Populační genetika II

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Populační genetika II"

Transkript

1 Populační genetika II

2 4. Mechanismy měnící frekvence alel v populaci Genetický draft (genetické svezení se)

3 Genetický draft = zvýšení frekvence alely díky genetické vazbě s výhodnou mutací. Selekční vymetení selective sweep = snížení genetické variability v okolí výhodné mutace.

4 Selekce na pozadí = snížení frekvence alel díky genetické vazbě s nevýhodnou mutací. Také vede ke snížení genetické variability v populaci, není však tak výrazné, jako u selekčního vymetení.

5 Vazebná nerovnováha Vyjadřuje skutečnost, že se určité kombinace alel ve dvou či více lokusech vyskytují v populaci častěji či méně často než by odpovídalo jejich náhodné kombinaci. A A a B b a A b A A B b a B B a A b a B b a b B A A a B a B A b A A b B a B B a A b a B b a b b AB. 25% ab. 25% ab. 25% Ab. 25% VAZEBNÁ ROVNOVÁHA AB. 40% ab. 40% ab. 10% Ab. 10% VAZEBNÁ NEROVNOVÁHA

6 Vazebná nerovnováha (D) D = pozorované očekávané frekvence kombinace alel Očekávané frekvence kombinace alel (tj. náhodné kombinace) jsou dané pouze frekvencí alel v populaci. AB ab Ab ab Očekávané frekvence p 1 q 1 p 2 q 2 p 1 q 2 p 2 q 1 p 1 frekvence alely A p 2 frekvence alely a q 1 frekvence alely B q 2 frekvence alely b D = 0 D > 0 či D < 0 vazebná rovnováha vazebná nerovnováha

7 Vazebná nerovnováha (D) Míra vazebné nerovnováhy závisí nepřímoúměrně na míře rekombinace (r) a efektivní velikosti poulace (N e ). Vazebná nerovnováha způsobená vzájemnou vazbou genů po čase v populaci vymizí. D = 1 4N e r Populační rekombinační rychlost

8 Odhaduje se jako počet cm na Mb. Míra rekombinace (r) U člověka v průměru 1cM ~ 1Mb. U myši 1cM ~ 2Mb. Liší se však výrazně v různých částech genomu. Většina rekombinačních událostí v určitých krátkých úsecích horká místa rekombinace. Pozice a síla horkých míst se v evoluci rychle mění. Jsou variabilní v i rámci druhu. Míra rekombinace se liší mezi pohlavími. Haldane-Huxley pravidlo: Pokud jedno pohlaví nerekombinuje vůbec, pak je to vždy pohlaví heterogametické Obecně větší míra rekombinace na malých chromosomech než na velkých. Obecně rekombinace néněčastá u centromery a častější u telomer.

9 Genetický draft zvyšuje míru vazebné nerovnováhy v populaci

10 Míra vazebná nerovnováhy je různá v různých částech genomu Haplotypová mapa lidského genomu Mapuje míru vazebné nerovnováhy podél genomu. Využívá se pro genetické mapování znaků v populaci (asociační mapování).

11 5. Neutrální teorie molekulární evoluce

12 Neutrální teorie molekulární evoluce Mottoo Kimura, konec 60. a začátek 70. let 20. stol. Její vytvoření stimulováno pozorováním, že v populacích existuje velké množství polymorfismu. Kimura navrhl, že by se mohlo jednat o neutrální polymorfismus. Ukazuje jak bude vypadat genetická variabilita v rámci populace a mezi druhy v případě, že mutace jsou neutrální. Poskytuje nulovou hypotézu. Většina testů selekce založena na tom, že se snaží vyvrátit neutralitu.

13 Neutrální teorie molekulární evoluce Neutrální teorie evoluce je matematický model. Předpoklady modelu: panmiktická populace, nepřekrývající se generace, konstantní velikost populace. Model je popsán několika volně nastavitelnými parametry (např. mutační rychlost, frekvence alel, velikost populace). Parametry lze odhadovat ze skutečných dat (odhady parametrů). Lze testovat, jestli naše data odpovídají neutrálnímu modelu či ne.

14 Míra vnitrodruhového polymorfismu za předpokladu neutrality Genetický polymorfismus θ = 4N e µ Míra polymorfismu v populaci závisí přímoúměrně na mutační rychlosti a velikosti populace. Druhy s velkými populacemi (drozofila) jsou polymorfnější než druhy s malými populacemi (člověk).

