Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Rozměr: px
Začít zobrazení ze stránky:

Download "Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek"


1 Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek

2 Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto genech pak dochází k odchylkám vůči normální mendelovské dědičnosti a tato dědičnost se nazývá pohlavně vázaná nebo gonozomální.

3 Geny neúplně vázané na pohlaví Gonozomy se liší tvarem a velikostí, kdy Y je mnohem menší. Velká heterologníčást chromozomu X tvoří zvláštní vazbovou skupinu. Naopak geny na malém homologním úseku obou chromozomů podléhají synapsi a může mezi nimi probíhat c.-o. (g. neúplně vázané na pohlaví = pseudoatozomové g.). Jsou přenášeny z rodičů na potomky stejně jako autozomové geny. Tyto geny jsou ženami přenášeny stejně na obě pohlaví, ale muži pouze na potomky jednoho pohlaví.

4 Geny úplně vázané na pohlaví V genotypu muže je pouze 1 X ch. hemizygotní. Pseudodominance je fenotypový projev recesivní alely způsobený nepřítomností párové alely dominantní. U čl. jsou to např. recesivní alely pro hemofílii (poruchu srážlivosti), daltonismus (barvoslepost). Dědičnost pohlavím ovlivněná heterozygotní sestava páru alel autozomálního genu se projeví fenotypově jako dominantní u jednoho a recesivní u druhého pohlaví (např. předčasná plešatost, za kterou odpovídá alela P PP, Pp muži jsou plešatí a pp ne. U žen je to tak, že pouze PP ženy mají tuto vadu, Pp a pp mají normální množství vlasů).

5 Hemofilie A, B Srážecí reakce krve je kaskádovitá a skládá se z mnoho kroků závislých na proteinech, které se navzájem ovlivňují. Pokud je porucha na 1 srážecím proteinu, pak se srážení krve neuskuteční. Hemofile A královská h. nedostatek faktoru VIII. H. B Christmasova (podle 1. nositele) nedostatek f. IX. Od 60. let 20. st. léčba hemofilie na bázi podání těchto f. izolovaných s krve dárců (drahá a omezená léčba). Současná léčba genové inženýrství izolace genů pro srážecí faktory a jejich vestavba do gen. informace bb. kultivovaných v laboratorních podmínkách syntéza faktorů.

6 X-vázaná porucha srážlivosti Hemofilie postižení lidé nejsou schopni vytvářet faktor nezbytný pro srážlivost krve. Pokud se hemofilici zraní, pak krvácejí a bez transfůze krve se srážecím faktorem mohou i zemřít (dříve se dožívali krátkého věku). Hlavní typ hemofilie u čl. je způsoben recesivní X-vázanou mutací. Z tohoto důvodu jsou nejvíce postiženi hemizygotní muži, kteří ji zdědili od svých heterozygotních matek. Incidence je u mužů 1/10 tis., ale u homozygotních žen pouze 1/100 mil. Jestliže mají tito muži děti, pak přenáší tuto mutaci na dceru, ale ne na syny.

7 Ruská carská rodina a hemofilie Na počátku 20. st. se právě tato forma hemofilie projevila v ruské carské rodině. Syn cara Mikuláše a carevny Alexandry Alexej trpěl hemofilií, ale jeho 4 sestry ne. Alexej zdědil tuto mutaci od své matky, vnučky britské královny Viktorie, která byla její přenašečkou. Viktorie přenesla tuto mutaci na své 3 děti z 9: Alice, Beatrice, Leopold. Viktorie byla zřejmě 1. nositelkou této alely, ale mohla ji zdědit i od rodičů nebo předků z matčiny strany.

8 Pravidla X-vázané recesivní dědičnosti Incidence choroby je mnohem vyšší u mužů než u žen. Mutovaná alela je předávána postiženým mužem všem jeho dcerám, ale ty ji neexprimují. Heterozygotní přenašeč žena předává alelu polovině svých synů, u kterých se projeví a polovině svých dcer, u kterých se neprojeví. Mutovanou alelu nikdy nepředá otec synovi. Jak matka, tak dcera jsou proto obligatorní přenašečky jakékoli X-vázané recesivní choroby, kterou exprimují muži (criss-cross dědičnost).

