Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách

Rozměr: px
Začít zobrazení ze stránky:

Download "Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách"

Transkript

1 Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Kamila Zdeňková Transgenní rostliny, tj. takové rostliny, do jejichž dědičného základu byly metodami genového inženýrství vneseny geny z jiných, často nepříbuzných organizmů, mají řešit otázky spojené s potřebou rychlého zvyšování zemědělské produkce, která úzce souvisí s růstem lidské populace. Dalším problémem, s jehož řešením mohou pomoci, jsou každoroční ztráty úrody po napadení škůdci nebo chorobami, protože množství chemikálií používaných na ochranu proti nim není z ekologického hlediska možné neustále zvyšovat. Hlavním cílem genetických modifikací (GM) je tedy zasáhnout do rostlinného genomu tak, aby došlo k vytvoření organismů rezistentních k herbicidům, odolných vůči škůdcům, bakteriálním, plísňovým a virovým infekcím, extrémním podmínkám, nebo ke zvýšení nutriční hodnoty potravin. Přestože celosvětově výměra ploch, na kterých jsou pěstovány transgenní plodiny, překročila v roce 2005 již 90 milionů hektarů, je stále respektována možnost nežádoucích projevů, které by mohly hypoteticky negativně ovlivňovat ostatní organizmy včetně člověka. V současné době existují v řadě zemí celého světa určitá omezení pro distribuci, prodej a využití geneticky modifikovaných organizmů (GMO). V České republice je použití GMO upraveno zákonem č. 346/2005 Sb., o nakládání s GMO a produkty, který zahrnuje problematiku uzavřeného nakládání s GMO a uvádění GMO do životního prostředí či do oběhu. Dále pak stanoví povinnost značit potraviny a krmiva obsahující více než 0,9 % GMO. Z legislativních požadavků plyne potřeba zavedení spolehlivého, účelného a rychlého kontrolního systému pro detekci GMO v potravinách, potravinářských surovinách a krmivech. Kontrola potravinářských surovin i samotných potravin a určování přítomnosti transgenů je dnes široce se rozvíjející vědní oblastí, která spojuje znalosti genetického inženýrství, biochemie, mikrobiologie a dalších vědních disciplín. V principu jsou metody detekce a kvantifikace GMO založeny buď na stanovení specifických nukleových kyselin (polymerasová řetězová reakce (PCR) či detekce exprese transgenu na úrovni RNA) nebo na stanovení bílkovin (určení přítomnosti bílkovin, imunochemické metody). Některé typy GMO mohou být detekovány také chromatograficky či infračervenou spektroskopií. Ve vědeckých i analytických laboratořích je nejčastěji prováděna detekce GMO pomocí PCR, kvantifikace pak pomocí PCR s fluorescenční detekcí v reálném čase (qrt PCR). Běžně používané testovací postupy jsou shrnuty v tabulce I. Všechny uvedené metody mají určitá omezení, ať již citlivost, možnost ovlivnění ostatními složkami potraviny, vhodnost metody

2 pro daný vzorek nebo cenu stanovení. Tato prezentace shrnuje aplikace uvedených technologií pro analýzu GMO a uvádí přednosti a specifická omezení jejich použití. Tab. I: Metody používané pro detekce GMO. Molekulárně - Detekce DNA PCR a její variace (multiplex PCR, nested PCR) biologické metody Kvantitativní kompetitivní PCR (QC-PCR) PCR s fluorescenční detekcí v reálném čase (qrt PCR) Southernův přenos DNA čipy PCR-ELISA Detekce RNA Reversní transkripce PCR (RT-PCR) Northern přenos RPA (ribonuclease protein assay) Imunochemické Detekce proteinu ELISA (Enzyme-Linked ImmunoSorbent Assay) metody Western přenos (Imunoblot) Ostatní techniky Určení aktivity produktu transgenu Chromatografie Infračervená spektroskopie Metody založené na detekci nukleových kyselin Pro detekci GMO bývají nejčastěji používány metody založené na detekci nukleových kyselin (NK). Mezi tyto metody patří PCR a její variace multiplex PCR, nested PCR, kvantitativní kompetitivní PCR (QC-PCR), PCR s fluorescenční detekcí v reálném čase (qrt PCR), reversní transkripce - PCR (RT-PCR); Southernův přenos; Northern přenos a ribonuclease protein assay (RPA), založená na specifické vazbě bílkoviny na NK. Jedním z prvních kroků testů založených na detekci NK je jejich izolace z testovaného vzorku potravin a potravinářských surovin, která zahrnuje lyzi buněčných membrán, inaktivaci nukleas a separaci nukleových kyselin od zbytků buněk. Efektivita metod založených na detekci NK záleží na kvalitě a čistotě izolovaných NK. Tyto ukazatele jsou důležitými faktory při stanovení GMO, a proto je významným bodem celé analysy výběr vhodné izolační metody a purifikačního procesu. Polymerasová řetězová reakce (PCR) Polymerasová řetězová reakce (angl. polymerase chain reaction) je in vitro reakce umožňující mnohonásobné namnožení definovaných úseků DNA. Reakce je katalyzovaná termostabilní DNA polymerasou, např. Taq DNA polymerasou izolovanou z termofilní bakterie Thermus aquaticus. K namnožení cílové DNA se používá dvou oligonukleotidových primerů, které jsou komplementární k 3 a 5 koncovým sekvencím cílového úseku