15 Empirické odhady genetického polymorfismu (θ) polymorfismus = existence více než jedné alely v populaci. AGTGAGTCGTCAGTACTGCTG ACTGAGTCGTCAGTACAGCTG AGTGTGTCGTCCGTACTGCTG ACTGAGTCGTCAGTACTGCTG ACTGAGTCGTCAGTACTGCTG AGTGTGTCGTCCGTACTGCTG ACTGAGTCGTCAGTACTGCTG ACTGTGTCGTCCGTACTGCTG AGTGAGTCGTCAGTACTGCTG AGTGAGTCGTTAGTACTGCTG ACTGAGTCGTCAGTACTGCTG θ = proporce polymorfních míst π = nukleodidová diverzita, průměrná heterozygozita

16 Rozložení frekvence alel za předpokladu neutrality V populaci je nejvíce vzácných alel a nejméněčastých alel.

17 Při neutrální distribuci frekvence alel, θ = π Pokud θǂπ a) Na sekvenci působí selekce. b) Jsou porušeny předpoklady modelu. Obvykle populace nemá konstantní velikost. θ >π π >θ nadbytek vzácných alel (pozitivní a negativní selekce či populační expanze). nadbytek středně četných alel (balancing selekce či bottle-neck) Tajima s D test - test na detekci selekce. - založen na porovnáníθa π. D = (π -θ)/var(d) Jak od sebe odlišit vliv selekce a demografických faktorů?

18 Doba fixace mutace Průměrná doba fixace nové mutace (počítáno jen pro mutace, které se nakonec zafixují): neutrální mutace: t = 4N e generací (pro chrx: 3N e, pro chry, mt DNA: 1N e )

19 U druhů s velkou efektivní velikostí populace může přetrvávat neutrální polymorfismus několik milionů let. Vysvětluje proč je ve velkých populacích velké množství polymorfismu. Průměrná doba existence druhu je 4 milióny let. Dva příbuzné druhy mohou sdílet polymorfismus, který zdědily od společného předka (ancestrální polymorfismus).

20 Rychlost evoluce za předpokladu neutrality Evoluční/substituční/fixační rychlost = počet nových mutací x pravděpodobnost jejich fixace k = 2N e µ 1 = µ 2N e N e efektivní velikost populace µ mutační rychlost pravděpodobnost fixace nové mutace počet nových mutací v populaci Evoluční rychlost pro neutrální sekvence je ovlivněna pouze mutační rychlostí. Nezávisí na efektivní velikosti populace. Za předpokladu neměnné mutační rychlosti je evoluční rychlost v čase konstantní. Molekulární hodiny.

21 Míra divergence za předpokladu neutrality Genetická divergence = substituční rychlost x čas D = 2µt počet mutací, které vzniknou za určitý čas. t

22 Odhad genetické divergence ze skutečných dat AGTGAGTCGTCAGTACTGCTG ACTTAGCCGTGAGTACAGCTA 6 D = = 0,2857 (28,57%) 21 Proporce nukleotidových míst, které se liší mezi dvěma sekvencemi DNA.

23 Problém saturace Po určité době divergence přestane stoupat. Je to kvůli mnohočetným substitucím ve stejné pozici. Došlo k saturaci. Divergence spočítaná mezi sekvencemi s mnohočentými substitucemi ve stejné pozici je podhodnocená. skutečných počet substitucí pozorovaný počet substitucí

24 Jak odhadnout skutečnou divergenci? Nukleotidové substituční modely Umožňují korekci na mnohonásobné substituce a odhad skutečné divergence. Jukes & Cantor (1 parameter) model -Nejjednodušší jednoparametrový model model -Předpokládá, že všech možné substituce stejnou pravděpodobnost (α) a všechny nukleotidy mají stejnou frekvenci. Kimura (2 parameter) model -Pravděpodobnost tranzic větší než pravděpodobnost transverzí Felsenstein 81 (4 parameter) model -Umožňuje nastavit různé frekvence nukleotidů HKY-Hasegawa,Kishino,Yano (5 parameter) model -Zohledňuje odlišnou pravděpodobnost transic a transverzí i různé frekvence nukleotidů HKY + Γ -Gama parametr umožňuje modelovat odlišnou rychlost substitucí v různých nukleotidových pozicích Program ModelTest: vybere model, který nejlépe sedí na data

25 Molekulární hodiny a odhad doby divergence Umožňují odhadnout dobu divergence dvou taxonů pokud známe jejich genetickou divergenci a substituční rychlost sekvence. Substituční rychlost se dá odhadnout pomocí známé doby divergence některých taxonů určené např. na základě paleontologických dat (kalibrace molekulárních hodin). nejčastěji se používá sekvence cytochromu b (mt DNA), která má u savců a ptáků substituční rychlost cca 0,01. Tzn. 2% divergence ~ 1 mil let. D = 2µt

26 Pomocí molekulárních hodin odhadujeme dobu divergence sekvencí. Ta může být výrazně nadhodnocená pokud druhy stále sdílí ancestrální polymorfismus. Odhady divergence pomocí molekulárních hodin má smysl používat jen pro vzdálenější taxony. divergence sekvencí divergence druhů

27 Substituční rychlost je velmi variabilní u různých taxonů Substituční rychlosti pro cytochrom b u ptáků. Pravidlo 2% divergence ~ 1 mil let, neplatí!

