a) Riziko postižení pro II/3 i II/4 je 50%. b) Riziko postižení pro II/3 je 95%. b) Riziko postižení pro II/4 je 5%. 33

34 Polycystická choroba ledvin (AD, p = 5cM) I 2 II III A B C D aa Aa Aa aa 2 5 a) Riziko postižení pro III/ 34 i III/2 je 50%.

35 Polycystická choroba ledvin (AD, p = 5cM) I 2 II III A B C D aa Aa Aa aa 2 5 b) Riziko postižení pro III/ je 95%. b) Riziko postižení pro III/2 je 5%. 35

36 Polymorfismy lidské DNA - vazebná analýza v přímé a nepřímé diagnostice Mikrosatelity (syn. krátké tandemové repetice) STR short tandem repeats, SSR simple sequence repeats TAGCCATCGGTACACACACACACACACAGTGCTTCAGTAGC TAGCCATCGGTACACACACACACAGTGCTTCAGTAGCGTAG Pokud se detekovatelný polymorfismus nachází dostatečně blízko lokusu, ve kterém se vyskytuje kauzální mutace pro sledovanou chorobu, bude možné jej využít i bez znalosti molekulární podstaty daného onemocnění: vazba polymorfismu s mutovanou alelou V závislosti na frekvenci crossing-overu bude současně s mutací předáván z rodičů na potomky kosegregace markeru s mutovanou alelou

37 Chromosomové mutace Aneuploidie Downův syndrom (3x 2. chromosom)

38 Nondisjunkce u Downova syndromu Tři rodokmeny rodin s dětmi postiženými Downovým syndromem (prostá trisomie). Výsledek analýzy DNA tetranukleotidového polymorfismu na chromozómu 2 - je znázorněn pod rodokmeny. Od kterého z rodičů zdědilo dítě třetí kopii chromozómu 2? V kterém meiotickém dělení došlo k nondisjunkci?

39 Nondisjunkce u Downova syndromu? Meióza I u otce nebo u matky

40 Nondisjunkce u Downova syndromu? Meióza I u otce nebo u matky Meióza I u matky

41 Nondisjunkce u Downova syndromu? Meióza I u otce nebo u matky Meióza I u matky Meióza II u matky

42 Přímá DNA diagnostika Huntingtonovy chorey n CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG primer (CAG)n primer 203 bp 203 bp + 3n

43 Přímá DNA diagnostika Huntingtonovy chorey I 2 43 II III expanze expanze

44 Polymorfismy lidské DNA využívané v přímé a nepřímé diagnostice Jednonukleotidové polymorfismy (single nucleotide polymorphisms SNP) SNP C / A TAGCCATCGGTA N GTACTCAATGATCAGCT G C T A

45 Polymorfismy lidské DNA využívané ve vazebné analýze, přímé a nepřímé diagnostice Jednonukleotidové polymorfismy (single nucleotide polymorphisms SNP) V 99.9% sekvence DNA se lidé od sebe vzájemně neliší. Ze zbývajícího 0.% rozdílu tvoří SNP přes 80%. Projekt lidského genomu nyní pokračuje mj. ve formě identifikace miliónů SNP, které jsou shromažďovány ve veřejně přístupných databázích. Možnost typizace mnoha set tisíc SNP v jednom vzorku pomocí DNA čipů by měla usnadnit identifikaci alel, zodpovědných za řadu onemocnění.

46 DNA čipy - microarrays Moderní metoda analýzy DNA v několika lokusech současně Genové čipy obsahují velké množství sond, které hybridizují s různými oblastmi genomu Využití nanotechnologií manipulace se vzorky probíhá převážně roboticky a vyhodnocení je softwarové Klony DNA Testovaný vzorek Referenční vzorek PCR amplifikace purifikace Reverzní transkripce Fluorescenční barvivo Hybridizace na mikrodestičce Počítačová analýza

47 Genetický čip DNA čip -.5 x.5 cm křemíková nosná destička s mřížkou (v plastové kazetě) Uměle syntetizované krátké jednovláknové řetězce DNA o známé sekvenci nukleotidů (oligonukleotidové próby); až několik milionů Analyzovaný vzorek jednořetězcové DNA označené fluorescenčním barvivem Snímání skenerem, počítačová analýza Testování aktivity genů (intenzita záření jednotlivých prób po hybridizaci) Využití: genetika, farmakologie, imunologie, mikrobiologie (genové profily virů a bakterií)