3 Vzhledem k tomu, že se jedná o řetězovou reakci, poskytuje tato metoda až 10 6 násobné pomnožení cílového úseku DNA během 2-3 hodin. Vlastní PCR se skládá z cyklického opakování 3 základních kroků (Obr. 1): 1) Oddělení vláken dvojšroubovice DNA teplotní denaturací při teplotě vyšší než 92 C. 2) Připojení primerů k jejich komplementárním úsekům v DNA (angl. annealing) při teplotě C. 3) Prodloužení připojených primerů termostabilní DNA polymerasou (angl. elongace) při teplotě C. Počet těchto cyklů (zpravidla 35 nebo 40) závisí na koncentračních poměrech v reakční směsi, požadovaném výtěžku a životnosti enzymu. Cyklickým opakováním kroků dochází k syntéze úseku definovaného primery, který tvoří hlavní produkt reakce. Užívané primery jsou synteticky připravené oligonukleotidy, které zpravidla obsahují nukleotidů a jejichž sekvence jsou komplementární k požadovaným úsekům DNA. Umístění primerů ovlivňuje informační hodnotu PCR. Obr. 1: Polymerasová řetězová reakce (upraveno dle K identifikaci, separaci a purifikaci stejně dlouhých úseků DNA, tzv. amplikonů, získaných pomocí PCR se nejčastěji používá elektroforéza v agarozovém gelu. Při tomto způsobu detekce amplifikovaných produktů existuje možnost záměny nespecificky namnoženého úseku a specifického PCR produktu, zvláště pokud se jedná o produkty podobné velikosti. Pro snížení rizika získání falešně pozitivních výsledků je v některých

4 případech vhodné zařadit další analýzu produktu, například Southern přenosem, štěpení restrikčními endonukleasami, sekvenováním nebo pomocí značek zabudovaných přímo do primerů či nukleotidů nebo do hybridizační sondy specifické k určitému PCR produktu (radioaktivní a neradioaktivní značky). Multiplex PCR a Nested PCR Obměnou tradiční polymerasové řetězové reakce je metoda multiplex PCR založená na přidání násobné množství párů primerů do reakční směsi, což umožňuje analyzovat více parametrů v průběhu jednoho reakčního procesu. Tento způsob amplifikace je uplatňován například při kvantitativní detekci transgenní DNA, při které je jeden pár používaných primerů komplementární k internímu genu a druhý pár primerů k transgenu. Porovnáním množství PCR produktů vzniklých namnožením obou cílových úseků bývá kvantifikována transgenní DNA v analyzovaném vzorku. Ke zvýšení citlivosti a přesnosti může být použita tzv. nested PCR, která je složena ze dvou po sobě následujících amplifikačních reakcí s reakčními cykly. Templátem první reakce je DNA získaná izolací vzorku, templátem druhé je produkt získaní první reakcí (Obr. 2). Jako primery jsou použity dva druhy oligonukleotidové sekvence (vnitřní a vnější). Vnitřní primery jsou komplementární k oblasti produktu získaného první reakcí. Zvýšená přesnost této techniky je důsledkem eliminace namnožených nespecifických amplifikačních produktů. 1. PCR vnějšíprimery DNA templát cílový produkt 1. PCR 2. PCR vnitřní primery DNA templát (cílový produkt 1. PCR) cílový produkt 2. PCR Obr. 2: Nested PCR (upraveno dle Čikoš a kol., 2001). PCR systém používaný pro detekci GMO pomocí PCR