28 Proč je substituční rychlost tak rozličná mezi druhy/taxony? Velkou část variability v substituční rychlosti vysvětlí variabilita ve velikosti těla.

29 Hypotéza generační doby Malé druhy mají obvykle kratší generační dobu. Druhy s krátkou generační dobou se častěji rozmnožují. Mají celkově více buněčných dělení v germinální linii v přepočtu na jeden rok. Pokud většina mutací vzniká při replikaci, je u nich zvýšená mutační rychlost a tím pádem i substituční rychlost. Nedokáže ale vysvětlit proč substituční rychlost obecně vyšší u teplokrevných organismů.

30 Metabolická hypotéza Mutační rychlost a tím pádem substituční rychlost daná především rychlostí metabolismu. Při vyšší rychlosti metabolismu, vyšší oxidativní stres. Druhy s malou velikostí mají rychlejší substituční rychlost. Vysvětlí proč teplokrevní mají vyšší substituční rychlost než studenokrevní.

31 Hypotéza dlouhověkosti Dlouhověké druhy si vyvinuly mechanismy, jak se bránit oxidativnímu stresu. Nezpůsobuje u nich tolik mutací, můžou se tak dožít vysokého věku. Substituční rychlost je tak u nich snížená. vysoký metabolismus dlouhověcí nízký metabolismus krátkověcí

32 Téměř neutrální teorie evoluce neutrální mutace působí na ně drift škodlivé / výhodné mutace působí na ně selekce mírně škodlivé / výhodné mutace působí na ně drift i selekce Pokud 2s = 1/2N e, selekce a drift na osud alely stejný vliv. Tomoko Ohta (Téměř) neutrální mutace: 2s < 1/2N e O jejich osudu rozhoduje více drift než selekce Mírně škodlivé/výhodné mutace se v malých populacích chovají jako neutrální, kdežto ve velkých jako škodlivé.

33 Téměř neutrální teorie evoluce předpovídá rychlejší evoluční rychlost v malých populacích Většina mutací škodlivých. V malých populacích se fixuje více škodlivých mutací než ve velkých. Druhy s malými populacemi mají rychlejší substituční rychlost (rychlejší molekulární hodiny) než druhy s velkými populacemi. > >

34 Téměř neutrální evoluce může vysvětlit rychlejší evoluci chromosomu X Chromosom X má menší efektivní velikost populace než autosomy. Můžou se na něm snadněji fixovat mírně škodlivé mutace. Rychlejší evoluce.

35 Molekulární hodiny V praxi moc nefungují ze dvou důvodů: 1. Mutační rychlost pro jednotlivé geny není konstantní napříč fylogenezí. Liší se u různých taxonů. 2. Evoluční rychlost není zcela nezávislá na velikosti populace. Ta se také velmi liší mezi různými druhy.

36 Existuje souvislost mezi substituční rychlostí a rychlostí fenotypické evoluce? Hatérie novozélandská pomalý metabolismus dlouhá generační doba pomalá fenotypická evoluce Ale rychlé molekulární hodiny! Substituční rychlost nemusí být daná pouze generační dobou a metabolickou rychlostí. Substituční rychlost nemusí souviset s rychlostí fenotypické evoluce.

37 6. Detekce selekce na molekulární úrovni

38 Výhody detekce selekce na molekulární úrovni Netřeba znát předem fenotyp. Lze detekovat i selekci, která působila v minulosti.

39 Typy selekce Pozitivní selekce: působí na výhodné mutace, vede k jejich fixaci v populaci snižuje genetickou variabilitu v populaci (selektivní vymetení) dlouhodobá pozitivní selekce zvyšuje míru divergence mezi druhy Negativní selekce: působí na nevýhodné mutace, vede k jejich odstranění z populace snižuje genetickou variabilitu v populaci (selekce na pozadí) dlouhodobá negativní selekce snižuje míru divergence mezi druhy Balancing selekce: Udržuje v populaci trvale polymorfismus selekce ve prospěch heterozygotů, frekvenčně závislá selekce

40 Detekce nedávné pozitivní selekce 1. Detekce založená na průvodních jevech selective sweep - snížení genetické variability (Hudson-Kreitman-Aguadé test) - zvýšení vazebné nerovnováhy (Extended haplotype test) - změna v distribuci frekvence alel (Tajima s D test) Selekce před max. ~ N e generacemi (u člověka ~ let). vznik výhodné mutace neúplný selective sweep úplný selective sweep

41 Detekce nedávné pozitivní selekce 2. Detekce založená na zvýšené míře genetické diferenciace subpopulací - Detekce genů odpovědných za lokální adaptace. Disruptivní selekce. - F ST outlier test Geny podmiňující lokální adaptace vykazují menší genový tok mezi subpopulacemi ve srovnání s neutrálními geny. Budou vykazovat odlišnější frekvence alel mezi subpopulacemi a tím pádem větší hodnoty F ST.

