Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie."

Transkript

1 Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: # FRIEDREICH ATAXIA 1; FRDA * FRDA GENE; FRDA Popis onemocnění Friedreichova ataxie (FRDA) je autosomálně recesivní neurodegenerativní onemocnění s frekvencí výskytu 1: v Evropské populaci (frekvence přenašečů 1:120). V 98% případů je příčinou FRDA homozygotní dynamická mutace spočívající v amplifikaci repetice GAA uvnitř 1. intronu genu X25. Tento gen je lokalizován na chromosomu 9 v oblasti 9q a kóduje protein frataxin. V normální populaci je počet repetic GAA 6 36, patologické alely obsahují repetic. Počet repetic je považován za premutaci, která může v dalších generacích expandovat do plné mutace. Analýza počtu repetic GAA u kontrolních vzorků vytvořila dvě skupiny alel: 83% alel obsahovalo 6 10 repetic ( malé normální alely ), 17% mělo repetic ( velké normální alely ). Sekvenční analýza ukázala, že žádná standardní alela neobsahuje více než 27 nepřerušených repetic GAA. U všech standardních alel s počtem repetic větším než 27 byla repetice GAA přerušena hexanukleotidovou repeticí GAGGAA. Repetice GAA na normálních chromosomech jsou stabilní při přenosu z rodičů na potomstvo, zatímco expandované repetice vykazují meiotickou i mitotickou nestabilitu. Expanze repetice GAA vede k potlačení exprese genu X25 a to pravděpodobně z důvodu tvorby stabilní non B struktury DNA, která blokuje transkripci. Množství výsledné mrna a tedy i samotného proteinu je v opačné korelaci s velikostí expanze repetice GAA. Tento efekt vytváří biologický základ pro korelaci mezi velikostí expanze a výsledným fenotypovým projevem onemocnění (tj. věkem počátečních projevů choroby, závažností a rozsahem postižení). Doposud bylo u pacientů s FRDA popsáno cca 17 bodových mutací. Pacienti, u kterých byly bodové mutace detekovány, jsou složení heterozygoti s expanzí repetice GAA na jedné alele a bodovou mutací na druhé alele. Zatím nebyl zachycen pacient homozygot nebo složený heterozygot na bodové mutace.

2 Gen X25 (6 exonů) kóduje protein frataxin (210 aminokyselin, 18 kda). Frataxin je lokalizován na vnitřní mitochondriální membráně a jeho absence má za následek nadměrnou mitochondriální akumulaci železa a deficit aktivity mitochondriálních Fe S proteinů v případě analýzy endomyocardiálních biopsií a mozkové tkáně pacientů s diagnózou FRDA. V kultivovaných kožních fibroblastech nebo kosterních svalech pacientů s FRDA významnější deficit aktivity Fe S proteinů prokázán nebyl. Kritéria pro klinickou diagnostiku FRDA navrhla A. E. Harding a podrobněji je o nich psáno v kapitole Výběr pacientů pro molekulárně genetickou diagnostiku FRDA. Kromě neurodegenerativních příznaků, jejichž frekvence se liší v závislosti na délce trvání nemoci, má většina pacientů hypertrofickou kardiomyopatii a téměř třetina pacientů má diabetes nebo nižší stupeň glukosové tolerance. Kliniká kriteria mohou být použity pro rozdělení pacientů s FRDA na typické a netypické případy. Na jedné straně jsou pacienti, kteří nemají všechny kliniké příznaky FRDA a přesto jsou nositeli homozygotní expanze repetice GAA v genu X25. Na druhé straně jsou pacienti klinicky podobni pacientům s FRDA, ale geneticky je onemocnění spojeno s genem pro protein přenášející alfa tokoferol na chromosomu 8q13. Mutace v tomto proteinu mají za následek poruchu inkorporace vitaminu E do VLDL (very low density lipoprotein). V roce 2001 byl pomocí vazebné analýzy na chromosomu 9 nalezen další lokus spojený s FRDA. Tento lokus se nachází v oblasti 9p23 9p11 a obsahuje 81 genů. Nyní je u pacientů s vazbou FRDA a lokusu 9p23 9p11 prováděna sekvenční analýza vytypovaných genů. Molekulárně genetická diagnostika Obecná strategie: 1. Kritéria pro výběr pacientů pro molekulárně genetickou diagnostiku FRDA. a) Nezbytná kritéria (>95%): věk projevu nemoci před 25. rokem, progredující ataxie chůze a končetin, autosomálně recesivní dědičnost, areflexie dolních končetin, extenční iritační pyramidové jevy (Babinského příznak), měření rychlosti vedení motorickými nervy na horních končetinách > 40 m/s, malé nebo nevýbavné SNAP (sensory nerve action potential). b) Přídatná kritéria (>65%): dysarthrie, centrální paréza dolních končetin, areflexie horních končetin, pallanestezie a ztráta polohocitu dolních končetin, skolióza,

