Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie."

Transkript

1 Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: # FRIEDREICH ATAXIA 1; FRDA * FRDA GENE; FRDA Popis onemocnění Friedreichova ataxie (FRDA) je autosomálně recesivní neurodegenerativní onemocnění s frekvencí výskytu 1: v Evropské populaci (frekvence přenašečů 1:120). V 98% případů je příčinou FRDA homozygotní dynamická mutace spočívající v amplifikaci repetice GAA uvnitř 1. intronu genu X25. Tento gen je lokalizován na chromosomu 9 v oblasti 9q a kóduje protein frataxin. V normální populaci je počet repetic GAA 6 36, patologické alely obsahují repetic. Počet repetic je považován za premutaci, která může v dalších generacích expandovat do plné mutace. Analýza počtu repetic GAA u kontrolních vzorků vytvořila dvě skupiny alel: 83% alel obsahovalo 6 10 repetic ( malé normální alely ), 17% mělo repetic ( velké normální alely ). Sekvenční analýza ukázala, že žádná standardní alela neobsahuje více než 27 nepřerušených repetic GAA. U všech standardních alel s počtem repetic větším než 27 byla repetice GAA přerušena hexanukleotidovou repeticí GAGGAA. Repetice GAA na normálních chromosomech jsou stabilní při přenosu z rodičů na potomstvo, zatímco expandované repetice vykazují meiotickou i mitotickou nestabilitu. Expanze repetice GAA vede k potlačení exprese genu X25 a to pravděpodobně z důvodu tvorby stabilní non B struktury DNA, která blokuje transkripci. Množství výsledné mrna a tedy i samotného proteinu je v opačné korelaci s velikostí expanze repetice GAA. Tento efekt vytváří biologický základ pro korelaci mezi velikostí expanze a výsledným fenotypovým projevem onemocnění (tj. věkem počátečních projevů choroby, závažností a rozsahem postižení). Doposud bylo u pacientů s FRDA popsáno cca 17 bodových mutací. Pacienti, u kterých byly bodové mutace detekovány, jsou složení heterozygoti s expanzí repetice GAA na jedné alele a bodovou mutací na druhé alele. Zatím nebyl zachycen pacient homozygot nebo složený heterozygot na bodové mutace.

2 Gen X25 (6 exonů) kóduje protein frataxin (210 aminokyselin, 18 kda). Frataxin je lokalizován na vnitřní mitochondriální membráně a jeho absence má za následek nadměrnou mitochondriální akumulaci železa a deficit aktivity mitochondriálních Fe S proteinů v případě analýzy endomyocardiálních biopsií a mozkové tkáně pacientů s diagnózou FRDA. V kultivovaných kožních fibroblastech nebo kosterních svalech pacientů s FRDA významnější deficit aktivity Fe S proteinů prokázán nebyl. Kritéria pro klinickou diagnostiku FRDA navrhla A. E. Harding a podrobněji je o nich psáno v kapitole Výběr pacientů pro molekulárně genetickou diagnostiku FRDA. Kromě neurodegenerativních příznaků, jejichž frekvence se liší v závislosti na délce trvání nemoci, má většina pacientů hypertrofickou kardiomyopatii a téměř třetina pacientů má diabetes nebo nižší stupeň glukosové tolerance. Kliniká kriteria mohou být použity pro rozdělení pacientů s FRDA na typické a netypické případy. Na jedné straně jsou pacienti, kteří nemají všechny kliniké příznaky FRDA a přesto jsou nositeli homozygotní expanze repetice GAA v genu X25. Na druhé straně jsou pacienti klinicky podobni pacientům s FRDA, ale geneticky je onemocnění spojeno s genem pro protein přenášející alfa tokoferol na chromosomu 8q13. Mutace v tomto proteinu mají za následek poruchu inkorporace vitaminu E do VLDL (very low density lipoprotein). V roce 2001 byl pomocí vazebné analýzy na chromosomu 9 nalezen další lokus spojený s FRDA. Tento lokus se nachází v oblasti 9p23 9p11 a obsahuje 81 genů. Nyní je u pacientů s vazbou FRDA a lokusu 9p23 9p11 prováděna sekvenční analýza vytypovaných genů. Molekulárně genetická diagnostika Obecná strategie: 1. Kritéria pro výběr pacientů pro molekulárně genetickou diagnostiku FRDA. a) Nezbytná kritéria (>95%): věk projevu nemoci před 25. rokem, progredující ataxie chůze a končetin, autosomálně recesivní dědičnost, areflexie dolních končetin, extenční iritační pyramidové jevy (Babinského příznak), měření rychlosti vedení motorickými nervy na horních končetinách > 40 m/s, malé nebo nevýbavné SNAP (sensory nerve action potential). b) Přídatná kritéria (>65%): dysarthrie, centrální paréza dolních končetin, areflexie horních končetin, pallanestezie a ztráta polohocitu dolních končetin, skolióza,