9 Daltonismus (barvoslepost) Tento stav je způsoben vysoce homologními geny v tandemové pozici na X ch. Touto poruchou je postiženo kolem 8 % britských mužů a 0,6 % žen. Beckerova a Duchenneova dystrofie mutace dystrofinového genu. Duchenneův typ je závažnější a v období adolescence smrtelný. Gowerův manévr dítě při vstávání z leže na břiše šplhá po vlastním těle. Syndrom fragilního chromosomu X nejvýznamnější příčina těžkých poruch učení u chlapců.

10 X-vázané dominantní poruchy Jsou vzácné a pravidla pro jejich přenos jsou následná: Tento stav je exprimován u obou pohlaví a i oběma pohlavími přenášen. Poruchy se vyskytují 2x častěji u žen než mužů. Postižený muž předává poruchu všem dcerám, ale ne synům. Postižená žena předává poruchu všem synům a polovině svých dcer. Příklad poruchy hypofosfatémie neboli vitamin D- rezistentní rachitida.

11 Geny na lidském ch. Y Během projektu mapování lidského genomu bylo zjištěno 307 genů na ch. Y. Jsou tam vázané geny, které zajišťují mužskou plodnost. Je jasné, že mutace těchto genů budou ovlivňovat schopnost reprodukce u mužů. Geny na ch. Y jsou exprimovány pouze u mužů a pouze muži je přenášejí na všechny své syny. Na ch. X jich bylo nalezeno 1000 genů.

12 Pohlavní ch. a determinace pohlaví Pohlavní dimorfismus živočichů může být ovlivňován faktory: Vnější prostředí (např. želvy - teplota > 30 C vajíčka samice, t.< 30 C samci. Genetický f. u čl. je dominantní vliv přítomnost ch. Y mužské pohlaví. U jedinců s abnormálním počtem ch. X jsou ženy, ale jedinci se sestavou XXY jsou muži. Ch. Y řídí vývoj primordiálních gonád směrem k varlatům testosteron mužské sekundární pohlavní znaky. Na ch. Y je důležitý gen SRY (sex-determining region Y krátké raménko, blízko pseudoautozomové oblasti ch.). Obdobný gen ovlivňuje pohlaví i myší.

13 Testosteron Testosteron se váže na receptory nediferencovaných bb. buněčné jádro diferenciace bb. mohutné svaly, vousy a hluboký hlas. Pokud dojde k poruše vazby hormon-receptor-buňka vývoj v ženu nebo testikulární feminizace. Jedinci s genotypem XY nejprve vývoj varlat produkce testosteronu, který je neúčinný ženské pohlavní znaky, ale nemají vaječníky sterilita. Gen na ch. X Tmf receptory pro testosteron, ale přenos mutace tmf defektní receptory. Přenos z matek na hemizygotní potomky XY (tady fenotypově ženy X vázaná dědičnost).

14 Determinace pohlaví u jiných živočichů Živočichové, kteří mají 2 typy samčích gamet s ch. X a Y heterogametické x homogametické samičí gamety (X). S opačnou situací se setkáváme u ptáků, motýlů a některých plazů: samčí pohlaví ZZ homogametické a samičí heterogametické (ZW). U včel je pohlaví určováno tím, zda je jedinec z neoplozeného vajíčka (haploidní) sameček x z oplozeného v. (diploidní) samička záleží na potravě královna (reprodukční forma) x sterilní (dělnice). Tento haplo-diploidní způsob pohlavní determinace se vyskytuje také u některých vos.

15 Kompenzace dávky genů vázaných na ch. X Protože je vývoj živočichů citlivý k poruše rovnováhy v počtu genů (2 kopie normální stav) odchylka směrem dolů a nahoru abnormální fenotyp až smrt. Nutné vyrovnání počtu genů vázaných na ch. X u samců (XY). 3 mechanismy kompenzace v přírodě: Každý X-vázaný gen pracuje u samců 2x tolik než u samic (drozofila). 1 kopie X ch. u samic je inaktivována (savci) Každý ch. X u samic působí s poloviční intenzitou v porovnání se samci (Caenorhabditis elegans).