3 abnormální EKG. c) Další příznaky (asi 50%): nystagmus, optická atrofie, hluchota, distální slabost a atrofie, pes cavus. 2. Izolace DNA 3. Stanovení počtu repetic GAA v 1. intronu genu X25 pomocí: a) PCR Sekvence primerů ohraničují repetici GAA : GAA 104F: 5 GGCTTAAACTTCCCACACGTGTT 3 GAA 629R: 5 AGGACCATCATGGCCACACTT 3 Použité chemikálie: Systém pro amplifikaci dlouhých úseků DNA Expand Long Template PCR System (Roche) Sekvence amplifikovaného úseku DNA: agtttgtact ttaggcttaa acttcccaca cgtgttattt ggcccacatt gtgtttgaag aaactttggg attggttgcc agtgcttaaa agttaggact tagaaaatgg atttcctggc aggacgcggt ggctcatgcc cataatctca gcactttggg aggcctagga aggtggatca cctgaggtcc ggagttcaag actaacctgg ccaacatggt gaaacccagt atctactaaa aaatacaaaa aaaaaaaaaa aaaagaagaa gaagaagaag aagaagaaga aaataaagaa aagttagccg ggcgtggtgt cgcgcgcctg taatcccagc tactccagag gctgcggcag gagaatcgct tgagcccggg aggcagaggt tgcattaagc caagatcgcc caatgcactc cggcctgggc gacagagcaa gctccgtctc aaaaaataat aataataaat aaaaataaaa aataaaatgg atttcccagc atctctggaa aaataggcaa gtgtggccat gatggtcctt (pozn: silně jsou vyznačeny místa nasedání primerů) Velikost produktů PCR: n pb (n je počet repetic GAA) Velikost standardních alel je 518 až 608 pb (odpovídá 6 36 repeticím GAA). Velikost mutantních alel je 770 až 4400 pb (odpovídá repeticím GAA). Velikost premutantních alel je 602 až 800 pb (odpovídá repeticím GAA). Produkty PCR jsou rozděleny v 1% agarósovém gelu a jejich velikost je vyhodnocena srovnáním s komerčně dostupnými fragmenty DNA o známé velikosti. Analyzovany vzorek je nutné současně amplifikovat se vzorky standardní DNA (u které se nepředpokládá expanze sledované repetice) a se vzorky DNA pacientů, u kterých již byla diagnóza FRDA potvrzena molekulárně genetickými metodami. V případě detekce produktu PCR o velikosti na rozhraní standardní alela/mutantní alela (velikost cca 602 až 800 pb) je vhodné provést sekvenční