42 Mapa recentě pozitivně selektovaných lokusů v lidské populaci 9 studií na Perlegen či HapMap SNP datových souborech. Detekce selekce pomocí LD, distribuce frekvence alelči Fst. Identifikováno: 5110 různých lokusů (zahrnuje 23 % všech genů). 722 ve > 2 studiích 271 ve > 3 studiích 129 ve > 4 studiích

43 LCT gen kódující laktázu V lidské populaci vzniklo nezávisle několik mutací v LCT genu, které umožňují trávit mléko i v dospělostí. Souvisí s rozšířením pastevectví. Výskyt laktázové perzistence Evropská populace Asijská populace

44 G6PD gen kódující glukóza-6-fosfát dehydrogenázu Mutace v tomto genu způsobují rezistenci vůči malárii.

45 Další geny identifikované v testech pozitivní selekce Alcohol dehydrogenase (ADH) gene Geny odpovědné za pigmentaci kůže

46 Analýza funkce 2465 genů, které leží v 722 lokusech identifikovaných ve > 2 studiích Recentní pozitivní selekce se často týká genů s funkcí v metabolismu. Souvisí pravděpodobně s výraznou změnou ve stravování lidí v nedávné historii.

47 Mezi několika málo geny identifikovanými v 6 z 9 studiích gen PCDH15 Hraje roli ve vývoji vnitřního ucha a sítnice. Mutace v tomto genu způsobují hluchotu a slepotu (Uscherův syndrom) Mezi geny identifikovanými v několika studiích také MYO1B, MYO3A a MYO6, které také důležité ve funkci vnitřního ucha. Důležitá role smyslů v lidské evoluci.

48 Mezi pozitivně selektovanými geny jsou i geny podmiňující různé lidské chroroby CFTR gen - mutace v tomto genu způsobují cystickou fybrózu ALMS1 gen - spojený s Alstromovým syndromem (pacienti vykazují obezitu, cukrovku, slepotu) GBA gen - štěpení glukosacharidů, - mutace v tomto genu způsobují Gaucherovu chorobu

49 Jak může frekvenci mutací způsobujících lidské choroby ovlivňovat pozitivní selekce? 1. Mutace způsobující chorobu jsou recesivní a v heterozygotním stavu přinášejí nějakou výhodu (balancing selekce). G6PD gen způsobuje resistenci vůči malárii v heterozygotním stavu, ale v homozygotním stavu, může způsobit hemolytickou anémii. CFTR gen způsobuje v homozygotním stavu cystickou fibrózu, ale v heterozygotním stavu poskytuje ochranu proti astma. 2. V historii došlo ke změně ve směru působení selekce Dříve spíše nedostatek potravy, selekce maximalizovala účinnost metabolismu. Dnešní nadbytek potravy způsobuje metabolické choroby. Alely, které byly výhodné dříve jsou dnes nevýhodné.

50 Detekce dlouhodobě působící selekce Využívá se srovnání sekvencí z různých, často vzdálených, druhů Negativní selekce snižuje míru divergence mezi druhy, častější synonymní substituce Pozitivní selekce zvyšuje míru divergence mezi druhy, častější nesynonymní mutace

51 Test neutrality založený na relativním počtu nesynonymních (K A ) synonymních (K S ) substitucí mezi druhy Synonymní substituce: nevedou k záměně aminokyseliny Nesynonymní substituce: vedou k záměně aminokyseliny K A /K S = 1 K A /K S > 1 K A /K S < 1 neutrální evoluce pozitivní selekce negativní selekce

52 K A /K S test Většina genů má K A /K S zhruba 0,1 0,2. Tzn. na většinu genů působí negativní selekce. člověk vs myš

53 K A /K S test V rámci jednoho genu může na některé kodóny působit pozitivní selekce, na jiné negativní a jiné se mohou vyvíjet neutrálně. Nové metody umožňují počítat K A /K S pro jednotlivé kodóny či pro jednotlivé evoluční linie. Užitečná je analýza sliding window umožnující počítat K A /K S pro různé oblasti genu.

54 Geny s vysokým poměrem K A /K S Často důležitou roli v reprodukci. U savců dále v imunitní odpovědi a čichu (např. MHC geny, OBP geny).

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Populační genetika Radka Reifová

Populační genetika Radka Reifová Populační genetika Radka Reifová Prezentace ke stažení: http://web.natur.cuni.cz/~radkas v záložce Courses Literatura An Introduction to Population Genetics. Rasmus Nielsen and Montgomery Slatkin. 2013.

Více

Molekulární podstata adaptací a detekce selekce na molekulární úrovni

Molekulární podstata adaptací a detekce selekce na molekulární úrovni Molekulární podstata adaptací a detekce selekce na molekulární úrovni Adaptace Metody detekce selekce na molekulární úrovni Netřeba znát předem fenotyp. Lze detekovat i selekci, která působila v minulosti.