3 abnormální EKG. c) Další příznaky (asi 50%): nystagmus, optická atrofie, hluchota, distální slabost a atrofie, pes cavus. 2. Izolace DNA 3. Stanovení počtu repetic GAA v 1. intronu genu X25 pomocí: a) PCR Sekvence primerů ohraničují repetici GAA : GAA 104F: 5 GGCTTAAACTTCCCACACGTGTT 3 GAA 629R: 5 AGGACCATCATGGCCACACTT 3 Použité chemikálie: Systém pro amplifikaci dlouhých úseků DNA Expand Long Template PCR System (Roche) Sekvence amplifikovaného úseku DNA: agtttgtact ttaggcttaa acttcccaca cgtgttattt ggcccacatt gtgtttgaag aaactttggg attggttgcc agtgcttaaa agttaggact tagaaaatgg atttcctggc aggacgcggt ggctcatgcc cataatctca gcactttggg aggcctagga aggtggatca cctgaggtcc ggagttcaag actaacctgg ccaacatggt gaaacccagt atctactaaa aaatacaaaa aaaaaaaaaa aaaagaagaa gaagaagaag aagaagaaga aaataaagaa aagttagccg ggcgtggtgt cgcgcgcctg taatcccagc tactccagag gctgcggcag gagaatcgct tgagcccggg aggcagaggt tgcattaagc caagatcgcc caatgcactc cggcctgggc gacagagcaa gctccgtctc aaaaaataat aataataaat aaaaataaaa aataaaatgg atttcccagc atctctggaa aaataggcaa gtgtggccat gatggtcctt (pozn: silně jsou vyznačeny místa nasedání primerů) Velikost produktů PCR: n pb (n je počet repetic GAA) Velikost standardních alel je 518 až 608 pb (odpovídá 6 36 repeticím GAA). Velikost mutantních alel je 770 až 4400 pb (odpovídá repeticím GAA). Velikost premutantních alel je 602 až 800 pb (odpovídá repeticím GAA). Produkty PCR jsou rozděleny v 1% agarósovém gelu a jejich velikost je vyhodnocena srovnáním s komerčně dostupnými fragmenty DNA o známé velikosti. Analyzovany vzorek je nutné současně amplifikovat se vzorky standardní DNA (u které se nepředpokládá expanze sledované repetice) a se vzorky DNA pacientů, u kterých již byla diagnóza FRDA potvrzena molekulárně genetickými metodami. V případě detekce produktu PCR o velikosti na rozhraní standardní alela/mutantní alela (velikost cca 602 až 800 pb) je vhodné provést sekvenční

4 analýzu PCR produktu a přesvědčit se tak o možnosti přerušení repetice GAA hexanukleotidovou repeticí GAGGAA (možnost stabilizace repetice GAA?). b) Southernova blotingu a hybridizace Restrikce genomové DNA, přenos rozdělené DNA na membránu, hybridizace s radioaktivně značenou sondou a následná autoradiografie detekuje v případě standardní DNA fragmenty o velikosti 2,4 kb (restrikce endonukleasou BsiHKA1), 5,6 kb (restrikce EcoRV ) a 8,2 kb (restrikce EcoR1). V případě expanze repetice GAA sonda hybridizující s 1. exonem a částí 1. intronu genu X25 detekuje fragmenty o délce související s velikostí expanze. c) Detekce bodových mutací u heterozygotních přenašečů expanze repetice GAA amplifikace jednotlivých exonů genu X25 a přímá sekvenční analýza produktů PCR. Sekvence primerů : Exon 1 (240 pb) 1F: 5 AGCACCCAGCGCTGGAGG 3 1R: 5 CCGCGGCTGTTCCCGG 3 Exon 2 (168 pb) 2F: 5 AGTAACCTACTTCTTAACTTTGGC 3 2R: 5 AGAGGAAGATACCTATCACGTG 3 Exon 3 (227 pb) 3F: 5 AAAATGGAAGCATTTGGTAATCA 3 3R: 5 AGTGAACTAAAATTCTTAGAGGG 3 Exon 4 (250 pb) 4F: 5 AAGCAATGATGACAAAGTGCTAAC 3 4R: 5 TGGTCCACAATGTCACATTTCGG 3 Exon 5a (223 pb) 5aF: 5 CTGAAGGGCTGTGCTGTGGA 3 5aR: 5 TGTCCTTACAAACGGGGCT 3 Exon 5b (224) 5bF: 5 CCCATGCTCAAGACATACTCC 3 5bR: 5 ACAGTAAGGAAAAAACAAACAGCC 3 Metody molekulárně genetické diagnostiky zavedené v Centru molekulární biologie a genové terapie, Fakultní nemocnice Brno: stanovení počtu repetic GAA v 1. intronu genu X25 pomocí PCR. Pozn.: V případě zájmu by bylo možné vyšetření doplnit o detekci bodových mutací u heterozygotních přenašečů expanze repetice GAA a o sekvenční analýzu alel s premutací. Interpretace výsledků molekulárně genetické diagnostiky založené na PCR

