Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu"

Transkript

1 Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno htt:// Seminář doktorského grantu 53/03/H076 : Molekulárn rní data v genetice oulací a hodnocení diverzity ZF JU České Budějovice Dědičnost tok informací mezi buňkami (během buněčného dělení) a řes generace (omocí meiózy) Organizace genetického materiálu Definice olymorfismu oly mnoho; morfé tvar Polymorfismus výskyt dvou nebo více variant (tvarů) určitého znaku v oulaci daného druhu říklad olymorfismu znaku ostavení uší u rasete Molekulární technologie a automatizace solu se sofistikovanými výočetními rogramy umožňují určit sekvence nukleotidů v genomu. znak kvalitativní

2 genomový chromozomů roteinů antigenů, rotilátek kvalitativních znaků genetická informace - mutace DA - sekvence geny - alely Strukturní a numerické aberace bílkoviny, enzymy - alozymy v buňkách, v krvi, atd. v krvi, tkáních, atd. v buňkách, tkáních, atd. na organismu Kvantitativní znaky Odhad genetické komonenty rostředí G e n o t y F e n o t y Proč využívat molekulární genetické markery? Molekulární data oskytují genetickou informaci (nejvíce informativní) Možno testovat všechny biologické druhy Molekulární metody zřístuňují téměř neomezený zdroj genetické variability (3 mld b) Komletní DA sekvence je již u mnoha modelových druhů (ale ro oulační a evoluční studie je taková informace nadbytečná) 003,4 mil SP v databázi lidského genomu Mol. data oskytují solečné měřítko ro měření divergence mezi druhy, lemeny, Molekulární řístuy se mění a rozvíjejí Proč nevyužívat molekulárně genetické markery? lidi, náklady PCR - RFLP řístu studia olymorfizmu Genomový olymorfismus Restriction fragment length olymorhism of the M307 olymorhic site in the FUT gene AG GG GG AA odstata: - bodové mutace (záměna, delece, atd. bazí) - reetice sekvencí (kratších nebo delších) zkoumá: - molekulární genetika - genomika metody zjišťov ování: PCR, RFLP, DGGE, TGGE, SSCP, sekvenování - krátký řehled Mgr. Civáňová Horák, Urban, Dvořák (004)

3 Genetický olymorfizmus jako míra genetické variance v oulacích Lokus je olymorfní Četnost nejrozšířenější alely není větší než 0,95 ebo 0,99? absolutní frekvence genotyů!? relativní frekvence genotyů! D d h BB 7 Bb 4 bb 4 H r f(bb) 0,4667 f(bb) 0,667 f(bb) 0,667 R? relativní frekvence alel! d + h f(b) 0,600 q r + h f(b) 0,400 Formy variability v bovinním PRP genu 8 % jsou SP Substituce 79 % tranzice (A > G; C > T) % transverze (A, G > C,T) Sequence variation in the bovine and ovine PRP genes D. Hills, J. Schlaefer, S. Comincini, I. MacLean, G. Dolf, L. Ferretti, I. Olsaker, J. L. Williams Animal Genetics :3. 83

4 Hardy-Weinbergova rovnováha a vazbová rovnováha V oulacích existuje genetická rovnováha ro studium změn frekvencí tyy rovnováhy Hardy Weinbergova vazbová Odvození H.-W. rinciu Tvorba nové generace Sermie Vajíčka q A A q A a q q A a q a a ( A + a) AA + Aa + aa + q + q