16 Hyperaktivace X- vázaných g. U samců drozofily Hyperaktivace zvýšení aktivity g. vázaných na ch. X u samců komplex různých proteinů, které se mohou vázat na ch. X způsobují 2- násobnou g. aktivitu. Bez navázání těchto proteinů nedojde k jejich hyperaktivaci. Tento komplex proteinů nazýváme MSL a obsahuje i RNA. Je produktem 5 různých g.

17 Inaktivace X-vázaných g. u savců U samic placentálních savců dochází k inaktivaci 1 ch. X. K inaktivaci dochází ve fázi, kdy má embryo několik tisíc bb. na základě g. XIST RNA, která postupně obalí celý ch. X. Ch. X, který je inaktivován je vybrán náhodně tento ch. je pak inaktivován i v ostatních bb. vznikajících z bb. původní. Genetická mozaika samice savců tak mohou obsahovat bb., ve kterých jsou inaktivovány různé ch. X inaktivovaný ch. X zděděný po matce a inaktivovaný ch. X zděděný po otci. Tato variabilita inaktivace ch. X se projeví např. u zbarvení koček (želvovinové zbarvení).

18 46,XY 46,XX 47,XXX Barrovo tělísko 48,XXXX 49,XXXXX Inaktivovaný ch. X se nechová ani nevypadá jako ostatní ch. Jeho DNA je modifikována připojením četných metylových skupin. Při kondenzaci tohoto ch. pak vzniká tmavě se barvící struktura Barrovo tělísko (podle objevitele kanadského genetika). Nachází se v blízkosti vnitřního povrchu jaderné mem. K jeho reaktivaci dochází pouze v zárodečné tkáni, aby došlo k úspěšnému dokončení oogeneze.

19 Hypoaktivace ch. X u Caenorhabditis elegans Zahrnuje kompenzace dávky částečnou represi X-vázaných genů v somatických bb. hermafroditů. Opět se ho účastní produkty několika g., které se váží specificky na ch. X, ale pouze pokud jsou přítomny 2 ch. X a potlačuje transkripci. Mechanismus působení těchto proteinů není přesně znám, ale předpokládá se, že působí opačně než u drozofily.

20 Mitochondriální dědičnost Vyjadřuje skutečnost, že zygota dostane všechny své funkční mitochondrie od matky z oocytu. Stav je typicky přenášen matkou na všechny její děti. Případné poruchy nikdy nepřenáší muži. Symptomy se mohou lišit u matky a potomků, i mezi sourozenci, v důsledku heteroplazie, což znamená variabilní zastoupení různých populací mitochondrií. Leberova hereditární optická neuropatie (LHON), myoklonická epilepsie s potrhanými červenými sval. vlákny (MERF).

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Determinace pohlaví a evoluce pohlavních chromosomů

Determinace pohlaví a evoluce pohlavních chromosomů Determinace pohlaví a evoluce pohlavních chromosomů Radka Reifová Katedra zoologie Prezentaci naleznete na: http://web.natur.cuni.cz/~radkas/ v záložce Courses Jak vznikají dvě pohlaví Mechanismy determinace


lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické Gonozomáln lní dědičnost Mgr. Aleš RUDA Chromozomové určení pohlaví autozomy gonozomy člověk má 22 párůp autozomů a 1 pár p gonozomů označen ení pohlavních chromozomů: : X a Y. jsou možné celkem 3 kombinace:


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce?

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce? REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince Co bylo dřív? Slepice nebo vejce? Rozmnožování Rozmnožování (reprodukce) může být nepohlavní (vegetativní, asexuální) pohlavní (sexuální;


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým


Hemofilie dnes. Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost

Hemofilie dnes. Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost Hemofilie dnes Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost Zdroje: Evropský sociální fond v ČR Evropská unie Ministerstvo školství, mládeže a tělovýchovy OPVK


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


Dědičnost pohlaví a znaků s pohlavím souvisejících

Dědičnost pohlaví a znaků s pohlavím souvisejících Dědičnost pohlaví a znaků s pohlavím souvisejících Rozmnožování Nepohlavní amixis, bez zvýšení genotypové proměnlivosti Pohlavní amfimixis střídání 2n a n fáze, zvýšení genotypové proměnlivosti Hermafrodité:


Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Hemofilie Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Definice hemofilie Nevyléčitelná vrozená krvácivá choroba s nedostatkem plazmatických faktorů FVIII hemofile A FIX hemofile


10. oogeneze a spermiogeneze meióza, vznik spermií a vajíček ovulační a menstruační cyklus antikoncepční metody, oplození

10. oogeneze a spermiogeneze meióza, vznik spermií a vajíček ovulační a menstruační cyklus antikoncepční metody, oplození 10. oogeneze a spermiogeneze meióza, vznik spermií a vajíček ovulační a menstruační cyklus antikoncepční metody, oplození MEIÓZA meióza (redukční dělení/ meiotické dělení), je buněčné dělení, při kterém


DĚDIČNOST A POHLAVÍ. Lekce 4 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc.

DĚDIČNOST A POHLAVÍ. Lekce 4 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. DĚDIČNOST A POHLAVÍ Lekce 4 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. V evoluci předcházejí asexuální organismy organismům sexuálním a organismy haploidní organismům diploidním. Sexualita se může


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Determinace pohlaví a evoluce pohlavních chromosomů

Determinace pohlaví a evoluce pohlavních chromosomů Determinace pohlaví a evoluce pohlavních chromosomů Radka Reifová Katedra zoologie Prezentaci naleznete na: http://web.natur.cuni.cz/~radkas/ v záložce Courses Jak vznikají dvě pohlaví Mechanismy determinace


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Genetika člověka - reprodukce

Genetika člověka - reprodukce Gymnázium Václava Hraběte Školní rok 2015/2016 Genetika člověka - reprodukce Seminární práce z biologie autor práce: Andrea Jirásková; 8.A vedoucí práce: RNDr. Roman Slušný Prohlášení Prohlašuji tímto,


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Chromozomová teorie dědičnosti KBI / GENE Mgr. Zbyněk Houdek Proč octomilka a T.H. Morgan? Drosophila melanogaster ideální objekt pro genetický výzkum : Rychlý reprodukční cyklus a snadný chov v laboratorních


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová



http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Populační genetika II

Populační genetika II Populační genetika II 4. Mechanismy měnící frekvence alel v populaci Genetický draft (genetické svezení se) Genetický draft = zvýšení frekvence alely díky genetické vazbě s výhodnou mutací. Selekční vymetení


1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,





Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649



MENDELISMUS GENOVÉ INTERAKCE NEMENDELISMUS MENDELISMUS GENOVÉ INTERAKCE NEMENDELISMUS Biologie a genetika BSP, LS4, 2014/2015, Ivan Literák 4. GENOVÉ INTERAKCE Dva (příp. více) geny ovlivňují 1 znak (kvalitativní!) 2 major-geny se ovlivňují -


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením


Výukový materiál zpracovaný v rámci projektu Výuka modern

Výukový materiál zpracovaný v rámci projektu Výuka modern St ední pr myslová škola strojnická Olomouc, t. 17. listopadu 49 Výukový materiál zpracovaný v rámci projektu Výuka modern Registrační číslo projektu: CZ.1.07/1.5.00/34.0205 Šablona: III/2 P írodov dné


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA



NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ Doc. MUDr. A. Šantavá, CSc. Ústav lékařské genetiky a fetální medicíny LF a UP Olomouc Význam genetiky v diagnostice neuromuskulárních onemocnění Podílí


UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku)

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) B I O L O G I E 1. Definice a obory biologie. Obecné vlastnosti organismů. Základní klasifikace organismů.


Klinefelterův syndrom

Klinefelterův syndrom Klinefelterův syndrom Vypracovali: Nikola Hrdá, Jakub Mušuka, Tereza Navrátilová, Peter Slodička, Eva Štefániková, Štefan Šuška, Nikola Tkáčová, Vojtěch Svízela Klinefelterův syndróm genetické onemocnění,


Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická


http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


ANATOMIE A FYZIOLOGIE ÈLOVÌKA Pro humanitní obory. doc. MUDr. Alena Merkunová, CSc. MUDr. PhDr. Miroslav Orel