5 1. Expanze repetice GAA není detekována (po elektroforéze jeden popř. dva pruhy o velikosti menší než 608 pb): pacient s největší pravděpodobnosí nemá diagnózu FRDA. 2. Detekce expanze repetice GAA na obou alelách (po elektroforéze jeden popř. dva pruhy o velikosti nad 770 pb): pacient s diagnózou FRDA. 3. Detekce expanze repetice GAA na jedné alele, druhá alela standardní (po elektroforéze jeden pruh o velikosti nad 770 pb, druhý o velikosti pod 608 pb): v závislosti na klinických projevech se může jednat o přenašečství FRDA nebo o pacienta s expanzí GAA a bodovou mutací na druhé alele (přichází li v úvahu druhý případ je nutné vyšetření doplnit o sekvenční analýzu exonů genu X25). Neobvyklé kombinace s obtížnou interpretací: 4. Detekce expanze repetice GAA na jedné alele, druhá alela s premutací (po elektroforéze jeden pruh o velikosti nad 770 pb, druhý o velikosti 602 až 800 pb): v závislosti na klinických projevech se může jednat o pacienta s FRDA vyšetření je vhodné doplnit sekvenční analýzou premutované alely a zjistit možnot přerušení repetice GAA hexanukleotidovou repeticí GAGGAA. 5. Detekce alely s premutací, druhá alela standardní (po elektroforéze jeden pruh o velikosti 602 až 800 pb, druhý pod 608 pb): pravděpodobně se nebude jednat o pacienta s FRDA, v závislosti na klinických projevech je vhodné vyšetření doplnit o sekvenční analýzu premutované alely (možnot přerušení repetice GAA hexanukleotidovou repeticí GAGGAA) a sekvenční analýzu exonů genu X Detekce dvou alel s premutací (po elektroforéze jeden popř. dva pruhy o velikosti 602 až 800 pb): pravděpodobně se nebude jednat o pacienta s FRDA, v závislosti na klinických projevech vyšetření doplnit o sekvenční analýzu premutovaných alel. Návrh kontroly kvality Kontrola kvality DNA diagnostických laboratoří v rámci ČR bude provedena referenční laboratoří kontrolovanou EMQN (European Molecular Genetics Quality Network). Laboratoře, které mají zájem o provedení kontroly kvality diagnostiky FRDA, osloví referenční laboratoř a ta jim minimálně jednou do roka zašle vzorky DNA od zdravých kontrol, pacientů popř. přenašečů FRDA (potvrzeno analýzou DNA v referenční laboratoři). Výsledky DNA diagnostiky předají testované laboratoře referenční laboratoři, která provede vyhodnocení provedených analýz, tj. písemnou formou zašle kontrolovaným laboratořím výsledek.

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD Shrnutí webináře Dystrofin 101: vše, co jste kdy chtěli vědět o dystrofinu (a nebáli jste se zeptat) Francesco Muntoni (University College of London), John Porter (PPMD) Dystrofinopatie: DMD versus BMD

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Genetická "oblast nejasnosti" u HCH: co to znamená? Genetický základ

Genetická oblast nejasnosti u HCH: co to znamená? Genetický základ Novinky ve výzkumu Huntingtonovy nemoci. Ve srozumitelném jazyce. Napsáno vědci. Určeno široké huntingtonské veřejnosti. Genetická "oblast nejasnosti" u HCH: co to znamená? Přechodní alely a alely s redukovanou

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady

Více

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí Stárnutí organismu Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí poklesy funkcí se liší mezi orgánovými systémy Některé projevy stárnutí ovlivňuje výživa Diagnostické metody odlišují

Více

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor Moto: Nejvyšším štěstím každé rodiny je zdravé dítě Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor ČLK, 14. února 2013 Úvod Od poznání možností, které nám nabízí prenatální diagnostika, se embryo či později

Více

Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární

Více

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D.