Více

Genetické mapování. v přírodních populacích i v laboratoři

Genetické mapování. v přírodních populacích i v laboratoři Genetické mapování v přírodních populacích i v laboratoři Funkční genetika Cílem je propojit konkrétní mutace/geny s fenotypem Vzniklý v laboratoři pomocí mutageneze či vyskytující se v přírodě. Forward

Více

Velikost genomu a mutační rychlost

Velikost genomu a mutační rychlost Velikost genomu a mutační rychlost Lynch et al. 2010 Detekce selekce na molekulární úrovni a genetická podstata adaptací Adaptace Typy selekce Pozitivní selekce vede k fixaci výhodných alel v populaci

Více

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat

Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Genetické markery ve studiu genetické diverzity v populacích hospodářských zvířat Bakalářská

Více

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno urban@mendelu.cz htt://www.mendelu.cz/af/genetika/ Seminář doktorského grantu 53/03/H076 : Molekulárn

Více

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická

Více

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o.

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o. Genetické markery ve šlechtění skotu pro masnou produkci Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Genetické markery Polymorfní místa v DNA, které vykazují asociaci na sledované znaky Příčinné

Více

Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho

Více

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí,

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí, Využití molekulárních markerů v systematice a populační biologii rostlin 12. Shrnutí, Přehled molekulárních markerů 1. proteiny isozymy 2. DNA markery RFLP (Restriction Fragment Length Polymorphism) založené

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)

Více

BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc.

BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. BAKTERIÁLNÍ GENETIKA Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. -dědičnost u baktérií principiálně stejná jako u komplexnějších organismů -genom haploidní a značně menší Bakteriální genom

Více

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae).

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). Populační studie Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). American Journal of Botany 87(8): 1128

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že

Více

Základy biologické antropologie 6. Doc. Václav Vančata katedra biologie a ekologické Ped F UK

Základy biologické antropologie 6. Doc. Václav Vančata katedra biologie a ekologické Ped F UK Základy biologické antropologie 6 Doc. Václav Vančata katedra biologie a ekologické Ped F UK časová Variabilita populační i časová populační Jak chápat variabilitu? Hlavní faktory a etapy hominizačního

Více

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH RÁMCOVÝ VZDĚLÁVACÍ PROGRAM PRO ZÍSKÁNÍ SPECIALIZOVANÉ ZPŮSOBILOSTI v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH 1. Cíl specializačního vzdělávání Cílem specializačního vzdělávání

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI

Více

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.

Více

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku)

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) B I O L O G I E 1. Definice a obory biologie. Obecné vlastnosti organismů. Základní klasifikace organismů.

Více

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Genetika populací Studium dědičnosti a proměnlivosti skupin jedinců (populací)

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách

Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách Molekulární biotechnologie č.8 Produkce heterologního proteinu v eukaryontních buňkách Eukaryontní buňky se využívají v případě, když Eukaryontní proteiny syntetizované v baktériích postrádají biologickou

Více

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii ONKOGENETIKA Spojuje: - lékařskou genetiku - buněčnou biologii - molekulární biologii - cytogenetiku - virologii Důležitost spolupráce různých specialistů při detekci hereditárních forem nádorů - (onkologů,internistů,chirurgů,kožních

Více

Variabilita v pigmentaci

Variabilita v pigmentaci Variabilita v pigmentaci Proč zkoumat pigmentaci Spojitost s rakovinou kůže reakcí na UV záření výživou geografickým původem metabolismem vitamínu D. Oči Pigmentace Pokožka Vlasy Měření pigmentace Neinvazivní

Více

Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):

Více

Polymorfimus DNA, kdy se jedinci nebo druhy liší v jedné nukleotidové záměně

Polymorfimus DNA, kdy se jedinci nebo druhy liší v jedné nukleotidové záměně MOLEKULÁRNÍ TAXONOMIE - 5 (2015) Single nucleotide polymophism - SNP Polymorfimus DNA, kdy se jedinci nebo druhy liší v jedné nukleotidové záměně AAGCCTA AAGCTTA V tomto případě mluvíme o alelách C a T.

Více

Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro

Více

Lze HCM vyléčit? Jak dlouho žije kočka s HCM? Je možné předejít hypertrofické kardiomyopatii?

Lze HCM vyléčit? Jak dlouho žije kočka s HCM? Je možné předejít hypertrofické kardiomyopatii? Nemoci srdce jsou, stejně jako u člověka, vrozené nebo získané v průběhu života. Ze získaných chorob srdce tvoří velkou část kardiomyopatie, což je onemocnění srdečního svalu spojené s jeho dysfunkcí,

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

Co Vám tedy balíček "Genetická analýza DNA pro ženy" může přinést?