5 Jedna frekvence alel více frekvencí genotyů Pouze v říadě je oulace v genetické rovnováze! Testování HWE Χ test (Pearson) d + h (AA) 0,60 0,6 0,64 0,70 0,75 q (Aa) 0,40 0,38 0,3 0,0 0,00 q (aa) 0,00 0,0 0,04 0,5 0,0 (A) q (a) 0,0 0,0 0,0 0,0 0,0 0,0 Vícealelové lokusy exact test (Fisher) likelihood-ratio test (Χ ) Pouze je-li oulace v genetické rovnováze, lze odvodit frekvenci genotyů z frekvencí alel dle + q + q χ test dobré shody Internetové alikace - HWE H 0 lokus je v HWE H A lokus není v HWE htt://wbiomed.curtin.edu.au/geneo/geneo_o.html Tests for deviation from Hardy-Weinberg equilibrium and tests for association (SP) htt://ihg.gsf.de/cgi-bin/hw/hwa.l HARDY (for large numbers of alleles (microsatellites) htt:// htt://ritch.bsd.uchicago.edu/software.html df 3-- χ (, 0,05) 3,84 χ (, 0,0) 6,64

6 Měření vazbové nerovnováhy enáhodné asociace mezi chromozomálními lokusy v oulaci Alely jednoho lokusu nemusí být v asociaci s alelami druhého lokusu Vazbová rovnováha: náhodné alelické asociace mezi alelami na jakémkoliv lokusu Dosažení rovnováhy je však omalé, závisí na rekombinaci r (ravděodobnost, že gameta řenášená jedincem je rekombinantní) B ( ) b ( ) D P P -P P A (q ) a (q ) AB ( q ) ab ( q ) Ab ( q ) P ab ( q ) Cis Trans Frekvence halotyů erovnováha v generaci t: D t (- r) t D 0 Ab 0 0,40 (L) f(a) Testování vazbové nerovnováhy ab AB ab ,0 0,30 q(l) (L) q(l) 0,4 0,6 f(a) f(b) f(b) Χ test lokusy s alelami χ ij f (i) n[ d(ij) ] [ ± f (i)] f (j)[ ± f (j)] d(ab) d(ab) d(ab) d(ab) ,00 d(ij) f(ij) - f(i)f(j) d(ij) f(ij) f(i)f(j) -nerovnováha alely i v lokusu a alely j v lokusu Ab X^ f(i), f(j)- frekvence alely i v lokusu, alely j v lokusu f(ij) - frekvence halotyu ij (lokus a ) ab AB X^ X^ χ ij f (i) n[ d(ij) ] [ ± f (i)] f ( j) [ ± f ( j) ] ab X^ Příklad v excelu

7 PROGRAM DOWLOAD Arlequin COVERT DISPA FSTAT GDA (Genetic Data Analysis) Genetix4.04 KISHIP: Microsat PAUP 4.0b PCAGen Phyli Pogene Structure TreeView htt://lgb.unige.ch/arlequin/ htt:// %0Staff/glaubitz/software.htm htt:// htt:// htt://lewis.eeb.uconn.edu/lewishome/software.html htt:// htt:// htt://hgl.stanford.edu/rojects/microsat/ htt://au.csit.fsu.edu/ htt:// htt://evolution.genetics.washington.edu/hyli.html htt:// htt://ritch.bsd.uchicago.edu/software.html htt://taxonomy.zoology.gla.ac.uk/rod/treeview.html

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)

Více

Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

UNIVERZITA PALACKÉHO V OLOMOUCI P Ř Í R O D O V Ě D E C K Á F A K U L T A KATEDRA MATEMATICKÉ ANALÝZY A APLIKACÍ MATEMATIKY BAKALÁŘSKÁ PRÁCE

UNIVERZITA PALACKÉHO V OLOMOUCI P Ř Í R O D O V Ě D E C K Á F A K U L T A KATEDRA MATEMATICKÉ ANALÝZY A APLIKACÍ MATEMATIKY BAKALÁŘSKÁ PRÁCE UNIVERZITA PALACKÉHO V OLOMOUCI P Ř Í R O D O V Ě D E C K Á F A K U L T A KATEDRA MATEMATICKÉ ANALÝZY A APLIKACÍ MATEMATIKY BAKALÁŘSKÁ PRÁCE Tutoriál statistických metod pro populační asociační studie