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace Genetické markery Genetické markery

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100% F8 - hemofilie A monogenní

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob PGD preimplantační genetická diagnostika zahrnuje soubor technik, které se používají pro zjištění

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK Richard Prùša Richard Prùša Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK . Základy analytických metod v klinické molekulární biologii Richard Prùša Praha 1997 Základy analytických metod

Více

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Kamila Zdeňková Transgenní rostliny, tj. takové rostliny, do jejichž dědičného základu byly metodami genového inženýrství

Více

Genetická "oblast nejasnosti" u HCH: co to znamená? Genetický základ

Genetická oblast nejasnosti u HCH: co to znamená? Genetický základ Novinky ve výzkumu Huntingtonovy nemoci. Ve srozumitelném jazyce. Napsáno vědci. Určeno široké huntingtonské veřejnosti. Genetická "oblast nejasnosti" u HCH: co to znamená? Přechodní alely a alely s redukovanou

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE

Více

Co se o sobě dovídáme z naší genetické informace

Co se o sobě dovídáme z naší genetické informace Genomika a bioinformatika Co se o sobě dovídáme z naší genetické informace Jan Pačes, Mgr, Ph.D Ústav molekulární genetiky AVČR, CZECH FOBIA (Free and Open Bioinformatics Association) hpaces@img.cas.cz

Více

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková Metody detekce a identifikace MO se zaměřením na PCR a její variace Kamila Zdeňková Metody detekce a identifikace MO rozdělení metod pro mikrobiologické zkoušení potravin přehled rychlých metod detekce

Více

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza Iveta Valášková ivalskova@fnbrno.cz Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza nejčastěji se vyskytující autozomálně recesivní dědičná metabolická porucha v zakavkazské

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Molekulární základ dědičnosti

Molekulární základ dědičnosti Molekulární základ dědičnosti Dědičná informace je zakódována v deoxyribonukleové kyselině, která je uložena v jádře buňky v chromozómech. Zlomovým objevem pro další rozvoj molekulární genetiky bylo odhalení

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

Metodické listy OPVK. Molekulární metody hodnocení genotypů Marker Assisted Breeding 14.

Metodické listy OPVK. Molekulární metody hodnocení genotypů Marker Assisted Breeding 14. Metodické listy OPVK Molekulární metody hodnocení genotypů Marker Assisted Breeding 14. Molekulární metody hodnocení genotypů 14.1. Izolace DNA V aplikacích zaměřených na analýzu rostlinného genomu je

Více

Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění

Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění Klin. Biochem. Metab., 14 (35), 2006, No. 2, p. 89 95. Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění Gojová L., Kozák L. Centrum molekulární biologie a genové terapie, Fakultní

Více

DNA, komplementarita, dopsání komplementárního vlákna

DNA, komplementarita, dopsání komplementárního vlákna Příklady z genetiky Řešené příklady ze stránek http://genetika.wz.cz/priklady/. Jakákoli písemná publikace tohoto textu bez uvedení zdroje není povolena. DNA, komplementarita, dopsání komplementárního

Více

Jsme tak odlišní. Co nás spojuje..? Nukleové kyseliny

Jsme tak odlišní. Co nás spojuje..? Nukleové kyseliny Jsme tak odlišní Co nás spojuje..? ukleové kyseliny 1 UKLEVÉ KYSELIY = K anj = A ositelky genetických informací Základní význam pro všechny organismy V buňkách a virech Identifikace v buněčném jádře (nucleos)

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA

Více

MUTACE mutageny: typy mutací:

MUTACE mutageny: typy mutací: MUTACE charakteristika: náhodné změny v genotypu organismu oproti normálu jsou poměrně vzácné z hlediska klinické genetiky, jsou to právě mutace, které způsobují genetické choroby nebo nádorové bujení

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

Základy laboratorní techniky

Základy laboratorní techniky Předmět: Biologie ŠVP: prokaryotní organismy, genetika Doporučený věk žáků: 16 18 let Doba trvání: 2 x 45 min. Specifické cíle: naučit studenty pracovat s laboratorními pomůckami a přístroji Seznam pomůcek:

Více

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)

Více

2. PROTEINOVÉ TECHNIKY

2. PROTEINOVÉ TECHNIKY OBSAH 1. DNA TECHNIKY (P. Kotrba, Z. Knejzlík) 1 1.1 Polymerasová řetězová reakce - klonování DNA in vitro 1 1.2 Polymorfismus DNA a jeho analýza 3 1.3 VNTR sekvence, jejich význam v kriminalistice a diagnostice