5 Na obrázku 3 je znázorněn používaný PCR systém detekce GMO pomocí PCR. Obrázek ukazuje předem připravenou rostlinnou transkripční jednotku (konstrukt) obsahující promotor (P), kódující sekvence (A,B) a terminátor (T). Dále jsou znázorněny rozdílné pozice komplementárních primerů a informace, které je možno získat z výsledků PCR. Pokud jsou v dané reakci použity primery komplementární k genomové DNA, ze získaných výsledků můžeme určit, je-li izolovaná NK schopna namnožení PCR procesem (viz. schéma úroveň A, Druhově specifické PCR). Např. u potravin částečně vyrobených z transformované sóji je prováděna detekce sójového lecitinového genu. V případě použití primerů komplementárních k regulačním sekvencím mohou získané výsledky potvrdit přítomnost transgenní DNA v testovaném vzorku potraviny nebo potravinářské suroviny (úroveň BI, Monitorovací PCR). Příkladem je kvalitativním PCR systém specifický pro originální sekvence 35S promotoru viru žilkové mozaiky květáku (P-35S CaMV promotor) či T-nos terminátoru půdní bakterie Agrobacterium tumefaciens, jež patří mezi nejčastěji používané regulační sekvence při cíleném přenosu genů do rostlinných buněk. Prostřednictvím primerů nasedajících uvnitř transgenní DNA bývá určen vložený gen (úroveň BII, Amplifikace transgenu). Primery komplementární k regulační sekvenci a genu určují vloženou transkripční jednotku (úroveň BIII, Konstrukt specifické PCR) a primery amplifikující úsek mezi regulační sekvencí a genomovou DNA určují druh transgenního organizmu (úroveň BIV, Odrůdově specifické PCR)

6 A Druhově specifické PCR BI Monitorovací PCR BII Amplifikace transgenu BIII Konstrukt specifické PCR BIV Odrůdově specifické PCR Obr. 3: Používaný systém PCR detekce GMO (upraveno dle Zdeňková, 2002). P: promotor, T: terminátor, Gen A a gen B: vložené geny Metoda PCR představuje významnou techniku pro detekci GMO v potravinách. Nukleové kyseliny nejsou považovány za důležitou složku potravin, jejich přítomnost nezvyšuje nutriční hodnotu výrobku a neexistuje přímá vazba mezi DNA a kvalitou potraviny, přesto jsou hlavním nástrojem při detekci GMO. Zatímco proteiny jsou teplotně nestabilní molekuly a v průběhu zpracování potravin degradují, nukleové kyseliny jsou odolnější vůči zvýšené teplotě i změnám ph. Kromě toho metoda PCR je vysoce specifická, citlivá a rychlá. Umožňuje najít teoreticky jedinou odlišnou molekulu DNA ve vzorku materiálu během několika hodin, čehož je využíváno pro rychlé analýzy velkého počtů vzorků. Detekční limity PCR metod se pohybují v rozmezí 0,001 až 1 % GMO. Pomocí PCR je však prokázána pouze přítomnost sekvencí komplementárních ke zvoleným primerům. Výsledky nenaznačují, zda je DNA sekvence integrována do genomu rostliny ani její koncentraci. Kvantifikace GMO v potravinách pomocí PCR Hlavním nedostatkem tradiční PCR je nepřesná kvantifikace, která je závislá na účinnosti amplifikačního procesu. Jestliže je účinnost amplifikace (angl. efficiency, E) konstantní