Co Vám tedy balíček Genetická analýza DNA pro ženy může přinést? Genetická analýza DNA pro ženy V naší ordinaci nyní nabízíme Na konci novou této službu stránky celkové pak, která najdete, analýzy je možné DNA. celkový u nás V rámci seznam provést této a genetických

Více

Genetický screening predispozice k celiakii

Genetický screening predispozice k celiakii VETERINÁRN RNÍ A FARMACEUTICKÁ UNIVERZITA BRNO Farmaceutická fakulta Ústav humánn nní farmakologie a toxikologie Genetický screening predispozice k celiakii RNDr. Ladislava Bartošov ová,ph.d. 1, PharmDr.

Více

Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická

Více

Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u

Více

1. Úvod do genetických algoritmů (GA)

1. Úvod do genetických algoritmů (GA) Obsah 1. Úvod do genetických algoritmů (GA)... 2 1.1 Základní informace... 2 1.2 Výstupy z učení... 2 1.3 Základní pomy genetických algoritmů... 2 1.3.1 Úvod... 2 1.3.2 Základní pomy... 2 1.3.3 Operátor

Více

BRACHYCEFALICKÝ SYNDROM

BRACHYCEFALICKÝ SYNDROM BRACHYCEFALICKÝ SYNDROM...patologie povýšená na plemenný znak MVDr. Jana Langerová Animal Clinic Praha FAKTA: v současnosti je oblíbenost brachycefalických plemen na vzestupu současný šlechtitelský trend

Více

polymorfní = vícetvarý, mnohotvárný

polymorfní = vícetvarý, mnohotvárný Genetický polymorfismus s Řeckyy morphos = tvar polymorfní = vícetvarý, mnohotvárný Genetický polymorfismus je tedy označení pro výskyt téhož znaku ve více tvarech, formách, přičemž tato mnohotvárnost

Více

Typologická koncepce druhu

Typologická koncepce druhu Speciace Co je to druh? Nebudu zde ani probírat různé definice pojmu druh. Žádná z nich až dosud neuspokojila všechny přírodovědce, ale každý přírodovědec zhruba ví, co míní tím, když mluví o druhu. (Charles

Více

Základní škola Náchod Plhov: ŠVP Klíče k životu

Základní škola Náchod Plhov: ŠVP Klíče k životu VZDĚLÁVACÍ OBLAST: VZDĚLÁVACÍ OBOR: PŘEDMĚT: ČLOVĚK A PŘÍRODA PŘÍRODOPIS PŘÍRODOPIS 8.ROČNÍK Téma, učivo Rozvíjené kompetence, očekávané výstupy Mezipředmětové vztahy Poznámky Úvod, opakování učiva ue

Více

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray

Více

UNIVERZITA PALACKÉHO V OLOMOUCI P Ř Í R O D O V Ě D E C K Á F A K U L T A KATEDRA MATEMATICKÉ ANALÝZY A APLIKACÍ MATEMATIKY BAKALÁŘSKÁ PRÁCE

UNIVERZITA PALACKÉHO V OLOMOUCI P Ř Í R O D O V Ě D E C K Á F A K U L T A KATEDRA MATEMATICKÉ ANALÝZY A APLIKACÍ MATEMATIKY BAKALÁŘSKÁ PRÁCE UNIVERZITA PALACKÉHO V OLOMOUCI P Ř Í R O D O V Ě D E C K Á F A K U L T A KATEDRA MATEMATICKÉ ANALÝZY A APLIKACÍ MATEMATIKY BAKALÁŘSKÁ PRÁCE Tutoriál statistických metod pro populační asociační studie

Více

Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci

Více

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou

Více

GENETIKA V MYSLIVOSTI

GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností

Více

Determinace pohlaví a evoluce pohlavních chromosomů

Determinace pohlaví a evoluce pohlavních chromosomů Determinace pohlaví a evoluce pohlavních chromosomů Radka Reifová Katedra zoologie Prezentaci naleznete na: http://web.natur.cuni.cz/~radkas/ v záložce Courses Jak vznikají dvě pohlaví Mechanismy determinace

Více

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

FUNKČNÍ VARIANTA GENU ANXA11 SNIŽUJE RIZIKO ONEMOCNĚNÍ

FUNKČNÍ VARIANTA GENU ANXA11 SNIŽUJE RIZIKO ONEMOCNĚNÍ FUNKČNÍ VARIANTA GENU ANXA11 SNIŽUJE RIZIKO ONEMOCNĚNÍ SARKOIDÓZOU: POTVRZENÍ VÝSLEDKŮ CELOGENOMOVÉ ASOCIAČNÍ STUDIE. Sťahelová A. 1, Mrázek F. 1, Kriegová E. 1, Hutyrová B. 2, Kubištová Z. 1, Kolek V.