4 analýzu PCR produktu a přesvědčit se tak o možnosti přerušení repetice GAA hexanukleotidovou repeticí GAGGAA (možnost stabilizace repetice GAA?). b) Southernova blotingu a hybridizace Restrikce genomové DNA, přenos rozdělené DNA na membránu, hybridizace s radioaktivně značenou sondou a následná autoradiografie detekuje v případě standardní DNA fragmenty o velikosti 2,4 kb (restrikce endonukleasou BsiHKA1), 5,6 kb (restrikce EcoRV ) a 8,2 kb (restrikce EcoR1). V případě expanze repetice GAA sonda hybridizující s 1. exonem a částí 1. intronu genu X25 detekuje fragmenty o délce související s velikostí expanze. c) Detekce bodových mutací u heterozygotních přenašečů expanze repetice GAA amplifikace jednotlivých exonů genu X25 a přímá sekvenční analýza produktů PCR. Sekvence primerů : Exon 1 (240 pb) 1F: 5 AGCACCCAGCGCTGGAGG 3 1R: 5 CCGCGGCTGTTCCCGG 3 Exon 2 (168 pb) 2F: 5 AGTAACCTACTTCTTAACTTTGGC 3 2R: 5 AGAGGAAGATACCTATCACGTG 3 Exon 3 (227 pb) 3F: 5 AAAATGGAAGCATTTGGTAATCA 3 3R: 5 AGTGAACTAAAATTCTTAGAGGG 3 Exon 4 (250 pb) 4F: 5 AAGCAATGATGACAAAGTGCTAAC 3 4R: 5 TGGTCCACAATGTCACATTTCGG 3 Exon 5a (223 pb) 5aF: 5 CTGAAGGGCTGTGCTGTGGA 3 5aR: 5 TGTCCTTACAAACGGGGCT 3 Exon 5b (224) 5bF: 5 CCCATGCTCAAGACATACTCC 3 5bR: 5 ACAGTAAGGAAAAAACAAACAGCC 3 Metody molekulárně genetické diagnostiky zavedené v Centru molekulární biologie a genové terapie, Fakultní nemocnice Brno: stanovení počtu repetic GAA v 1. intronu genu X25 pomocí PCR. Pozn.: V případě zájmu by bylo možné vyšetření doplnit o detekci bodových mutací u heterozygotních přenašečů expanze repetice GAA a o sekvenční analýzu alel s premutací. Interpretace výsledků molekulárně genetické diagnostiky založené na PCR

5 1. Expanze repetice GAA není detekována (po elektroforéze jeden popř. dva pruhy o velikosti menší než 608 pb): pacient s největší pravděpodobnosí nemá diagnózu FRDA. 2. Detekce expanze repetice GAA na obou alelách (po elektroforéze jeden popř. dva pruhy o velikosti nad 770 pb): pacient s diagnózou FRDA. 3. Detekce expanze repetice GAA na jedné alele, druhá alela standardní (po elektroforéze jeden pruh o velikosti nad 770 pb, druhý o velikosti pod 608 pb): v závislosti na klinických projevech se může jednat o přenašečství FRDA nebo o pacienta s expanzí GAA a bodovou mutací na druhé alele (přichází li v úvahu druhý případ je nutné vyšetření doplnit o sekvenční analýzu exonů genu X25). Neobvyklé kombinace s obtížnou interpretací: 4. Detekce expanze repetice GAA na jedné alele, druhá alela s premutací (po elektroforéze jeden pruh o velikosti nad 770 pb, druhý o velikosti 602 až 800 pb): v závislosti na klinických projevech se může jednat o pacienta s FRDA vyšetření je vhodné doplnit sekvenční analýzou premutované alely a zjistit možnot přerušení repetice GAA hexanukleotidovou repeticí GAGGAA. 5. Detekce alely s premutací, druhá alela standardní (po elektroforéze jeden pruh o velikosti 602 až 800 pb, druhý pod 608 pb): pravděpodobně se nebude jednat o pacienta s FRDA, v závislosti na klinických projevech je vhodné vyšetření doplnit o sekvenční analýzu premutované alely (možnot přerušení repetice GAA hexanukleotidovou repeticí GAGGAA) a sekvenční analýzu exonů genu X Detekce dvou alel s premutací (po elektroforéze jeden popř. dva pruhy o velikosti 602 až 800 pb): pravděpodobně se nebude jednat o pacienta s FRDA, v závislosti na klinických projevech vyšetření doplnit o sekvenční analýzu premutovaných alel. Návrh kontroly kvality Kontrola kvality DNA diagnostických laboratoří v rámci ČR bude provedena referenční laboratoří kontrolovanou EMQN (European Molecular Genetics Quality Network). Laboratoře, které mají zájem o provedení kontroly kvality diagnostiky FRDA, osloví referenční laboratoř a ta jim minimálně jednou do roka zašle vzorky DNA od zdravých kontrol, pacientů popř. přenašečů FRDA (potvrzeno analýzou DNA v referenční laboratoři). Výsledky DNA diagnostiky předají testované laboratoře referenční laboratoři, která provede vyhodnocení provedených analýz, tj. písemnou formou zašle kontrolovaným laboratořím výsledek.

NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ

NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ Doc. MUDr. A. Šantavá, CSc. Ústav lékařské genetiky a fetální medicíny LF a UP Olomouc Význam genetiky v diagnostice neuromuskulárních onemocnění Podílí

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

DMPK (ZNF9) V DIFERENCOVANÝCH. Z, Kroupová I, Falk M* M

DMPK (ZNF9) V DIFERENCOVANÝCH. Z, Kroupová I, Falk M* M FISH ANALÝZA m-rna DMPK (ZNF9) V DIFERENCOVANÝCH TKÁNÍCH PACIENT IENTŮ S MYOTONICKOU DYSTROFI FIÍ Lukáš Z, Kroupová I, Falk M* M Ústav patologie FN Brno *Biofyzikáln lní ústav AVČR R Brno Definice MD Myotonická

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka

Více

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky

Více

Molekulární diagnostika pletencové svalové dystrofie typu 2A

Molekulární diagnostika pletencové svalové dystrofie typu 2A Molekulární diagnostika pletencové svalové dystrofie typu 2A Lenka Fajkusová Centrum molekulární biologie a genové terapie Fakultní nemocnice Brno Pletencové svalové dystrofie (Limb Girdle Muscular Dystrophy

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika

Více

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE POHLED Z LABORATOŘE Petra Hedvičákov ková ÚBLG FN Motol Odd. lékal kařské molekulárn rní genetiky MZO 00064203 23.-24.5.2008

Více

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické

Více

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH RÁMCOVÝ VZDĚLÁVACÍ PROGRAM PRO ZÍSKÁNÍ SPECIALIZOVANÉ ZPŮSOBILOSTI v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH 1. Cíl specializačního vzdělávání Cílem specializačního vzdělávání

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

Spinální svalová atrofie. Vypracovali: Kateřina Teplá Monika Madrová Anna Dobrovolná Mária Čižmárová Dominika Štrbová Juraj Štipka

Spinální svalová atrofie. Vypracovali: Kateřina Teplá Monika Madrová Anna Dobrovolná Mária Čižmárová Dominika Štrbová Juraj Štipka Spinální svalová atrofie Vypracovali: Kateřina Teplá Monika Madrová Anna Dobrovolná Mária Čižmárová Dominika Štrbová Juraj Štipka Klinický popis - relativně vzácná nemoc, nicméně se jedná o nejčastější

Více

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Mendelovská genetika - Základy přenosové genetiky Základy genetiky Gregor (Johann)

Více

Využití DNA markerů ve studiu fylogeneze rostlin

Využití DNA markerů ve studiu fylogeneze rostlin Mendelova genetika v příkladech Využití DNA markerů ve studiu fylogeneze rostlin Ing. Petra VESELÁ Ústav lesnické botaniky, dendrologie a geobiocenologie LDF MENDELU Brno Tento projekt je spolufinancován

Více

Duchenneova/Beckerova svalová dystrofie a Parent Project

Duchenneova/Beckerova svalová dystrofie a Parent Project Duchenneova/Beckerova svalová dystrofie a Parent Project Oddělení lékařské genetiky FN Brno Renata Gaillyová Vzácné nemoci V EU se nemoc považuje za vzácnou, jestliže postihuje méně než 5 osob z každých

Více

Mgr. et Mgr. Lenka Falková. Laboratoř agrogenomiky. Ústav morfologie, fyziologie a genetiky zvířat Mendelova univerzita