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D. GENETICKÉ PORADENSTVÍ u pacientů s epidermolysis bullosa congenita MUDr. Renata Gaillyová, Ph.D. Homozygot jedinec, který zdědil po rodičích tutéž alelu. Jedinec nebo genotyp s identickými alelami v daném

Více

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.

Více

spinální svalová atrofie SMA GENETIKA Příručka pro rodiče a odborníky

spinální svalová atrofie SMA GENETIKA Příručka pro rodiče a odborníky spinální svalová atrofie SMA GENETIKA Příručka pro rodiče a odborníky GENETIKA SPINÁLNÍ SVALOVÉ ATROFIE poděkování hlavnímu autorovi: Louise Simard, Ph.D. Professor and Head Department of Biochemistry

Více

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza Iveta Valášková ivalskova@fnbrno.cz Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza nejčastěji se vyskytující autozomálně recesivní dědičná metabolická porucha v zakavkazské

Více

,, Cesta ke zdraví mužů

,, Cesta ke zdraví mužů PREZENTACE VÝSLEDKŮ ŘEŠENÍ PILOTNÍHO PROJEKTU PREVENTIVNÍ PÉČE PRO MUŢE,, Cesta ke zdraví mužů prim. MUDr. Monika Koudová GHC GENETICS, s.r.o.- NZZ, Praha Projekt byl realizován ve dvou etapách: I. etapa

Více

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Centrum nádorové cytogenetiky Ústav klinické biochemie a laboratorní diagnostiky VFN a 1. LF UK v Praze Klinický význam cytogenetických

Více

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem

Více

Projekt vyhledávání pacientů s Pompeho nemocí v ČR metodou suché kapky krve

Projekt vyhledávání pacientů s Pompeho nemocí v ČR metodou suché kapky krve Projekt vyhledávání pacientů s Pompeho nemocí v ČR metodou suché kapky krve Stanislav Voháňka, Hana Ošlejšková Eva Slouková, Janette Fartelová Neurologická klinika FN a LF MU Brno Klinika dětské neurologie

Více

Návrh směrnice pro správnou laboratorní praxi pro molekulárně genetické vyšetřování Huntingtonovy choroby

Návrh směrnice pro správnou laboratorní praxi pro molekulárně genetické vyšetřování Huntingtonovy choroby Návrh směrnice pro správnou laboratorní praxi pro molekulárně genetické vyšetřování Huntingtonovy choroby Připravily: V.Kebrlová, J.Židovská Poslední revize: březen 2007 Směrnice jsou sestaveny podle doporučení

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013 Lékařská genetika a onkologie Renata Gaillyová OLG a LF MU Brno 2012/2013 *genetické souvislosti *onkogenetická vyšetření u onkologických onemocnění * genetické vyšetření u hereditárních nádorů *presymptomatické

Více

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?

Více

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob PGD preimplantační genetická diagnostika zahrnuje soubor technik, které se používají pro zjištění

Více

Studie zdravotního stavu dětí

Studie zdravotního stavu dětí Studie zdravotního stavu dětí z Radvanic a Bartovic Miroslav Dostál Ústav experimentální mediciny AV ČR, v.v.i., Praha 1 Zdravotní stav dětí Cíl porovnat zdravotní stav dětí žijících v Radvanicích & Bartovicích

Více

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských

Více

Huntingtonova choroba. Václav Dostál Neurologie Pardubická krajská nemocnice

Huntingtonova choroba. Václav Dostál Neurologie Pardubická krajská nemocnice Huntingtonova choroba Václav Dostál Neurologie Pardubická krajská nemocnice Huntigtonova choroba Neurodegenerativní onemocnění Neuronální ztráty ve striatu Chorea, kognitivní deficit Nástup ve středním

Více

Pavel Čermák. Thomayerova nemocnice Praha - Krč. 14.2.2013 výroční zasedání SLM

Pavel Čermák. Thomayerova nemocnice Praha - Krč. 14.2.2013 výroční zasedání SLM Pavel Čermák Thomayerova nemocnice Praha - Krč Úkoly na rok 2012 Vytvoření seznamu přístrojů Doplnění podkladů pro kalkulaci Možná úprava některých stávajících výkonů?? Revize pracovních časů u všech výkonů

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11.

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. Personalizovaná medicína Roche v oblasti onkologie Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. listopadu 2013 Personalizovaná vs standardní péče Cílená léčba Spojení diagnostiky

Více

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci

Více

Co se děje v genetické laboratoři?