Více

JIHOČESKÁ UNIVERZITA V ČESKÝCH BUDĚJOVICÍCH ZEMĚDĚLSKÁ FAKULTA

JIHOČESKÁ UNIVERZITA V ČESKÝCH BUDĚJOVICÍCH ZEMĚDĚLSKÁ FAKULTA JIHOČESKÁ UNIVERZITA V ČESKÝCH BUDĚJOVICÍCH ZEMĚDĚLSKÁ FAKULTA Studijní program: Studijní obor: Zadávající katedra: Vedoucí katedry: B4131 Zemědělství Agroekologie Katedra zootechnických a veterinárních

Více

Je-li rostlinné společenstvo tvořeno pouze jedinci jedné populace, mluvíme o monocenóze nebo také o čistém prostoru.

Je-li rostlinné společenstvo tvořeno pouze jedinci jedné populace, mluvíme o monocenóze nebo také o čistém prostoru. EKOLOGIE SPOLEČENSTVA (SYNEKOLOGIE) Rostlinné společenstvo (fytocenózu) můžeme definovat jako soubor jedinců a populací rostlin rostoucích společně na určitém stanovišti, které jsou ovlivňovány svým prostředím,

Více

Deficit mevalonátkinázy (MKD) (nebo hyper IgD syndrom)

Deficit mevalonátkinázy (MKD) (nebo hyper IgD syndrom) www.printo.it/pediatric-rheumatology/cz/intro Deficit mevalonátkinázy (MKD) (nebo hyper IgD syndrom) Verze č 2016 1. CO JE MKD? 1.1 Co je to? Deficit mevalonákinázy patří mezi dědičná onemocnění. Jedná

Více

Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti

Více

S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef

Více

Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny

Více

Osnova přednášky volitelného předmětu Evoluční vývoj a rozmanitost lidských populací, letní semestr

Osnova přednášky volitelného předmětu Evoluční vývoj a rozmanitost lidských populací, letní semestr Osnova přednášky volitelného předmětu Evoluční vývoj a rozmanitost lidských populací, letní semestr Evoluční teorie Základy evoluce, adaptace na životní podmínky - poskytuje řadu unifikujících principů

Více

ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a

Více

PROVEDENÍ ANALÝZY RIZIK

PROVEDENÍ ANALÝZY RIZIK IV. Příloha č. 1 Počet listů: 7 PROVEDENÍ ANALÝZY RIZIK Pro určení úrovně rizika je využito následujícího vztahu: R = F N kde F (Frekvence) je koeficientem četnosti možné aktivace konkrétního typu nebezpečí

Více

OPVK CZ.1.07/2.2.00/28.0184

OPVK CZ.1.07/2.2.00/28.0184 OPVK CZ.1.07/2.2.00/28.0184 Základy ADME a toxického hodnocení léčiv v preklinickém vývoji OCH/ADME LS 2012/2013 Metodické přístupy ke studiu toxických účinků vyvíjených látek při vývoji léčiv 10.4.2013

Více

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?

Více

8 Odhad plemenné hodnoty (OPH)

8 Odhad plemenné hodnoty (OPH) Genetika ve šlechtění zvířat TGU 006 část 7. (rough draft version) 8 Odhad plemenné hodnot (OPH) V populaci jedinců je genetická variabilita způsobená jedinci s různými genotp. U kvantitativních vlastností

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k

Více

Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat.

Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat. POPULAČNÍ GENETIKA Populační genetika se zabývá genetickými zákonitostmi v definovaných souborech jedinců téhož druhu. Genetické vztahy uvnitř populace jsou komplikované, a proto se v populační genetice

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Témata bakalářských a diplomových prací pro akademický rok 2015/2016

Témata bakalářských a diplomových prací pro akademický rok 2015/2016 Témata bakalářských a diplomových prací pro akademický rok 2015/2016 doc. Ing. Miroslav Maršálek, CSc. Výsledky reprodukce dojnic v inseminačním obvodu (zadáno) Fyzioterapie u koní (zadáno) Využití různých

Více

Rybářství. Co je Akvakultura 11.11.2013. Studijní literatura. Tradiční dělení rybářství : Podle intenzity hospodaření nebo výlovu rozlišujeme:

Rybářství. Co je Akvakultura 11.11.2013. Studijní literatura. Tradiční dělení rybářství : Podle intenzity hospodaření nebo výlovu rozlišujeme: Studijní literatura Špaček a kol.: 1980, Speciální chov hospodářských zvířat 2. s. 405-583. Čítek, J., Krupauer, V., Kubů, F.: 1993, 1998, Rybnikářství, Informatorium, Praha. Pokorný, J., Dvořák, J., Šrámek,

Více

Nové směry v evoluční biologii. Jaroslav Flegr Katedra filosofie a dějin přírodních věd Přírodovědecká Fakulta UK Praha

Nové směry v evoluční biologii. Jaroslav Flegr Katedra filosofie a dějin přírodních věd Přírodovědecká Fakulta UK Praha Nové směry v evoluční biologii Jaroslav Flegr Katedra filosofie a dějin přírodních věd Přírodovědecká Fakulta UK Praha 2014 Genetika věda o dědění znaků Mendelismus původně spíše antidarwinistický