7 pro každý reakční cyklus, koncentrace PCR produktu je úměrná počátečnímu množství cílové DNA. Účinnost amplifikace však není parametrem konstantním, ale proměnným. A to v rámci různých reakcí i v průběhu jedné reakce, zejména v posledních cyklech, kdy jsou produkty tvořené v neexponenciální fázi neznámou reakční rychlostí. Pro dosažení vysoké citlivosti PCR procesu je množství vytvořeného produktu měřeno v závěrečné fázi, kdy amplikon dosáhne maximálního výtěžku (známé jako plato fáze ). V plato fázi procesu je korelace mezi koncentrací produktu a počátečním množstvím cílové DNA jen velmi nízká. Pro kvantifikaci DNA jsou používány metody, které vyřešily problém určení vztahu mezi koncentrací cílové DNA sekvence a množstvím PCR produktu vytvářeného během amplifikace. Používané techniky jsou následující: Společná amplifikace cílové sekvence a vnitřního standardu pomocí kvantitativní kompetitivní PCR (QC-PCR). Měření PCR produktu v počátečních fázích reakce, kdy je účinnost amplifikace (E) stále ještě konstantní a proto jsou koncentrace produktu v korelaci s počátečním množstvím cílové DNA sekvence. Tohoto principu využívají metody PCR s fluorescenční detekcí v reálném čase (qrt PCR) a spojení metod PCR-ELISA. Kvantitativní kompetitivní polymerasová řetězová reakce (QC-PCR) Metoda kvantitativní kompetitivní PCR (QC-PCR) je založena na společné amplifikaci cílové sekvence vzorku a vnitřního standardu o známé koncentraci. Synteticky připravený vnitřní standard i analyzovaný vzorek jsou amplifikovány prostřednictvím stejných primerů, čímž je zajištěna podobná amplifikační účinnost. Produkt amplifikace vnitřního standardu by měl obsahovat stejné procentuální zastoupení guanidinu a cytosinu jako cílová sekvence testovaného vzorku, dále musí mít velikost umožňující jeho snadné odlišení od kvantifikované cílové sekvence. Rozdíl ve velikosti produktů se pohybuje maximálně v desítkách párů bazí. Při QC-PCR je vždy zapotřebí analyzovat sérii PCR reakcí jedné koncentrace DNA analyzovaného vzorku s přídavky různých koncentrací DNA vnitřního standardu. DNA standardu a cílového úseku soupeří o primery, nukleotidy i polymerasu. Pokud je na začátku reakce výrazný nadbytek jedné cílové DNA, je produkt amplifikace tohoto úseku ve značném přebytku. Kvantitativní vyhodnocení je získáno odečtením po elektroforetickém rozdělení PCR produktů (Obr. 4). Množství cílové sekvence je odečteno z bodu ekvivalence, ve kterém je shodná intenzita signálu PCR produktu vzorku se signálem vnitřního standardu o známé koncentraci. Nevýhodou této metody je semikvantitativní odhad koncentrace cílové sekvence ve vzorku, výhodou je odhalení případné inhibice PCR procesu

8 Obr. 4: Princip QC-PCR společná amplifikace neměnného množství cílové sekvence s rozdílnými množstvími vnitřního standardu (upraveno dle Zvýšující se přídavek koncentrace vnitřního standardu. Bod ekvivalence Amplifikovaná cílová sekvence. PCR s fluorescenční detekcí v reálném čase (qrt PCR) Principem qrt PCR je rychlé a přesné zaznamenávání produktů PCR bezprostředně po jejich vzniku, v každém jednotlivém cyklu reakce. K detekci vznikajícího produktu mohou být použity různé systémy založené na stanovení změny intenzity fluorescenčního záření během amplifikace. Jeden z používaných systémů využívá interkalační barvivo SYBR Green I (SG I), další jsou založeny na použití fluorescenčně značených sond nebo primerů. Pro kvantifikaci DNA je využíváno schopnosti interkalačního barviva SG I vázat se do malého žlábku dvojvlákna DNA (dsdna), princip qrt PCR se SG I je vysvětlen na obrázku 5. V průběhu cyklu je nejprve DNA denaturována teplotou na jednotlivá vlákna, do kterých se barvivo neinterkaluje (Obr. 5a). Intenzita jeho fluorescenčního signálu je tedy velmi nízká. Po snížení teploty dojde k nasednutí primerů a vytvoření krátkého úseku dvouvláknové DNA. Barvivo SG I je vázáno na nově vzniklou dsdna (Obr. 5b). V průběhu prodlužování primerů vzrůstá množství barviva navázaného do dsdna a tím i intenzita fluorescence, která je měřena na konci elongační fáze každého cyklu (Obr. 5c). Začátek vzrůstu fluorescence měřeného vzorku nad hodnotu fluorescence pozadí je závislý na počáteční koncentraci cílové DNA. Obr. 5: Interkalace barviva SG I mezi řetězce dsdna (upraveno dle Legenda: a) Prostředí reakce po teplotní denaturaci b) Nasednutí primerů a vazba barviva c) Prodlužování primerů a) b) c)