Mgr. et Mgr. Lenka Falková. Laboratoř agrogenomiky. Ústav morfologie, fyziologie a genetiky zvířat Mendelova univerzita Mgr. et Mgr. Lenka Falková Laboratoř agrogenomiky Ústav morfologie, fyziologie a genetiky zvířat Mendelova univerzita 9. 9. 2015 Šlechtění Užitek hospodářská zvířata X zájmová zvířata Zemědělství X chovatelství

Více

Základní pojmy obecné genetiky, kvalitativní a kvantitativní znaky, vztahy mezi geny

Základní pojmy obecné genetiky, kvalitativní a kvantitativní znaky, vztahy mezi geny Obecná genetika Základní pojmy obecné genetiky, kvalitativní a kvantitativní znaky, vztahy mezi geny Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU

Více

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,

Více

ÚVOD DO TRANSPLANTAČNÍ IMUNOLOGIE

ÚVOD DO TRANSPLANTAČNÍ IMUNOLOGIE ÚVOD DO TRANSPLANTAČNÍ IMUNOLOGIE Základní funkce imunitního systému Chrání integritu organizmu proti škodlivinám zevního a vnitřního původu: chrání organizmus proti patogenním mikroorganizmům a jejich

Více

Hereditární spastická paraparéza. Stanislav Voháňka

Hereditární spastická paraparéza. Stanislav Voháňka Hereditární spastická paraparéza Stanislav Voháňka HSPP (hereditární spastická paraplegie) Skupina dědičných chorob Progredující spastická paraparéza Synonyma Familiární spastická paraplegie Onemocnění

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Poziční klonování Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s metodou pozičního klonování genů

Více

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní

Více

FUNKČNÍ VARIANTA GENU ANXA11 SNIŽUJE RIZIKO ONEMOCNĚNÍ

FUNKČNÍ VARIANTA GENU ANXA11 SNIŽUJE RIZIKO ONEMOCNĚNÍ FUNKČNÍ VARIANTA GENU ANXA11 SNIŽUJE RIZIKO ONEMOCNĚNÍ SARKOIDÓZOU: POTVRZENÍ VÝSLEDKŮ CELOGENOMOVÉ ASOCIAČNÍ STUDIE. Sťahelová A. 1, Mrázek F. 1, Kriegová E. 1, Hutyrová B. 2, Kubištová Z. 1, Kolek V.

Více

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.

Více

RUTINNÍ TESTY HLA PRO DIAGNOSTIKU CELIAKIE

RUTINNÍ TESTY HLA PRO DIAGNOSTIKU CELIAKIE RUTINNÍ TESTY HLA PRO DIAGNOSTIKU CELIAKIE Vraná Milena Odd. HLA, Národní referenční laboratoř pro DNA diagnostiku, ÚHKT, Praha WWW.UHKT.CZ ÚVOD Základní podmínkou vzniku celiakie je přítomnost některých

Více

Vykazování pro zdravotní pojišťovny a zákonné požadavky pro genetická vyšetření

Vykazování pro zdravotní pojišťovny a zákonné požadavky pro genetická vyšetření Vykazování pro zdravotní pojišťovny a zákonné požadavky pro genetická vyšetření Hana Feixová Komplement laboratoří ÚHKT, Praha WWW.UHKT.CZ Novela SZV k 1. 1. 2017 Vyhláška č. 421/2016 Sb. Vyhláška, kterou

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Mgr. Klára Vilimovská Dědečková, Ph.D. Synlab genetics s.r.o. Molekulární

Více

Jana Krejčová MOLEKULÁRNÍ PATOLOGIE ZAČÁTKU III. TISÍCILETÍ: VYUŽITÍ BIOPTICKÝCH VZORKŮ PRO MOLEKULÁRNÍ ANALÝZU. Workshop dubna 2005 Olomouc

Jana Krejčová MOLEKULÁRNÍ PATOLOGIE ZAČÁTKU III. TISÍCILETÍ: VYUŽITÍ BIOPTICKÝCH VZORKŮ PRO MOLEKULÁRNÍ ANALÝZU. Workshop dubna 2005 Olomouc Jana Krejčová Pracovní skupina molekulární patologie České lékařské společnosti Jana Evangelisty Purkyně Společnost patologů České lékařské společnosti Jana Evangelisty Purkyně Laboratoř molekulární patologie