Více

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí Stárnutí organismu Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí poklesy funkcí se liší mezi orgánovými systémy Některé projevy stárnutí ovlivňuje výživa Diagnostické metody odlišují

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION

CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION AFLP ANALÝZA *** Technika AFLP (Amplification Fragment Lenght Polymorphism - polymorfismus délky amplifikovaných fragmentů) je modifikací RFLP,

Více

Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) www.uhkt.cz/nrl/db Chromosomové změny Unique - Britská svépomocná skupina

Více

Návrh směrnice pro správnou laboratorní praxi pro molekulárně genetické vyšetřování Huntingtonovy choroby

Návrh směrnice pro správnou laboratorní praxi pro molekulárně genetické vyšetřování Huntingtonovy choroby Návrh směrnice pro správnou laboratorní praxi pro molekulárně genetické vyšetřování Huntingtonovy choroby Připravily: V.Kebrlová, J.Židovská Poslední revize: březen 2007 Směrnice jsou sestaveny podle doporučení

Více

NUMERICKÉ ABERACE ÚBLG 1.LF UK

NUMERICKÉ ABERACE ÚBLG 1.LF UK NUMERICKÉ ABERACE ÚBLG 1.LF UK CHROMOSOMÁLN LNÍ ABERACE NUMERICKÉ ANEUPLOIDIE POLYPLOIDIE MONOSOMIE TRISOMIE TRIPLOIDIE TETRAPLOIDIE STRUKTURÁLN LNÍ MIXOPLOIDIE MOZAICISMUS CHIMÉRISMUS ZÁKLADNÍ SYNDROMY

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela

Více

Co se děje v genetické laboratoři?

Co se děje v genetické laboratoři? 12 Co se děje v genetické laboratoři? Tento letáček byl vytvořen s pomocí Dr Iana M Fraylinga, Institute of Medical Genetics, University Hospital of Wales, Cardiff, UK; Dr Domenica Coviella, Laboratory

Více

nastavení real-time PCR cykleru Rotor Gene 3000

nastavení real-time PCR cykleru Rotor Gene 3000 Verze: 1.4 Datum poslední revize: 25. 3. 2015 nastavení real-time PCR cykleru Rotor Gene 3000 (Corbett Research) generi biotech OBSAH: 1. Nastavení teplotního profilu a spuštění cykleru... 3 2. Zadání

Více

P Ř Í L O H A K P R O D U K T U

P Ř Í L O H A K P R O D U K T U Immucor Transplant Diagnostics, Inc. 550 West Avenue, Stamford, Connecticut 06902 Spojené státy americké Tel: +1 (203) 328-9500 nebo volání bez poplatku ve Spojených státech amerických, Kanadě a Portoriku

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry

Více

IMUNOGENETIKA II + F1 F2 + F2 + + + - - Transplantace kostní dřeně - lymfoidní tkáň TRANSPLANTAČNÍ PRAVIDLA TRANSPLANTAČNÍ PRAVIDLA

IMUNOGENETIKA II + F1 F2 + F2 + + + - - Transplantace kostní dřeně - lymfoidní tkáň TRANSPLANTAČNÍ PRAVIDLA TRANSPLANTAČNÍ PRAVIDLA IMUNOGENETIKA II kmen A TRANSPLANTAČNÍ PRAVIDLA - - F1 kmen B e x F2 y y kmen A 3 4 y TRANSPLANTAČNÍ PRAVIDLA - F1 e x F2 - - - y kmen B 3 4 Transplantace orgánů, které neobsahují lymfoidní tkáň Imunitní

Více

Vaše cesta ke zdravému dítěti

Vaše cesta ke zdravému dítěti Vážení klienti, Vaše cesta ke zdravému dítěti Preimplantační genetická diagnostika Sanatorium REPROMEDA patří již téměř 15 let mezi přední česká i evropská centra reprodukční medicíny. Již od počátku své

Více

Nemoc a její příčiny

Nemoc a její příčiny Nemoc a její příčiny Definice zdraví a nemoc zdraví stav úplné tělesné, duševní a sociální pohody s harmonickým průběhem vitálních procesů nemoc porucha zdraví poškození určitého počtu bb. (bb. reagují