Co se děje v genetické laboratoři? 12 Co se děje v genetické laboratoři? Tento letáček byl vytvořen s pomocí Dr Iana M Fraylinga, Institute of Medical Genetics, University Hospital of Wales, Cardiff, UK; Dr Domenica Coviella, Laboratory

Více

Klinické sledování. Screening kardiomyopatie na podkladě familiární transthyretinové amyloidózy. u pacientů s nejasnou polyneuropatií

Klinické sledování. Screening kardiomyopatie na podkladě familiární transthyretinové amyloidózy. u pacientů s nejasnou polyneuropatií Klinické sledování Screening kardiomyopatie na podkladě familiární transthyretinové amyloidózy u pacientů s nejasnou polyneuropatií Informace pro pacienta Vážená paní, vážený pane, Na základě dosud provedených

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

Dotazník k vyšetření MODY diabetu vyplněný odešlete na adresu: MUDr. Š.Průhová, Klinika dětí a dorostu FNKV, Vinohradská 159, Praha 10, 100 81

Dotazník k vyšetření MODY diabetu vyplněný odešlete na adresu: MUDr. Š.Průhová, Klinika dětí a dorostu FNKV, Vinohradská 159, Praha 10, 100 81 Dotazník k vyšetření MODY diabetu vyplněný odešlete na adresu: MUDr. Š.Průhová, Klinika dětí a dorostu FNKV, Vinohradská 159, Praha 10, 100 81 JMÉNO, PŘÍJMENÍ Rodné číslo Pojišťovna Adresa Telefon Doporučující

Více

Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený

Více

SCREENINGOVÉ PROGRAMY V ČR Z POHLEDU VZP ČR

SCREENINGOVÉ PROGRAMY V ČR Z POHLEDU VZP ČR SCREENINGOVÉ PROGRAMY V ČR Z POHLEDU VZP ČR 5.12. 2013 MUDr. HANA ŠUSTKOVÁ, VZP ČR OBSAH 1. Screening karcinomu děložního hrdla 2. Mamografický screening 3. Screening kolorektálního karcinomu 4. Projekt

Více

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v

Více

Buněčné kultury. Kontinuální kultury

Buněčné kultury. Kontinuální kultury Buněčné kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

SEZNAM LABORATORNÍCH VYŠETŘENÍ

SEZNAM LABORATORNÍCH VYŠETŘENÍ Laboratoř morfologická SME 8/001/01/VERZE 01 SEZNAM LABORATORNÍCH VYŠETŘENÍ Cytologické vyšetření nátěru kostní dřeně Patologické změny krevního obrazu, klinická symptomatologie s možností hematologického

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

Genetické testování pro zdravotní účely

Genetické testování pro zdravotní účely Genetické testování pro zdravotní účely ZA JAKÝCH OKOLNOSTÍ PŘICHÁZÍ V ÚVAHU GENETICKÉ TESTOVÁNÍ? PROFESIONÁLNÍ GENETICKÉ PORADENSTVÍ CO HLEDÁ GENETICKÉ VYŠETŘENÍ VAŠE ROZHODNUTÍ Genetické testování pro

Více

Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku. Richard J W Currie

Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku. Richard J W Currie Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku Richard J W Currie Virus infekční bronchitidy RNA (nukleová kyselina) uvnitř Proteiny (spike proteiny S1 a S2) na vnější straně

Více

Obsah. Předmluva...13

Obsah. Předmluva...13 Obsah Předmluva...13 1 Pohyb jako základní projev života...17 1.1 Pohyb obecně...17 1.2 Pohybové chování...17 1.3 Vliv pohybu na životní pochody...18 1.4 Vztah pohybu k funkci CNS...19 1.5 Psychomotorické

Více

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela

Více

Diagnostika amyloidózy z pohledu patologa Látalová P., Flodr P., Tichý M.

Diagnostika amyloidózy z pohledu patologa Látalová P., Flodr P., Tichý M. Diagnostika amyloidózy z pohledu patologa Látalová P., Flodr P., Tichý M. Ústav klinické a molekulární patologie LF UP a FN Olomouc Úvodem -vzácná jednotka i pro patologa Statistika Ústavu klinické a

Více

2,00-4,00. 6 týdnů - koagulačně 60-120 Protein S (PS) koagulačně 50-150 % citrát 1:10-6 týdnů APC-řeď.FV deficientní