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

Tekuté biopsie u mnohočetného myelomu

Tekuté biopsie u mnohočetného myelomu Tekuté biopsie u mnohočetného myelomu Mgr. Veronika Kubaczková Babákova myelomová skupina ÚPF LF MU Pacientský seminář 11. května 2016, Brno Co jsou tekuté biopsie? Představují méně zatěžující vyšetření

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice

Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice Účinnost k 1. 12. 2014 Doporučený postup č. 3 Genetické laboratorní vyšetření v reprodukční genetice Stav změn: 1. vydání Základním předpokladem genetického laboratorního vyšetření v reprodukční genetice

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Návrh směrnice pro vydávání a interpretaci výsledků v molekulárně genetických laboratořích

Návrh směrnice pro vydávání a interpretaci výsledků v molekulárně genetických laboratořích Návrh směrnice pro vydávání a interpretaci výsledků v molekulárně genetických laboratořích Úvodní informace Tento dokument vychází z doporučení OECD (Organisation for Economic Co-operation and Development;

Více

P1 AA BB CC DD ee ff gg hh x P2 aa bb cc dd EE FF GG HH Aa Bb Cc Dd Ee Ff Gg Hh

P1 AA BB CC DD ee ff gg hh x P2 aa bb cc dd EE FF GG HH Aa Bb Cc Dd Ee Ff Gg Hh Heteroze jev, kdy v F1 po křížení geneticky rozdílných genotypů lze pozorovat zvětšení a mohutnost orgánů, zvýšení výnosu, životnosti, ranosti, odolnosti ve srovnání s lepším rodičem = heterózní efekt

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

Nemendelovská dědičnost

Nemendelovská dědičnost Nemendelovská dědičnost Některá onemocnění a znaky, za které zodpovídají variace jednotlivých genů, nesledují do značné míry pravidla přenosu do dalších generací, která platí pro dědičnost "klasických"

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

Pohled genetika na racionální vyšetřování v preventivní kardiologii

Pohled genetika na racionální vyšetřování v preventivní kardiologii Pohled genetika na racionální vyšetřování v preventivní kardiologii Tomáš Freiberger Genetická laboratoř, Centrum kardiovaskulární a transplantační chirurgie Brno, ČR Osnova Genetické faktory vzniku KV

Více

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická

Více

Genetika dědičných neuropatií

Genetika dědičných neuropatií Genetika dědičných neuropatií P. Seeman Klinika dětské neurologie, DNA laboratoř, UK 2. LF a FN Motol Praha a CMT tým UK 2. LF a FNM CMT - dědičná choroba Známo již od Charcota, Marie a Tootha téměř 130

Více

VYKAZOVÁNÍ PRO ZDRAVOTNÍ POJIŠŤOVNY

VYKAZOVÁNÍ PRO ZDRAVOTNÍ POJIŠŤOVNY VYKAZOVÁNÍ PRO ZDRAVOTNÍ POJIŠŤOVNY JAK VYKAZOVAT JEDNOTLIVÁ VYŠETŘENÍ Vraná Milena Odd. HLA, Národní referenční laboratoř pro DNA diagnostiku, ÚHKT, Praha WWW.UHKT.CZ Přehled nových genetických kódů pro

Více

KBI/GENE Mgr. Zbyněk Houdek

KBI/GENE Mgr. Zbyněk Houdek Genealogie KBI/GENE Mgr. Zbyněk Houdek Rodokmenové schéma Shromáždění informací o rodině je 1. důležitým krokem v genetickém poradenství. Rodokmenové schéma musí být srozumitelné a jednoznačné. Poskytuje

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou

Více

Genetika člověka GCPSB

Genetika člověka GCPSB Inovace předmětu Genetika člověka GCPSB Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/28.0032 Genetika člověka / GCPSB 7. Genetika

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

a) Sledovaný znak (nemoc) je podmíněn vždy jen jedním genem se dvěma alelami, mezi kterými je vztah úplné dominance.

a) Sledovaný znak (nemoc) je podmíněn vždy jen jedním genem se dvěma alelami, mezi kterými je vztah úplné dominance. GENEALOGIE (Genealogická metoda. Genealogické symboly. Rozbor rodokmenů. Základní typy dědičnosti.) ÚVOD Genealogie je základem genetického vyšetření člověka, jehož cílem je stanovení typu dědičnosti daného

Více

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.