Více

VARIABILITY IN H-FABP, C-MYC, GH, LEP, LEPR GENES IN LARGE WHITE, LANDRACE AND DUROC BREEDS OF PIGS

VARIABILITY IN H-FABP, C-MYC, GH, LEP, LEPR GENES IN LARGE WHITE, LANDRACE AND DUROC BREEDS OF PIGS VARIABILITY IN H-FABP, C-MYC, GH, LEP, LEPR GENES IN LARGE WHITE, LANDRACE AND DUROC BREEDS OF PIGS VARIABILITA GENŮ H-FABP, C-MYC, GH, LEP, LEPR U PLEMEN PRASAT BÍLÉ UŠLECHTILÉ, LANDRASE A DUROK Mikolášová

Více

Populační genetika II

Populační genetika II Populační genetika II 4. Mechanismy měnící frekvence alel v populaci Genetický draft (genetické svezení se) Genetický draft = zvýšení frekvence alely díky genetické vazbě s výhodnou mutací. Selekční vymetení

Více

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí,

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí, Využití molekulárních markerů v systematice a populační biologii rostlin 12. Shrnutí, Přehled molekulárních markerů 1. proteiny isozymy 2. DNA markery RFLP (Restriction Fragment Length Polymorphism) založené

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o.

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o. Genetické markery ve šlechtění skotu pro masnou produkci Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Genetické markery Polymorfní místa v DNA, které vykazují asociaci na sledované znaky Příčinné

Více

8 Odhad plemenné hodnoty (OPH)

8 Odhad plemenné hodnoty (OPH) Genetika ve šlechtění zvířat TGU 006 část 7. (rough draft version) 8 Odhad plemenné hodnot (OPH) V populaci jedinců je genetická variabilita způsobená jedinci s různými genotp. U kvantitativních vlastností

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika

Více

Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

Genetické mapování. v přírodních populacích i v laboratoři

Genetické mapování. v přírodních populacích i v laboratoři Genetické mapování v přírodních populacích i v laboratoři Funkční genetika Cílem je propojit konkrétní mutace/geny s fenotypem Vzniklý v laboratoři pomocí mutageneze či vyskytující se v přírodě. Forward

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního

Více

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae).

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). Populační studie Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). American Journal of Botany 87(8): 1128

Více

Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat

Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Mendelova zemědělská a lesnická univerzita v Brně Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Genetické markery ve studiu genetické diverzity v populacích hospodářských zvířat Bakalářská

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta

MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Určování a ověřování paternity u koní. Bakalářská práce Brno 2006 Vedoucí bakalářské

Více

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin Část Molekulární biologie a imunologie 6. Základy dědičnosti Mendelovská dědičnost (autozomálně recesivní, autozomálně dominantní a X-vázaný přenos mutací). Nemendelovská dědičnost (uniparentální disomie,

Více

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou

Více

UTILIZATION OF DNA MICROSATELLITES USED IN PARENTITY PANEL IN EVALUATION OF DIVERZITY AND DISTANCES BETWEEN THE BREEDS OF PIGS IN CZECH REPUBLIC

UTILIZATION OF DNA MICROSATELLITES USED IN PARENTITY PANEL IN EVALUATION OF DIVERZITY AND DISTANCES BETWEEN THE BREEDS OF PIGS IN CZECH REPUBLIC UTILIZATION OF DNA MICROSATELLITES USED IN PARENTITY PANEL IN EVALUATION OF DIVERZITY AND DISTANCES BETWEEN THE BREEDS OF PIGS IN CZECH REPUBLIC VYUŽITÍ DNA MIKROSATELITŮ POUŽÍVANÝCH V PANELU NA URČOVÁNÍ

Více

JIHOČESKÁ UNIVERZITA V ČESKÝCH BUDĚJOVICÍCH ZEMĚDĚLSKÁ FAKULTA

JIHOČESKÁ UNIVERZITA V ČESKÝCH BUDĚJOVICÍCH ZEMĚDĚLSKÁ FAKULTA JIHOČESKÁ UNIVERZITA V ČESKÝCH BUDĚJOVICÍCH ZEMĚDĚLSKÁ FAKULTA Studijní program: Studijní obor: Zadávající katedra: Vedoucí katedry: B4131 Zemědělství Agroekologie Katedra zootechnických a veterinárních