2,00-4,00. 6 týdnů - koagulačně 60-120 Protein S (PS) koagulačně 50-150 % citrát 1:10-6 týdnů APC-řeď.FV deficientní Laboratorní příručka Příloha1: Přehled vyšetření prováděných v laboratoři 105_LP_08_01_Přílohač1 sodný k provádění laboratorních testů: doby odezvy (tzv Turn-Around Time, TAT) jsou ve shodě s doporučeními

Více

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci

Více

Příloha č. 1 HLÁŠENÍ PŘI PODEZŘENÍ NA VÝSKYT VYSOCE NAKAŽLIVÉ NEMOCI VE ZDRAVOTNICKÉM ZAŘÍZENÍ POSKYTOVATELE ZDRAVOTNÍCH SLUŽEB

Příloha č. 1 HLÁŠENÍ PŘI PODEZŘENÍ NA VÝSKYT VYSOCE NAKAŽLIVÉ NEMOCI VE ZDRAVOTNICKÉM ZAŘÍZENÍ POSKYTOVATELE ZDRAVOTNÍCH SLUŽEB HLÁŠENÍ PŘI PODEZŘENÍ NA VÝSKYT VYSOCE NAKAŽLIVÉ NEMOCI VE ZDRAVOTNICKÉM ZAŘÍZENÍ POSKYTOVATELE ZDRAVOTNÍCH SLUŽEB Hlášení pořizuje v rozsahu dostupných údajů a předává místně příslušnému orgánu ochrany

Více

Doporučení ČSKB-Markery poškození myokardu Klin. Biochem. Metab., 16 (37), 2008, 1, 50-55. Universal Definition of Myocardial Infarction

Doporučení ČSKB-Markery poškození myokardu Klin. Biochem. Metab., 16 (37), 2008, 1, 50-55. Universal Definition of Myocardial Infarction První zkušenosti se stanovením hs-ctnt Vašatová M., Tichý M. Ústav klinické biochemie a diagnostiky FN a LF UK Hradec Králové Biolab 2010 Troponiny troponiny součást troponinového komplexu účast na svalové

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku

Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku 22. ledna 2015 EMA/PRAC/63322/2015 Farmakovigilanční výbor pro posuzování rizik léčiv Doporučení Farmakovigilančního výboru pro posuzování rizik léčiv (PRAC) k signálům pro aktualizaci informací o přípravku

Více

Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň

Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň Laboratoř uplatňuje flexibilní přístup k rozsahu akreditace upřesněný v dodatku. Aktuální seznam činností prováděných v rámci požadovaného flexibilního rozsahu je k dispozici na webových stránkách laboratoře

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION

CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION DIGITÁLNÍ OBRAZOVÁ ANALÝZA ELEKTROFORETICKÝCH GELŮ *** Vyhodnocování získaných elektroforeogramů: Pro vyhodnocování

Více

Myopatie u koní a jejich diferenciální diagnostika

Myopatie u koní a jejich diferenciální diagnostika Myopatie u koní a jejich diferenciální diagnostika Eva Ludvíková Diagnostika onemocnění svalů je založena na správném získání anamnézy, klinickém vyšetření pacienta a biochemickém vyšetření krve (stanovení

Více

MUTACE mutageny: typy mutací:

MUTACE mutageny: typy mutací: MUTACE charakteristika: náhodné změny v genotypu organismu oproti normálu jsou poměrně vzácné z hlediska klinické genetiky, jsou to právě mutace, které způsobují genetické choroby nebo nádorové bujení

Více

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Vývojové vady a ortopedie. studijní opora pro kombinovanou formu studia

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Vývojové vady a ortopedie. studijní opora pro kombinovanou formu studia UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vývojové vady a ortopedie studijní opora pro kombinovanou formu studia Tělesná výchova a sport zdravotně postižených Doc.MUDr.Eva Kohlíková,

Více

Život s karcinomem ledviny

Život s karcinomem ledviny Život s karcinomem ledviny Život s karcinomem ledviny není lehký. Ale nikdo na to nemusí být sám. Rodina, přátelé i poskytovatelé zdravotní péče, všichni mohou pomoci. Péče o pacienta s karcinomem buněk

Více

Změny v játrech u pacientů s Huntingtonovou chorobou naznačují, že bychom se měli zabývat změnami v celém těle

Změny v játrech u pacientů s Huntingtonovou chorobou naznačují, že bychom se měli zabývat změnami v celém těle Novinky ve výzkumu Huntingtonovy nemoci. Ve srozumitelném jazyce. Napsáno vědci. Určeno široké huntingtonské veřejnosti. Změny v játrech u pacientů s Huntingtonovou chorobou naznačují, že bychom se měli

Více

NÁDOROVÁ RIZIKA. poznejme OBSAH

NÁDOROVÁ RIZIKA. poznejme OBSAH poznejme NÁDOROVÁ RIZIKA OBSAH Úvod... 3 Proč bychom se měli dozvědět o svých vlastních rizicích?... 4 Jaké jsou naše služby?... 4 Kdo by měl být vyšetřen?... 5 Jaký je postup při vyšetřování?... 6 Informace

Více

Co víme nového o borelióze a klíšťové meningoencefalitidě?