Více

Lze HCM vyléčit? Jak dlouho žije kočka s HCM? Je možné předejít hypertrofické kardiomyopatii?

Lze HCM vyléčit? Jak dlouho žije kočka s HCM? Je možné předejít hypertrofické kardiomyopatii? Nemoci srdce jsou, stejně jako u člověka, vrozené nebo získané v průběhu života. Ze získaných chorob srdce tvoří velkou část kardiomyopatie, což je onemocnění srdečního svalu spojené s jeho dysfunkcí,

Více

Sylabus témat ke zkoušce z lékařské biologie a genetiky. Struktura, reprodukce a rekombinace virů (DNA viry, RNA viry), význam v medicíně

Sylabus témat ke zkoušce z lékařské biologie a genetiky. Struktura, reprodukce a rekombinace virů (DNA viry, RNA viry), význam v medicíně Sylabus témat ke zkoušce z lékařské biologie a genetiky Buněčná podstata reprodukce a dědičnosti Struktura a funkce prokaryot Struktura, reprodukce a rekombinace virů (DNA viry, RNA viry), význam v medicíně

Více

Elektromyografie v diagnostice dědičných neuropatií

Elektromyografie v diagnostice dědičných neuropatií Elektromyografie v diagnostice dědičných neuropatií Mazanec R 1, Seeman P 2, Baránková L 1, Bojar M 1 1 Neurologická klinika 2.LF UK a FN Motol, Praha 2 Klinika dětské neurologie 2.LF UK a FN Motol, Praha

Více

ší šířen VAZEBNÁ ANALÝZA Vazba genů

ší šířen VAZEBNÁ ANALÝZA Vazba genů VAZEBNÁ ANALÝZA Vazba genů Americký genetik Thomas Morgan při genetických pokusech s octomilkami (Drosophila melanogaster) popsal zákonitosti o umístění genů na chromosomech, které existují až do současnosti

Více

Využití Sequence Capture v diagnostice svalových onemocnění

Využití Sequence Capture v diagnostice svalových onemocnění Využití Sequence Capture v diagnostice svalových onemocnění Kristýna Stehlíková Daniela Skálová Lenka Fajkusová Centrum molekulární biologie a genové terapie IHOK, FN Brno Sekce vrozených genetických poruch

Více

Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

Genetická preventivní vyšetření u vybraných monogenně dědičných onemocnění Renata Gaillyová 2010

Genetická preventivní vyšetření u vybraných monogenně dědičných onemocnění Renata Gaillyová 2010 Fakultní Nemocnice Brno Jihlavská 20, 639 00 Brno Genetická preventivní vyšetření u vybraných monogenně dědičných onemocnění Renata Gaillyová 2010 Molekulární biologie Metodiky využívané stále šířeji v

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

Terapeutické klonování, náhrada tkání a orgánů

Terapeutické klonování, náhrada tkání a orgánů Transfekce, elektroporace, retrovirová infekce Vnesení genů Vrstva fibroblastů, LIF Terapeutické klonování, náhrada tkání a orgánů Selekce ES buněk, v nichž došlo k začlenění vneseného genu homologní rekombinací

Více

Genetika kardiomyopatií. Pavol Tomašov Kardiologická klinika 2. LF UK a FN v Motole, Praha

Genetika kardiomyopatií. Pavol Tomašov Kardiologická klinika 2. LF UK a FN v Motole, Praha Genetika kardiomyopatií Pavol Tomašov Kardiologická klinika 2. LF UK a FN v Motole, Praha Úvod 1. Některé kardiomyopatie jsou monogenně podmíněná dědičná onemocnění 2. Dědičné kardiomyopatie mají velkou