ANATOMIE A FYZIOLOGIE ÈLOVÌKA Pro humanitní obory. doc. MUDr. Alena Merkunová, CSc. MUDr. PhDr. Miroslav Orel doc. MUDr. Alena Merkunová, CSc. MUDr. PhDr. Miroslav Orel ANATOMIE A FYZIOLOGIE ÈLOVÌKA Pro humanitní obory Vydala Grada Publishing, a.s. U Prùhonu 22, 170 00 Praha 7 tel.: +420 220 386401, fax: +420


Spermatogeneze saranče stěhovavé (Locusta migratoria)

Spermatogeneze saranče stěhovavé (Locusta migratoria) Spermatogeneze saranče stěhovavé (Locusta migratoria) Vývoj pohlavních buněk u živočichů zahrnuje několik dějů, které zajistí, že dojde k redukci a promíchání genetického materiálu a vzniklé buňky jsou


Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk. Aleš Hampl

Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk. Aleš Hampl Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk Aleš Hampl Tkáně Orgány Živé buňky, které plní různé funkce (podpora struktury, přijímání živin, lokomoce,


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Chromozomální aberace nalezené u párů s poruchou reprodukce v letech

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech Chromozomální aberace nalezené u párů s poruchou reprodukce v letech 2000-2005 Jak přistupovat k nálezům minoritních gonozomálních mozaik? Šantavá A., Adamová, K.,Čapková P., Hyjánek J. Ústav lékařské


Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický!

Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický! Karyologie Typy chromosomů A telocentrický B akrocentrický C submetacentrický D metacentrický Člověk nemá typ telocentrický! Chromosom chromosom telomera jádro centomera telomera buňka histony dvoušroubovice


Deriváty karboxylových kyselin, aminokyseliny, estery

Deriváty karboxylových kyselin, aminokyseliny, estery Deriváty karboxylových kyselin, aminokyseliny, estery Zpracovala: Ing. Štěpánka Janstová 29.1.2012 Určeno pro 9. ročník ZŠ V/II,EU-OPVK,42/CH9/Ja Přehled a využití derivátů organických kyselin, jejich


Molekulární procesy po fertilizacinormální či abnormální po ART?

Molekulární procesy po fertilizacinormální či abnormální po ART? Molekulární procesy po fertilizacinormální či abnormální po ART? Aleš Hampl Již více jak MILION dětí bylo na světě počato pomocí ART ART jako zdroj zvýšeného rizika:? Kongenitální malformace (Ericson and


GENvia, s.r.o. Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So

GENvia, s.r.o. Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So 20 1USA I Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So Ne Po Út St Čt Pá So 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 II Ne Po Út St


PARLAMENT ČESKÉ REPUBLIKY Poslanecká sněmovna 2008 V. volební období. Vládní návrh. na vydání. zákona zákona o specifických zdravotních službách

PARLAMENT ČESKÉ REPUBLIKY Poslanecká sněmovna 2008 V. volební období. Vládní návrh. na vydání. zákona zákona o specifických zdravotních službách PARLAMENT ČESKÉ REPUBLIKY Poslanecká sněmovna 2008 V. volební období 689 Vládní návrh na vydání zákona zákona o specifických zdravotních službách - 2 - ZÁKON ze dne 2009 o specifických zdravotních službách


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


Duchenneova/Beckerova svalová dystrofie a Parent Project

Duchenneova/Beckerova svalová dystrofie a Parent Project Duchenneova/Beckerova svalová dystrofie a Parent Project Oddělení lékařské genetiky FN Brno Renata Gaillyová Vzácné nemoci V EU se nemoc považuje za vzácnou, jestliže postihuje méně než 5 osob z každých


Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Zvyšování kvality výuky technických oborů

Zvyšování kvality výuky technických oborů Zvyšování kvality výuky technických oborů Klíčová aktivita V.2 Inovace a zkvalitnění výuky směřující k rozvoji odborných kompetencí žáků středních škol Téma V.2.18 Dřeviny Kapitola 2 Rozmnožování rostlin


Hemofilie Zdeňka Hajšmanová Proces krevního srážení Obr. č. 1 Poranění cévy Vasokonstrikce Primární destičková zátka Fibrinová síť Definice hemofilie Nevyléčitelná vrozená krvácivá choroba s nedostatkem



TERATOGENEZA ONTOGENEZA TERATOGENEZA ONTOGENEZA Vrozené vývojové vady (VVV) Jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo 3-5 % novorozenců.