Více

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů Imunogenetika Vědní odvětví zabývající se imunitním systémem obratlovců, který je výrazně odlišuje od nižších organizmů se nazývá imunologie. Její náplní je zejména studium imunity mechanizmů stálosti

Více

Aplikace molekulárně- genetických dat ve šlechtění. Humpolíček Petr

Aplikace molekulárně- genetických dat ve šlechtění. Humpolíček Petr Aplikace molekulárně- genetických dat ve šlechtění Humpolíček Petr Co vás čeká Tradiční šlechtitelské postupy Typy molek-gen. dat Přístupy k aplikaci molek-gen. dat Srovnání přístupů Šlechtění na odolnost

Více

7. Regulace genové exprese, diferenciace buněk a epigenetika

7. Regulace genové exprese, diferenciace buněk a epigenetika 7. Regulace genové exprese, diferenciace buněk a epigenetika Aby mohl mnohobuněčný organismus efektivně fungovat, je třeba, aby se jednotlivé buňky specializovaly na určité funkce. Nový jedinec přitom

Více

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce?

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce? REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince Co bylo dřív? Slepice nebo vejce? Rozmnožování Rozmnožování (reprodukce) může být nepohlavní (vegetativní, asexuální) pohlavní (sexuální;

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Dekapling, koherentní transfer polarizace, nukleární Overhauserův jev

Dekapling, koherentní transfer polarizace, nukleární Overhauserův jev Dekapling Dekapling, koherentní transfer polarizace, nukleární Overhauserův jev Dekaplingem rozumíme odstranění vlivu J-vazby XA na na spektra jader A působením dalšího radiofrekvenčního pole ( ω X )na

Více

Poznámky k nutrigenetice

Poznámky k nutrigenetice Poznámky k nutrigenetice Ondřej Šeda Institut klinické a experimentální medicíny, Praha Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Research Centre CHUM, Montreal, Canada Nutrigenetika Jednotlivé

Více

Tematický plán učiva BIOLOGIE

Tematický plán učiva BIOLOGIE Tematický plán učiva BIOLOGIE Třída: Prima Počet hodin za školní rok: 66 h 1. POZNÁVÁME PŘÍRODU 2. LES 2.1 Rostliny a houby našich lesů 2.2 Lesní patra 2.3 Živočichové v lesích 2.4 Vztahy živočichů a rostlin

Více

Dokument ze zasedání 7. 3. 2012 B7-0148/2012 NÁVRH USNESENÍ. předložený na základě prohlášení Rady a Komise

Dokument ze zasedání 7. 3. 2012 B7-0148/2012 NÁVRH USNESENÍ. předložený na základě prohlášení Rady a Komise EVROPSKÝ PARLAMENT 2009-2014 Dokument ze zasedání 7. 3. 2012 B7-0148/2012 NÁVRH USNESENÍ předložený na základě prohlášení Rady a Komise v souladu s čl. 110 odst. 2 jednacího řádu o vytvoření strategie

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/

Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/ Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018 Základy populační genetiky Osnova 1. Genetická struktura populace 2. Způsob reprodukce v

Více

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou

Více

Zdravotní stav a vybrané ukazatele demografické statistiky

Zdravotní stav a vybrané ukazatele demografické statistiky Zdravotní stav a vybrané ukazatele demografické statistiky MUDr. Růžena Kubínová ředitelka monitoringu Odbor hygieny životního prostředí Státní zdravotní ústav Zdravotní stav české populace Očekávaná délka

Více

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865

Více

Evoluce fenotypu I. web.natur.cuni.cz/~kratoch1/

Evoluce fenotypu I. web.natur.cuni.cz/~kratoch1/ Evoluce fenotypu I web.natur.cuni.cz/~kratoch1/ Pojem fenotyp: genotyp dnes zpravidla chápán jako sekvence DNA fenotyp soubor všech vlastností organismu (např. morfologie, fyziologie, vývin, chování) (zavedl

Více

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech Chromozomální aberace nalezené u párů s poruchou reprodukce v letech 2000-2005 Jak přistupovat k nálezům minoritních gonozomálních mozaik? Šantavá A., Adamová, K.,Čapková P., Hyjánek J. Ústav lékařské

Více

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch

Více

Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální

Více

ZMĚNA KLIMATU A JEJÍ DOPADY NA RŮST A VÝVOJ POLNÍCH PLODIN

ZMĚNA KLIMATU A JEJÍ DOPADY NA RŮST A VÝVOJ POLNÍCH PLODIN ZMĚNA KLIMATU A JEJÍ DOPADY NA RŮST A VÝVOJ POLNÍCH PLODIN Zdeněk Žalud 1, Miroslav Trnka 1, Daniela Semerádová 1, Martin Dubrovský 1,2 1 Ústav agrosystémů a bioklimatologie, Mendelova zemědělská a lesnická

Více