Více

Genové knihovny a analýza genomu

Genové knihovny a analýza genomu Genové knihovny a analýza genomu Klonování genů Problém: genom organismů je komplexní a je proto obtížné v něm najít a klonovat specifický gen Klonování genů Po restrikčním štěpení genomové DNA pocházející

Více

Familiární středomořská (Mediterranean) horečka (Fever)

Familiární středomořská (Mediterranean) horečka (Fever) www.printo.it/pediatric-rheumatology/cz/intro Familiární středomořská (Mediterranean) horečka (Fever) Verze č 2016 2. DIAGNÓZA A LÉČBA 2.1 Jak se nemoc diagnostikuje? Obecně se uplatňuje následující postup:

Více

Mendelistická genetika

Mendelistická genetika Mendelistická genetika Základní pracovní metodou je křížení křížení = vzájemné oplozování organizmů s různými genotypy Základní pojmy Gen úsek DNA se specifickou funkcí. Strukturní gen úsek DNA nesoucí

Více

Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI

Více

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár

Více

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních

Více

MagPurix Blood DNA Extraction Kit 200

MagPurix Blood DNA Extraction Kit 200 MagPurix Blood DNA Extraction Kit 200 Kat. č. ZP02001-48 Doba zpracování: 50-60 minut pro MagPurix 12S 50-70 minut pro MagPurix 24 Použití Souprava MagPurix Blood DNA Extraction Kit 200 je určena pro izolátor

Více

HEMOFILIE A a B. Alžběta Petruchová, Vendula Trunčíková, Dominika Reňáková, Milena Vévodová, Petra Peňázová, Jan Dobrovolný

HEMOFILIE A a B. Alžběta Petruchová, Vendula Trunčíková, Dominika Reňáková, Milena Vévodová, Petra Peňázová, Jan Dobrovolný HEMOFILIE A a B Alžběta Petruchová, Vendula Trunčíková, Dominika Reňáková, Milena Vévodová, Petra Peňázová, Jan Dobrovolný Projevy onemocnění Hemofilie A a B jsou dědičné krvácivé choroby, které jsou způsobeny

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)

Více

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii ONKOGENETIKA Spojuje: - lékařskou genetiku - buněčnou biologii - molekulární biologii - cytogenetiku - virologii Důležitost spolupráce různých specialistů při detekci hereditárních forem nádorů - (onkologů,internistů,chirurgů,kožních

Více

19.b - Metabolismus nukleových kyselin a proteosyntéza

19.b - Metabolismus nukleových kyselin a proteosyntéza 19.b - Metabolismus nukleových kyselin a proteosyntéza Proteosyntéza vyžaduje především zajištění primární struktury. Informace je uložena v DNA (ev. RNA u některých virů) trvalá forma. Forma uskladnění

Více

Diagnostika poškození srdce amyloidem

Diagnostika poškození srdce amyloidem Diagnostika poškození srdce amyloidem Tomáš Paleček Komplexní kardiovaskulární centrum 1. LF UK a VFN, II. Interní klinika kardiologie a angiologie, Praha ICRC-FNUSA, Brno Postižení srdce: 1. Pozitivní

Více

Crossing-over. over. synaptonemální komplex

Crossing-over. over. synaptonemální komplex Genetické mapy Crossing-over over v průběhu profáze I meiózy princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem synaptonemální komplex zlomy a nová spojení chromatinových

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010 Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem Milan Bartoš Forum veterinarium, Brno 2010 Vývoj farmakogenetické diagnostické soupravy pro stanovení genetických polymorfismů

Více

Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21

Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21 Glosář - Cestina alely aneuploidie asistovaná reprodukce autozomálně dominantní autozomálně recesivní BRCA chromozom chromozomová aberace cytogenetický laborant de novo Různé formy genu, které se nacházejí

Více

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Hemofilie Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Definice hemofilie Nevyléčitelná vrozená krvácivá choroba s nedostatkem plazmatických faktorů FVIII hemofile A FIX hemofile

Více

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin Část Molekulární biologie a imunologie 6. Základy dědičnosti Mendelovská dědičnost (autozomálně recesivní, autozomálně dominantní a X-vázaný přenos mutací). Nemendelovská dědičnost (uniparentální disomie,

Více