Co víme nového o borelióze a klíšťové meningoencefalitidě? Co víme nového o borelióze a klíšťové meningoencefalitidě? Schánilec P. Hájek I. Agudelo C. F. Tato prezentace je spolufinancována Evropským sociálním fondem a státním rozpočtem České republiky. Rozšíření

Více

Epilepsie. Silvia Čillíková FEL ČVUT. 9th May 2006

Epilepsie. Silvia Čillíková FEL ČVUT. 9th May 2006 Epilepsie Silvia Čillíková FEL ČVUT 9th May 2006 Úvod Epilepsie (zkr. epi) je skupina poruch mozku projevujících se opakovanými záchvaty (paroxysmy) různého charakteru Je to relativně běžné onemocnění,

Více

Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12

Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12 Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12 Firma Abbott Laboratories nabízí na imunoanalytických systémech ARCHITECT test ke stanovení biologicky aktivní části vitaminu

Více

Informace VZP ČR k indikaci a vykazování laboratorních genetických vyšetření (odbornost 816)

Informace VZP ČR k indikaci a vykazování laboratorních genetických vyšetření (odbornost 816) Příloha č.1 Informace VZP ČR k indikaci a vykazování laboratorních genetických vyšetření (odbornost 816) Upozorňujeme smluvní partnery, lékaře i laboratoře, na základní pravidla a postupy při indikaci

Více

Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu

Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Srovnal J. 1, Cincibuch J. 2, Cwierkta K. 2, Melichar B. 2, Aujeský R. 3, Vrba R.

Více

KLÍŠŤOVÁ ENCEFALITIDA pohledem epidemiologa

KLÍŠŤOVÁ ENCEFALITIDA pohledem epidemiologa KLÍŠŤOVÁ ENCEFALITIDA pohledem epidemiologa MUDr. Renata Vaverková Krajská hygienická stanice Jihomoravského kraje se sídlem v Brně HVD - Hradec Králové 4. 10. 2013 KLÍŠŤOVÁ ENCEFALITIDA je nákazou s přírodní

Více

Genetika člověka GCPSB

Genetika člověka GCPSB Inovace předmětu Genetika člověka GCPSB Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/28.0032 Genetika člověka / GCPSB 6. Genetika

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

O původu života na Zemi Václav Pačes

O původu života na Zemi Václav Pačes O původu života na Zemi Václav Pačes Ústav molekulární genetiky Akademie věd ČR centrální dogma replikace transkripce DNA RNA protein reverzní transkripce translace informace funkce Exon 1 Intron (413

Více

Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE

Více

INOVATIVNÍ KURZY IMUNOANALÝZY A ENDOKRINOLOGIE PRO VĚDECKÉ PRACOVNÍKY- PILOTNÍ ZKUŠENOSTI LÉKAŘSKÉ FAKULTY V PLZNI

INOVATIVNÍ KURZY IMUNOANALÝZY A ENDOKRINOLOGIE PRO VĚDECKÉ PRACOVNÍKY- PILOTNÍ ZKUŠENOSTI LÉKAŘSKÉ FAKULTY V PLZNI INOVATIVNÍ KURZY IMUNOANALÝZY A ENDOKRINOLOGIE PRO VĚDECKÉ PRACOVNÍKY- PILOTNÍ ZKUŠENOSTI LÉKAŘSKÉ FAKULTY V PLZNI RNDr. Marie Karlíková, PhD. Prof. MUDr. Ondřej Topolčan, CSc. Univerzita Karlova - Lékařská

Více

P ehled výsledk z Referen ní laborato e

P ehled výsledk z Referen ní laborato e P ehled výsledk z Referen ní laborato e 1,3 Hajdúch M, 1,3 Trojanec R, 2,3 Kolá Z, 1,3 Bouchalová K, 2,3 Sedláková E. 1 Laborato experimentální medicíny p i D tské klinice LF UP a FN Olomouc 2 Laborato

Více

ZADÁVACÍ PODMÍNKY. Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT) Sídlo: U Nemocnice 2094/1, 128 20 Praha 2 IČ / DIČ