9 Pro specifickou detekci DNA při qrt PCR jsou používány sondy komplementární k vnitřní části cílového úseku, méně často pak LUX systém využívající jednoho fluorescenčně značeného primeru. Sondy nejsou většinou v průběhu reakce rozštěpeny, pouze hydrolyzační TaqMan sondy jsou v průběhu amplifikační reakce rozštěpeny 5-3 exonukleasovou aktivitou Taq polymerasy. TaqMan fluorescenčně značené sondy jsou složeny z krátkého DNA fragmentu, který obsahuje dvojici fluoroforů. Jeden z nich, na 5 konci sondy, má funkci zářiče (angl. reporter; R ) a druhý, na 3 konci sondy, má funkci zhášeče fluorescence (angl. quencher; Q ). Díky jejich vzájemné blízkosti je u sondy v inaktivním stavu potlačováno zhášečem všechno záření emitované zářičem. V průběhu každého cyklu je stejně jako při klasické PCR dvojvlákno DNA nejdříve separováno na jednotlivá vlákna, dále dochází k nasednutí primerů a TaqMan sondy. Posledním krokem je polymerace DNA polymerasou. DNA polymerasy používané v qrt PCR vykazují silnou 5-3 exonukleasovou aktivitu, podle podmínek reakce může při polymeraci štěpit vnitřní sondu na jednotlivé nukleotidy. Po rozštěpení TaqMan sondy se zhášeč a fluorofor již nenacházejí v těsné blízkosti. Dochází k ukončení efektu zhášení a tím k nárůstu fluorescenčního signálu. Vzniklá fluorescence je měřena na konci každé elongační fáze (Obr. 6). Obr. 6: Princip TaqMan sond (upraveno dle Při qrt PCR je využíván jev známý pod zkratkou FRET (Fluorescenční rezonanční přenos energie; angl. Fluorescence Resonance Energy Transfer), který je založen na přenosu

10 energie mezi fluorofory. Na obrázku 7 je zobrazen systém Dual Oligo FRET sond založený na použití dvou vnitřních sond s fluoroforem na 3 konci sondy 1 a fluoroforem na 5 konci sondy 2. Sondy jsou navržené k nasednutí blízko sebe uvnitř cílové sekvence. První fluorofor po excitaci vnějším zdrojem emituje zelené fluorescenční světlo. Při dostatečné blízkosti druhé sondy druhý fluorofor zachycuje emitované světlo a excituje světlo červené o vyšší vlnové délce. Celý systém sond je měřen na konci annelingu (Obr 7c). FRET (Obr. 7c) je závislý na vzdálenosti sond, efektivní transfer probíhá pouze mezi sondami v těsné blízkosti (1-5 nukleotidů). V průběhu elongace dochází k uvolnění vnitřních sond, a tím k jejích oddálení. Druhá sonda tedy nezachytává energii vysílanou první, tím dochází k nárůstu fluorescence (Obr 7b). Obr. 7: Princip FRET sond (upraveno dle Legenda: a) Prostředí reakce po teplotní denaturaci. d) Ozáření nenavázaných sond. b) Ozáření po nasednutí sond na cílové sekvence (měřena je fluorescence emitovaná druhým fluoroforem). LUX systém (Light Upon extension) nevyužívá pro fluorescenční detekci vznikajících produktů sondu, fluorescenčně je značen jeden z primerů. Zhášení fluorescence značeného primeru je dáno jeho sekundární strukturou (smyčka), k vzrůstu fluorescence dochází po nasednutí primeru na cílovou sekvenci a při jeho prodlužování. Ačkoliv je vysoká cena přístrojů a specifických reagencií překážkou pro mnoho