Více

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch

Více

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou

Více

Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že

Více

Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů

Více

PhD. České Budějovice

PhD. České Budějovice PhD. České Budějovice Sledování a využívání poznatků o genetické biodiverzitě mezi populacemi hospodářských zvířat Dvořák Josef prof. Genetiky živočichů Ústavu genetiky MZLU v Brně Pro seminář doktorského

Více

Využití molekulárních markerů v systematice a populační biologii rostlin. 2. Přehled aplikací a otázek

Využití molekulárních markerů v systematice a populační biologii rostlin. 2. Přehled aplikací a otázek Využití molekulárních markerů v systematice a populační biologii rostlin 2. Přehled aplikací a otázek Přehled molekulárních markerů 1. proteiny isozymy 2. DNA markery RFLP (Restriction Fragment Length

Více

Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ

PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ 10 SEZNAM PŘÍLOH PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ PŘÍLOHA č. 2 MAPY Mapa 1 Lokalizace zájmového území (zdroj: Mapy.cz) Mapa 2 Místa odlovených nebo uhynulých kusů (zdroj:

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u

Více

polymorfní = vícetvarý, mnohotvárný

polymorfní = vícetvarý, mnohotvárný Genetický polymorfismus s Řeckyy morphos = tvar polymorfní = vícetvarý, mnohotvárný Genetický polymorfismus je tedy označení pro výskyt téhož znaku ve více tvarech, formách, přičemž tato mnohotvárnost

Více

GENETICS OF CAT S COLORS GENETIKA ZBARVENÍ KOČEK. Chaloupková L., Dvořák J. ABSTRACT ABSTRAKT ÚVOD

GENETICS OF CAT S COLORS GENETIKA ZBARVENÍ KOČEK. Chaloupková L., Dvořák J. ABSTRACT ABSTRAKT ÚVOD GENETCS OF CAT S COLORS GENETKA ZBARVENÍ KOČEK Chaloupková L., Dvořák J. Ústav morfologie, fyziologie a genetiky zvířat, Agronomická fakulta, MZLU v Brně, Zemědělská 1, 613 00 Brno, ČR E-mail: xchalou0@node.mendelu.cz,

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

Úvod do nonhla-dq genetiky celiakie

Úvod do nonhla-dq genetiky celiakie Úvod do nonhla-dq genetiky celiakie František Mrázek HLA laboratoř, Ústav Imunologie LF UP a FN Olomouc Celiakie - časté chronické zánětlivé onemocnění tenkého střeva s autoimunitní a systémovou složkou

Více

Populační genetika Radka Reifová

Populační genetika Radka Reifová Populační genetika Radka Reifová Prezentace ke stažení: http://web.natur.cuni.cz/~radkas v záložce Courses Literatura An Introduction to Population Genetics. Rasmus Nielsen and Montgomery Slatkin. 2013.

Více

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Genetika populací Studium dědičnosti a proměnlivosti skupin jedinců (populací)

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp.

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp. BIOLOGICKÉ LISTY 68 (3): 207-211, 2003 Způsoby detekce polymorfismu homologních DNA a jejich využití při studiu změn ve struktuře rodičovských genomů u modelových allotetraploidních druhů rodu Nicotiana

Více

RURGenetika zápočtový program Programování II

RURGenetika zápočtový program Programování II RURGenetika zápočtový program Programování II Rudolf Rosa cvičící: Doc. RNDr. Pavel Töpfer, CSc. Obsah Specifikace...1 Původní specifikace...1 Upravená specifikace...2 Program...3 třída Populace...4 Datové

Více

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů Imunogenetika Vědní odvětví zabývající se imunitním systémem obratlovců, který je výrazně odlišuje od nižších organizmů se nazývá imunologie. Její náplní je zejména studium imunity mechanizmů stálosti

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,

Více

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou

Více

Výskyt MHC molekul. RNDr. Ivana Fellnerová, Ph.D. ajor istocompatibility omplex. Funkce MHC glykoproteinů