Deficit mevalonátkinázy (MKD) (nebo hyper IgD syndrom)

Deficit mevalonátkinázy (MKD) (nebo hyper IgD syndrom) www.printo.it/pediatric-rheumatology/cz/intro Deficit mevalonátkinázy (MKD) (nebo hyper IgD syndrom) Verze č 2016 1. CO JE MKD? 1.1 Co je to? Deficit mevalonákinázy patří mezi dědičná onemocnění. Jedná



Buněčné dělení ŘÍZENÍ BUNĚČNÉHO CYKLU BUNĚČNÝ CYKLUS Buněčné dělení Cykliny a na cyklinech závislé proteinkinázy (Cyclin- Dependent Protein Kinases; Cdk-proteinkinázy) - proteiny, které jsou součástí řídícího systému buněčného cyklu 8 cyklinů


Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár

Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár schopen spontánní koncepce, ale žena není schopna donosit


MUTACE mutageny: typy mutací:

MUTACE mutageny: typy mutací: MUTACE charakteristika: náhodné změny v genotypu organismu oproti normálu jsou poměrně vzácné z hlediska klinické genetiky, jsou to právě mutace, které způsobují genetické choroby nebo nádorové bujení


Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace Mutace Klasifikace mutací Z hlediska lokalizace mutací v genotypu Genové mutace Chromozomální mutace Genomové mutace Vznik genových mutací Tranzice pyrim. za pyrim. C na T T na C purin za purin A na G


Buňky, tkáně, orgány, soustavy

Buňky, tkáně, orgány, soustavy Lidská buňka buněčné organely a struktury: Jádro Endoplazmatické retikulum Goldiho aparát Mitochondrie Lysozomy Centrioly Cytoskelet Cytoplazma Cytoplazmatická membrána Buněčné jádro Jadérko Karyoplazma


S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef






GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností


Základní škola Náchod Plhov: ŠVP Klíče k životu

Základní škola Náchod Plhov: ŠVP Klíče k životu VZDĚLÁVACÍ OBLAST: VZDĚLÁVACÍ OBOR: PŘEDMĚT: ČLOVĚK A PŘÍRODA PŘÍRODOPIS PŘÍRODOPIS 8.ROČNÍK Téma, učivo Rozvíjené kompetence, očekávané výstupy Mezipředmětové vztahy Poznámky Úvod, opakování učiva ue


Velká rodina života. mlha se zvedá

Velká rodina života. mlha se zvedá Úvod Jen málo národů a lidských pospolitostí na Zemi nemá svůj mýtus o stvoření. Američtí Irokézové věřili, že svět a všechno v něm stvořili nebeští lidé, podle starověkých Japonců byl svět výtvorem bohů,


Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální


Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry


Řád plemenné knihy plemene Aberdeen Angus

Řád plemenné knihy plemene Aberdeen Angus Řád plemenné knihy plemene Aberdeen Angus l. Základní východiska plemenné knihy 1.1. Právním základem řádu plemenné knihy (dále jen Řád PK) je zákon ČR č. 344/2006 Sb. o šlechtění, plemenitbě a evidenci


Dilatační (městnavá) kardiomyopatie z pohledu patologa

Dilatační (městnavá) kardiomyopatie z pohledu patologa Dilatační (městnavá) kardiomyopatie z pohledu patologa Kardiomyopatie jsou heterogenní skupina onemocnění myokardu Dva základní typy: hypertorfická a dilatační, nově restrikční a arytmogenní kardiomyopatie





Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina Přehled GMH Seminář z biologie GENETIKA Molekulární genetika Základní dogma molekulární biologie Základním nosičem genetické informace je molekula DNA. Tato molekula se může replikovat (kopírovat). Informace


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


EMBRYOLOGIE Učebnice pro studenty lékařství a oborů všeobecná sestra a porodní asistentka

EMBRYOLOGIE Učebnice pro studenty lékařství a oborů všeobecná sestra a porodní asistentka 6pt;font-style:normal;color:grey;font-family:Verdana,Geneva,Kalimati,sans-serif;text-decoration:none;text-align:center;font-variant:n = = < p s t y l e = " p a d d i n g : 0 ; b o r d e r : 0 ; t e x t