11 laboratoří, qrt PCR může být v současné době považována za nejpřesnější a nejvýhodnější dostupnou kvantitativní metodu. DNA čipy Rychlý rozvoj molekulárně-biologických metod umožňuje přípravu GMO, které obsahují nové znaky, rozmanitost a vyšší množství vkládaných genů i regulačních prvků. Již v roce 1997 Hemmer publikoval některé schválené GM plodiny neobsahující P-35S promotor ani T- nos terminátor. Z toho vyplývá potřeba analýzy dalších genetických modifikací. Toto vyžaduje vývoj nových automatizovaných systémů, které mohou snížit nejen čas, ale i náklady analýz. Detekovat přítomnost různých sekvencí v molekule NK lze také pomocí biočipů (angl. microarrays nebo arrays), což jsou kolekce mikroskopických spotů DNA navázaných k pevnému povrchu, jako například sklu, plastu nebo křemíkovému čipu. Na velmi malé plošce čipu jsou umístěny tisíce krátkých DNA sond komplementárních k hledaným sekvencím sledovaného vzorku. Navázané DNA fragmenty se označují jako sondy, kterých můžou být na jediném biočipu tisíce. Technika DNA čipů je založena na klasické technologii hybridizace DNA. Principem je detekce sekvencí NK na základě specifické interakce komplementárních úseků analyzované molekuly a DNA sondy. Jako sondy mohou být využívány kratší oligonukleotidy (20-30 bp), PCR produkty, genomová DNA, umělé bakteriální chromosomy (BAC z angl. bacterial artificial chromosome), plazmidy nebo i dlouhé oligonukleotidy (do 70 bp). DNA biočipy jsou nejčastěji využívány k měření exprese velkého množství genů současně. NK bývají izolovány z buněk, RNA je a poté převedena na cdna nebo crna, a jsou amplifikovány pomocí PCR technik. Fluorescenční značky mohou být přímo zabudovány do nově syntetizovaného řetězce (pokud je použito značených nukleotidů) nebo chemicky navázány k řetězcům jednořetězové DNA nebo RNA. Vzorky jsou naneseny na filtry odděleně a jsou inkubovány se sondou a promyty. Řetězec NK hybridizuje se sondou imobilizovanou na povrchu pevného nosiče. Hybridizované sondy jsou detekovány buď chemiluminiscenčně nebo přímo fluorescenčně. V místech, kde došlo k hybridizaci na základě komplementarity příslušných úseků, je fluorescence emitována laserovým paprskem a intensita každé skvrny je měřena CCD kamerou a data jsou počítačově vyhodnocena. Pro detekci GMO byly použity např. v práci Xu a kol. (2006) pro monitorování přítomnosti GMO pomocí detekce P-35S, T-nos a specifických úseků transgenů. Pomocí čipu navrženého ve zmiňované práci lze detekovat 95 % v současné době povolených GM odrůd, detekční limit tohoto čipu je 0,5 % GM sóji a 1 % GM kukuřice

12 Analysa RNA V mnoha případech jsou analýzy exprese transgenů zaměřeny na proteiny nebo jiné finální produkty, jejichž akumulace má být fenotypovým projevem exprese. Ne vždy je možní provést analýzu proteinů. Požadovaných výsledků lze také dosáhnout analysou RNA transkriptů. Dokonce v případech, kdy jsou známy výsledky analýzy proteinů, poskytla analýza RNA užitečné informace o akumulaci transkriptu a jeho stabilitě. Pomáhá i při objasňování nepředpokládaných fenotypových projevů. Pro měření množství RNA mohou být použity takové techniky jako reverzní transkripce - PCR (RT-PCR), Northern přenos a ribonuclease protein assay (RPA). Principem RT-PCR je spojení PCR s reverzní transkripcí. Nejdříve je provedena izolace totální RNA nebo čisté mrna z testovaného vzorku. Pomocí DNasy jsou odstraněny zbytky DNA, následně je RNA podrobena reverzní transkripci a polymerasové řetězové reakci. Popisovaná metoda může být použita jako rychlá a relativně vysoce účinná screeningová metoda určení přítomnosti specifického transkriptu. Výhody RT-PCR, v porovnání s Northern přenosem a RPA, jsou malá množství potřebného materiálu, vysoká citlivost a snadnost přípravy vzorku. Nevýhodou při práci s RNA je vysoké riziko její degradace RNasami, které jsou velmi stabilní a nevyžadují žádné kofaktory. Jestliže použijeme RT-PCR je nutné umět rozlišit mezi produkty vzniklými z amplifikace genomové DNA vzorku a produkty syntézy cdna z RNA vzorku in vitro. Proto je požadováno zpracování vzorku pomocí DNas a dále by měli být použity takové primery, aby amplifikace vzorku DNA byla buď nemožná nebo aby amplifikované produkty měly rozdílnou velikost než amplikony vzniklé z cdna. Metody založené na detekci proteinu Metody založené na detekci proteinu (imunochemické a enzymové) detekují produkt transgenu nebo metabolity, jejichž produkce je ovlivněna vloženým genem. Pro stanovení GMO v potravinách a potravinářských surovinách mají tyto metody podstatné limity, které významně omezují jejich běžné použití. První nevýhodou je dispozice jen velmi mála protilátek specifických proti proteinům produkovaným expresí vloženého genu, není však určen vložený transgen. Druhou nevýhodou pro aplikaci těchto analýz je degradace a změny v konformaci proteinů v průběhu zpracování potravin. V případě, že jsou vhodné protilátky k dispozici, jsou vyvinuté metody vhodné pouze pro čerstvé potravinové suroviny a neupravené potraviny. Nicméně tyto metody jsou citlivé, specifické, efektivní a jsou běžně