Více

P Ř Í L O H A K P R O D U K T U

P Ř Í L O H A K P R O D U K T U Immucor Transplant Diagnostics, Inc. 550 West Avenue, Stamford, Connecticut 06902 Spojené státy americké Tel: +1 (203) 328-9500 nebo volání bez poplatku ve Spojených státech amerických, Kanadě a Portoriku

Více

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody Návod k použití souprav Wipe test Kontaminační kontrola Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody REF 7091 40 reakcí 1. Popis výrobku V posledních letech se

Více

Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením

Více

ISBN 978-80-7305-651-3

ISBN 978-80-7305-651-3 www.mendelianum.cz Mendelianum MZM, Brno ÚŽFG AV ČR, v.v.i., Brno Ústav fyziologie FVL VFU Brno Vydala Veterinární a farmaceutická univerzita Brno 2013 ISBN 978-80-7305-651-3 MENDEL FORUM 2013 26. dubna

Více

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dgmp) Koncept párování bazí je striktně konzervativní Cytosine

Více

Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený

Více

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D.

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D. GENETICKÉ PORADENSTVÍ u pacientů s epidermolysis bullosa congenita MUDr. Renata Gaillyová, Ph.D. Homozygot jedinec, který zdědil po rodičích tutéž alelu. Jedinec nebo genotyp s identickými alelami v daném

Více

FLUORESCENČNÍ MIKROSKOP

FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po

Více

Genetika - slovníček pojmů

Genetika - slovníček pojmů Genetika - slovníček pojmů Autor: Antonín Šípek A Adenin 6-aminopurin; purinová báze, přítomná v DNA i RNA AIDS Acquired immunodeficiency syndrome - syndrom získané imunodeficience, způsobený virem HIV

Více

Posouzení citlivosti, specifity a přesnosti identifikace nefermentujících Gram-negativních tyčinek pomocí PCR-HRMA

Posouzení citlivosti, specifity a přesnosti identifikace nefermentujících Gram-negativních tyčinek pomocí PCR-HRMA Univerzita Palackého v Olomouci Přírodovědecká fakulta Katedra buněčné biologie a genetiky Posouzení citlivosti, specifity a přesnosti identifikace nefermentujících Gram-negativních tyčinek pomocí PCR-HRMA

Více

Zvláš. áštnosti studia genetiky člověka: nelze z etických důvodd experimenty a selekci. ství potomků. ším m prostřed (sociáln ůže sledovat maximáln

Zvláš. áštnosti studia genetiky člověka: nelze z etických důvodd experimenty a selekci. ství potomků. ším m prostřed (sociáln ůže sledovat maximáln Genetika člověka Zvláš áštnosti studia genetiky člověka: Na člověku nelze z etických důvodd vodů provádět experimenty a selekci. Člověk k mám většinou za život velmi malé množstv ství potomků. Fenotyp

Více

Buněčné kultury. Kontinuální kultury

Buněčné kultury. Kontinuální kultury Buněčné kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace

Více

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno Zpracování a využití biologického materiálu pro výzkumné účely od nemocných s monoklonální gamapatií Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie,

Více

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR Mikrobiologický ústav AV ČR Příloha 6 Havarijní plán 1/5 Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR a) Adresa pracoviště Mikrobiologický ústav AV ČR

Více

Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření

Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření Název sondy / vyšetřovaného syndromu vyšetřovaný gen / oblast použití Fast FISH souprava prenatálních sond DiGeorge

Více

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC 1 Výrobce Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC Tento návod k použití si důkladně přečtěte před použitím tohoto produktu. Uschovejte si tento návod k použití,

Více

Identifikace osob pomocí DNA

Identifikace osob pomocí DNA Identifikace osob pomocí DNA Indetification of DNA Tomáš Vaculka Bakalářská práce 2010 UTB ve Zlíně, Fakulta aplikované informatiky, 2010 2 UTB ve Zlíně, Fakulta aplikované informatiky, 2010 3 UTB ve Zlíně,

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery ve šlechtění rostlin Petr Smýkal Katedra botaniky, PřF UPOL 1. Mikrosatelitní markery

Více

Absorpční spektroskopie při biologické analýze molekul

Absorpční spektroskopie při biologické analýze molekul Absorpční spektroskopie při biologické analýze molekul Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 8.11.2007 7 1 UV spektroskopie DNA a proteinů Všechny atomy absorbují v UV oblasti

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Pavel Čermák. Thomayerova nemocnice Praha - Krč. 14.2.2013 výroční zasedání SLM