ZADÁVACÍ PODMÍNKY. Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT) Sídlo: U Nemocnice 2094/1, 128 20 Praha 2 IČ / DIČ VÝZVA K PODÁNÍ NABÍDEK DO VÝBĚROVÉHO ŘÍZENÍ NA ZADÁVACÍ PODMÍNKY Název zakázky: Systém Real-Time PCR 1. Identifikační údaje zadavatele Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT)

Více

Diabetes mellitus 1. typu a přidružené autoimunitní choroby

Diabetes mellitus 1. typu a přidružené autoimunitní choroby Diabetes mellitus 1. typu a přidružené autoimunitní choroby Venháčová J., Venháčová P. Diabetologické centrum Dětská klinika FN a LF UP Olomouc SRPDD červen 2011 Nejčastější přidružené autoimunitní choroby

Více

Zdravotnické laboratoře. MUDr. Marcela Šimečková

Zdravotnické laboratoře. MUDr. Marcela Šimečková Zdravotnické laboratoře MUDr. Marcela Šimečková Český institut pro akreditaci o.p.s. 14.2.2006 Obsah sdělení Zásady uvedené v ISO/TR 22869- připravené technickou komisí ISO/TC 212 Procesní uspořádání normy

Více

Činnost a aktivity zdravotníků v oblasti klonování a GMO

Činnost a aktivity zdravotníků v oblasti klonování a GMO Konference ZV PS ČR Klonování a GMO dne 7. 5. 2015 v Praze Činnost a aktivity zdravotníků v oblasti klonování a GMO Vladimír Ostrý Státní zdravotní ústav v Praze Centrum zdraví, výživy a potravin v Brně

Více

Martina Havlíčková Helena Jiřincová. NRL pro chřipku, Státní zdravotní ústav

Martina Havlíčková Helena Jiřincová. NRL pro chřipku, Státní zdravotní ústav Pandemic H1N1 2009 Martina Havlíčková Helena Jiřincová NRL pro chřipku, Státní zdravotní ústav Z historie H1N1 1916-1917 pravděpodobná cirkulace viru, malá ohniska, lokální epidemie ve vojenských táborech,

Více

DNA, komplementarita, dopsání komplementárního vlákna

DNA, komplementarita, dopsání komplementárního vlákna Příklady z genetiky Řešené příklady ze stránek http://genetika.wz.cz/priklady/. Jakákoli písemná publikace tohoto textu bez uvedení zdroje není povolena. DNA, komplementarita, dopsání komplementárního

Více

Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA

Více

INFORMACE PRO PACIENTY LÉČBA PACIENTŮ S AUTOIMUNITNÍMI NERVOSVALOVÝMI ONEMOCNĚNÍMI INTRAVENÓZNÍM LIDSKÝM IMUNOGLOBULINEM A VÝMĚNNOU PLAZMAFERÉZOU

INFORMACE PRO PACIENTY LÉČBA PACIENTŮ S AUTOIMUNITNÍMI NERVOSVALOVÝMI ONEMOCNĚNÍMI INTRAVENÓZNÍM LIDSKÝM IMUNOGLOBULINEM A VÝMĚNNOU PLAZMAFERÉZOU NÁRODNÍ SADA KLINICKÝCH STANDARDŮ 1 LÉČBA PACIENTŮ S AUTOIMUNITNÍMI NERVOSVALOVÝMI ONEMOCNĚNÍMI INTRAVENÓZNÍM LIDSKÝM IMUNOGLOBULINEM A VÝMĚNNOU PLAZMAFERÉZOU INFORMACE PRO PACIENTY ZÁŘÍ 2010 Technologický

Více

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno Zpracování a využití biologického materiálu pro výzkumné účely od nemocných s monoklonální gamapatií Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie,

Více

+ F1 F2 + TRANSPLANTAČNÍ PRAVIDLA. Inbrední kmen A. Inbrední kmen B. Genotyp aa. Genotyp bb. Genotype ab. ab x ab. aa ab ab bb Genotypy

+ F1 F2 + TRANSPLANTAČNÍ PRAVIDLA. Inbrední kmen A. Inbrední kmen B. Genotyp aa. Genotyp bb. Genotype ab. ab x ab. aa ab ab bb Genotypy IMUNOGENETIKA II TRANSPLANTAČNÍ PRAVIDLA Inbrední kmen A Inbrední kmen B - F1 - e x F2 y y TRANSPLANTAČNÍ PRAVIDLA Inbrední kmen A Inbrední kmen B - F1 - e 3 4 x 3 4 F2 - - y y Transplantace orgánů,, které

Více