13 používány pro studium akumulace proteinů v transgenních rostlinách. Detekční limit se pohybuje mezi 0,3 až 1 % GMO. Správnost a přesnost stanovení však může být nepříznivě ovlivněna ve složitých matricích, kde možné interference mohou způsobovat nespecifické interakce protilátek. Imunochemické metody Základem všech imunochemických detekčních metod je specifická interakce antigenu (Ag) s protilátkou (Ab). Jsou běžně používány pro studium akumulace proteinů v transgenních rostlinách. Pro detekci GMO jsou nejčastěji používány dva typy imunochemických metod: a) Western přenos (imunoblotting) b) ELISA (Enzyme-Linked ImmunoSorbent Assay) Při Western přenosu je směs proteinů přenesena z gelu na nitrocelulosovou membránu a jednotlivé proteiny jsou identifikovány podle toho, jak se váží s příslušnými značenými protilátkami. Enzymová imunoanalýza na pevné fázi ELISA patří mezi imunoanalytické metody, které ve fázi detekce nebo kvantifikace používají enzymovou reakci. Jeden z imunoreaktantů (Ag, Ab) je vždy imobilizován na pevný nosič, kterým může být např. membrána, skleněná podložka, stěna zkumavky nebo mikrotitrační destičky. Nejčastější uspořádaní metody používané pro detekci GMO v potravinách je přímá nekompetitivní ELISA, tzv. sendvičový formát (Obr. 8). Využívá většinou dvou protilátek, z nichž první je imobilizovaná na povrch nosiče a specificky interaguje s antigenem. Druhá protilátka, značená enzymem (nejčastěji peroxidasa, alkalická fosfatasa, β-galaktosidasa a glukosa oxidasa) reaguje s jinými determinantními skupinami na odlišné části molekuly antigenu. Po přidání chromogenního substrátu je výsledná enzymová reakce vyhodnocena spektrofotometricky. Obr. 8: Přímá nekompetitivní ELISA. Legenda: a) Imobilizovaná protilátka b) Přídavek vzorku c) Specifická interakce protilátky a antigenu d) Sendvič antigenu a obou protilátek a) b) c) d)