Pavel Čermák. Thomayerova nemocnice Praha - Krč. 14.2.2013 výroční zasedání SLM Pavel Čermák Thomayerova nemocnice Praha - Krč Úkoly na rok 2012 Vytvoření seznamu přístrojů Doplnění podkladů pro kalkulaci Možná úprava některých stávajících výkonů?? Revize pracovních časů u všech výkonů

Více

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD Shrnutí webináře Dystrofin 101: vše, co jste kdy chtěli vědět o dystrofinu (a nebáli jste se zeptat) Francesco Muntoni (University College of London), John Porter (PPMD) Dystrofinopatie: DMD versus BMD

Více

O původu života na Zemi Václav Pačes

O původu života na Zemi Václav Pačes O původu života na Zemi Václav Pačes Ústav molekulární genetiky Akademie věd ČR centrální dogma replikace transkripce DNA RNA protein reverzní transkripce translace informace funkce Exon 1 Intron (413

Více

Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření

Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření Laboratoř Metalomiky a Nanotechnologií Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření Vyučující: Ing. et Ing. David Hynek, Ph.D., Prof. Ing. René

Více

CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION

CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION DIGITÁLNÍ OBRAZOVÁ ANALÝZA ELEKTROFORETICKÝCH GELŮ *** Vyhodnocování získaných elektroforeogramů: Pro vyhodnocování

Více

Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady

Více

Zkoumání přírody. Myšlení a způsob života lidí vyšší nervová činnost odlišnosti člověka od ostatních organismů

Zkoumání přírody. Myšlení a způsob života lidí vyšší nervová činnost odlišnosti člověka od ostatních organismů Předmět: PŘÍRODOPIS Ročník: 9. Časová dotace: 1 hodina týdně Výstup předmětu Rozpracované očekávané výstupy Učivo předmětu Přesahy, poznámky Konkretizované tématické okruhy realizovaného průřezového tématu

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

P ehled výsledk z Referen ní laborato e

P ehled výsledk z Referen ní laborato e P ehled výsledk z Referen ní laborato e 1,3 Hajdúch M, 1,3 Trojanec R, 2,3 Kolá Z, 1,3 Bouchalová K, 2,3 Sedláková E. 1 Laborato experimentální medicíny p i D tské klinice LF UP a FN Olomouc 2 Laborato

Více

ANALYSIS OF GENOMIC MARKER CSN2 IN COW'S MILK ANALÝZA GENOMICKÉHO MARKERU CSN2 V MLÉCE SKOTU

ANALYSIS OF GENOMIC MARKER CSN2 IN COW'S MILK ANALÝZA GENOMICKÉHO MARKERU CSN2 V MLÉCE SKOTU ANALYSIS OF GENOMIC MARKER CSN2 IN COW'S MILK ANALÝZA GENOMICKÉHO MARKERU CSN2 V MLÉCE SKOTU Šrubařová P., Dvořák J. Ústav Morfologie, fyziologie a genetiky zvířat, Agronomická fakulta, Mendelova zemědělská

Více

C V C. Návod k použití pro Biofortuna SSPGo TM HLA Wipe Test BF-40-01. Revize 3. Červenec 2014

C V C. Návod k použití pro Biofortuna SSPGo TM HLA Wipe Test BF-40-01. Revize 3. Červenec 2014 Dot146v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strana 1 / 8 Návod k použití pro Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Revize 3 Červenec 2014 Dot146v1 Instructions for

Více

NMR spektroskopie. Úvod

NMR spektroskopie. Úvod NMR spektroskopie Úvod Zkratka NMR znamená Nukleární Magnetická Rezonance. Jde o analytickou metodu, která na základě absorpce radiofrekvenčního záření vzorkem umístěným v silném magnetickém poli poskytuje

Více

Diagnostické metody v lékařské mikrobiologii

Diagnostické metody v lékařské mikrobiologii Diagnostické metody v lékařské mikrobiologii Výuková prezentace z: Lékařské mikrobiologie Jan Smíšek ÚLM 3. LF UK 2009 Princip identifikace Soubor znaků s rozdílnou diskriminační hodnotou Základní problémy

Více

Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku. Richard J W Currie

Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku. Richard J W Currie Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku Richard J W Currie Virus infekční bronchitidy RNA (nukleová kyselina) uvnitř Proteiny (spike proteiny S1 a S2) na vnější straně

Více