Výskyt MHC molekul. RNDr. Ivana Fellnerová, Ph.D. ajor istocompatibility omplex. Funkce MHC glykoproteinů RNDr. Ivana Fellnerová, Ph.D. Katedra zoologie, PřF UP Olomouc = ajor istocompatibility omplex Skupina genů na 6. chromozomu (u člověka) Kódují membránové glykoproteiny, tzv. MHC molekuly, MHC molekuly

Více

FUNKČNÍ VARIANTA GENU ANXA11 SNIŽUJE RIZIKO ONEMOCNĚNÍ

FUNKČNÍ VARIANTA GENU ANXA11 SNIŽUJE RIZIKO ONEMOCNĚNÍ FUNKČNÍ VARIANTA GENU ANXA11 SNIŽUJE RIZIKO ONEMOCNĚNÍ SARKOIDÓZOU: POTVRZENÍ VÝSLEDKŮ CELOGENOMOVÉ ASOCIAČNÍ STUDIE. Sťahelová A. 1, Mrázek F. 1, Kriegová E. 1, Hutyrová B. 2, Kubištová Z. 1, Kolek V.

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace Mutace Klasifikace mutací Z hlediska lokalizace mutací v genotypu Genové mutace Chromozomální mutace Genomové mutace Vznik genových mutací Tranzice pyrim. za pyrim. C na T T na C purin za purin A na G

Více

Rozštěpy rtu a patra Vrozená vývojová vada, kterou dnes již nemusíte (na první pohled) vidět Pohled genetika. Renata Gaillyová, OLG FN Brno

Rozštěpy rtu a patra Vrozená vývojová vada, kterou dnes již nemusíte (na první pohled) vidět Pohled genetika. Renata Gaillyová, OLG FN Brno Rozštěpy rtu a patra Vrozená vývojová vada, kterou dnes již nemusíte (na první pohled) vidět Pohled genetika Renata Gaillyová, OLG FN Brno Lékařská genetika Interdisciplinární spolupráce Preventivní medicína

Více

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010

Více

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku)

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) B I O L O G I E 1. Definice a obory biologie. Obecné vlastnosti organismů. Základní klasifikace organismů.

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní

Více

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION VYUŽITÍ AUTOMATICKÉHO SEKVENOVÁNÍ DNA PRO DETEKCI POLYMORFISMŮ KANDIDÁTNÍCH GENŮ U PRASAT Vykoukalová Z., Knoll A.,

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Chromozomová teorie dědičnosti KBI / GENE Mgr. Zbyněk Houdek Proč octomilka a T.H. Morgan? Drosophila melanogaster ideální objekt pro genetický výzkum : Rychlý reprodukční cyklus a snadný chov v laboratorních

Více

Poznámky k nutrigenetice

Poznámky k nutrigenetice Poznámky k nutrigenetice Ondřej Šeda Institut klinické a experimentální medicíny, Praha Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Research Centre CHUM, Montreal, Canada Nutrigenetika Jednotlivé

Více

Genetické markery - princip a využití

Genetické markery - princip a využití Genetika a šlechtění lesních dřevin Genetické markery - princip a využití Doc. Ing. RNDr. Eva Palátová, PhD. Ing. R. Longauer, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován

Více

Úvod do populační genetiky

Úvod do populační genetiky Úvod do populační genetiky 1 Termíny Gene Locus (loci) Allele alternative forms of a gene Genome single copy of all of the genes Diploid - 2 alely pro každý gen (výjimka Chr Y, cpdna a mtdna) 2 genomy

Více

HLA B27: molekulární marker Ankylozující spondylitidy. Peter Novota. 16.2.2016, Praha

HLA B27: molekulární marker Ankylozující spondylitidy. Peter Novota. 16.2.2016, Praha HLA B27: molekulární marker Ankylozující spondylitidy Peter Novota 16.2.2016, Praha HLA B součást MHC komplexu HLA I. třídy (chromosom 6) úsek značně polymorfní antigeny se vyskytují na povrchu buněk podílí

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/

Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/ Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018 Základy populační genetiky Osnova 1. Genetická struktura populace 2. Způsob reprodukce v

Více

GENETIKA A JEJÍ ZÁKLADY

GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky

Více

Evoluční genetika KBI/GENE Mgr. Zbyněk Houdek Evoluční teorie Evoluční teorii vyslovil Ch. Darwin v díle O původu druhů (1859), kde ukazoval, že druhy se postupně měnily v dlouhých časových periodách.

Více

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH RÁMCOVÝ VZDĚLÁVACÍ PROGRAM PRO ZÍSKÁNÍ SPECIALIZOVANÉ ZPŮSOBILOSTI v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH 1. Cíl specializačního vzdělávání Cílem specializačního vzdělávání

Více

Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený

Více

Ondřej Scheinost Nemocnice České Budějovice, a.s.

Ondřej Scheinost Nemocnice České Budějovice, a.s. Ondřej Scheinost Nemocnice České Budějovice, a.s. Nové technologie přelomové období principy technologií klinická použitelnost chips (arrays) sekvenační technologie Důležitost genetických informací i další

Více

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení

Více

GENETIKA V MYSLIVOSTI

GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností

Více

Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

PRAKTIKUM Z OBECNÉ GENETIKY

PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie lizal@sci.muni.cz 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin

Více

Zaměření bakalářské práce (témata BP)

Zaměření bakalářské práce (témata BP) Zaměření bakalářské práce (témata BP) Obor: Buněčná a molekulární diagnostika - zadává katedra - studenti si témata losují Obor: molekulární biologie a genetika - témata BP vychází z vybraného tématu DP

Více

Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského

Více

Témata bakalářských a diplomových prací pro akademický rok 2015/2016

Témata bakalářských a diplomových prací pro akademický rok 2015/2016 Témata bakalářských a diplomových prací pro akademický rok 2015/2016 doc. Ing. Miroslav Maršálek, CSc. Výsledky reprodukce dojnic v inseminačním obvodu (zadáno) Fyzioterapie u koní (zadáno) Využití různých

Více

Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem

Více

Populační genetika. ) a. Populační genetika. Castle-Hardy-Weinbergova zákonitost. Platí v panmiktické populaci za předpokladu omezujících podmínek

Populační genetika. ) a. Populační genetika. Castle-Hardy-Weinbergova zákonitost. Platí v panmiktické populaci za předpokladu omezujících podmínek Poulační genetika Poulační genetika ORGANISMUS Součást výše organizované soustavy oulace POPULACE Soubor jedinců jednoho druhu Genotyově heterogenní V určitém čase má řirozeně vymezený rostor Velký očet

Více

Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky

Více

Ě ÁÁ Ú é é ý ů ý ů é ý ů é é ú Ž ý ů é ů é é Ě ÁÁ Ú é Ý ž ý ž ý ý ů ž ů ň é Ž ý Ž ů ý é é é é ý ž Í Ě ÁÁ Ú é é ň é Ž ý ž Ž Í ý é ý Í ů ý ý ý é ý é ý é ň Ž Ž Ě ÁÁ Ú é é ý Ý é é ý Ž Í Í é ž Í Ž Ě ÁÁ Ú é

Více

Genetický screening predispozice k celiakii

Genetický screening predispozice k celiakii VETERINÁRN RNÍ A FARMACEUTICKÁ UNIVERZITA BRNO Farmaceutická fakulta Ústav humánn nní farmakologie a toxikologie Genetický screening predispozice k celiakii RNDr. Ladislava Bartošov ová,ph.d. 1, PharmDr.

Více

Genotypování markerů užitkovosti a zdraví u skotu

Genotypování markerů užitkovosti a zdraví u skotu Mezinárodní odborný seminář Využití chovatelských dat onemocnění skotu pro management stád, šlechtění a pro racionální užívání antimikrobik. Genotypování markerů užitkovosti a zdraví u skotu Jitka Kyseľová

Více