14 Výhoda Western přenosu oproti ELISA je schopnost stanovit molekulární hmotnost proteinu, reprodukovatelné výsledky mohou být dosaženy i při použití ne zcela přečištěných protilátek. Western hybridizace je však časově náročnější a kvantitativní výsledky jsou určovány s menší přesností. Naproti tomu ELISA metody jsou vysoce specifické, citlivé a relativně snadno proveditelné. Mezi nevýhody ELISA metod patří občasný výskyt falešně pozitivních výsledků získaných např. použitím protilátek s nízkou specifitu. Sendvičová ELISA je používána například pro stanovení enzymu 5-enolpyruvátšikimát-3--fosfosynthasy (CP4 EPSPS) exprimovaného v transgenní sóji, odolné vůči herbicidu Roundup. Při spojení PCR-ELISA je detekce produktu polymerační reakce provedena pomocí protilátek. Amplifikační produkt je značen digoxigeninem začleňovaným během amplifikační reakce probíhající v přítomnosti digoxigenin-11-dutp (DIG-dUTP). Produkt PCR reakce hybridizuje s komplementární sondou značenou biotinem a poté je hybrid imobilizován na mikrotitrační destičky pokryté streptavidinem. Imobilizace je závislá na interakci biotinu navázaného na sondě se streptavidinem, jímž je potažen povrch jamek destičky. Po promytí volných nespecifických amplifikačních produktů je kvantifikováno množství navázaných PCR produktů pomocí protilátky proti digoxigeninu s konjugovaným enzymem. Detekce je zprostředkována reakcí enzymu s chromogenním substrátem. Princip metody je schématicky znázorněn na obrázku 9. Tato metoda je velmi citlivá, specifická a rychlá. Pokud je polymerasová řetězová reakce zastavena před poklesem amplifikační účinnosti, je možné použít metodu PCR-ELISA pro kvantifikaci GMO. Při použití mikrotitračních destiček může být charakterizováno a kvantifikováno až 96 produktů během 1-5 hodin. I když byla tato metoda aplikována na různé vzorky a GMO detekční kit využívající tohoto principu je na trhu dostupný, nenašla široké uplatnění při kvantifikaci obsahu GMO v potravinách a potravinářských výrobcích. Obr. 9: Princip detekce produktu PCR pomocí ELISA (upraveno dle

15 Strip test Na principu imunochromatografie v sendvičovém uspořádání (Lateral Flow Immunoassay, LFIA) jsou založeny nitrocelulosové testovací proužky Lateral Flow Strip, jejichž princip je vysvětlen na obrázku 10. Stripy umožňují testování jednotlivých vzorků potravin a potravinářských surovin. Test používá dva typy monoklonálních protilátek, specifických pro stanovovaný protein. První typ protilátky je imobilizován na membráně testovacího proužku, druhý je konjugován s koloidním zlatem nebo barevnými latexovými částicemi. Pokud je ve vzorku transgenní protein, vytváří sendvič se značenými a imobilizovanými protilátkami. Pozitivním výsledkem je barevná linka uprostřed testu. V horní části testovacího proužku je imobilizována kontrolní protilátka, která váže přebytek značených protilátek nezávisle na tom, zda je antigen ve vzorku přítomen. Jestliže je výsledek testu negativní a sledovaný protein není přítomen v extraktu, objeví se pouze jedna linka v horní části testovacího proužku vypovídající o funkčnosti a správnosti prováděného testu. Jestliže je transgenní protein přítomen, jsou zbarveny obě linky. Lateral Flow Strip poskytují výsledky během 5-10 minut. Kromě časové nenáročnosti jsou dalšími výhodami nízká cena a jednoduchost provedení. Lateral Flow Strip se používají pouze pro informativní stanovení, pozitivní výsledky testu musejí být konfirmovány jinou metodou. Z těchto důvodů je metoda vhodná a v praxi používaná pro přímé získání prvních předběžných výsledků. Obr. 10: Lateral Flow Strip (upraveno dle Lipton a kol., 2000)

16 Určení aktivity produktu transgenu Cíleným fenotypovým projevem vloženého genu bývá nejčastěji protein se specifickou aktivitou. Aktivita může být měřena pomocí biochemických metod a/nebo biometod např. rezistence rostliny vůči hmyzu nebo patogenům. V každém případě je důležité uvědomit si, že tato aktivita je v mnoha případech nejvíce řízená fenotypem rostliny. Tento fakt může být rozhodující pro pochopení fenotypového projevu. Ostatní techniky používané pro detekci GMO Chromatografie Pokud se liší složení GMO od nemodifikovaného organismu, např. zastoupení mastných kyselin nebo triglyceridů, mohou být tyto rozdíly detekovány prostřednictvím tradičních chemických metod založených na chromatografickém principu. Toto je možné využít například při detekci oleje získaného z GM kanoly pomocí HPLC (vysokotlaká kapalinová chromatografie) spojené s hmotnostní ionizační spektrometrií (HPLC-MS). Nicméně, tato metoda je průkazná pouze tehdy, pokud je složení GM rostlin nebo získaných produktů významně odlišné od složení nemodifikovaných organismů. Mimo to jsou tyto metody vhodné spíše pro kvalitativní analýzu než pro kvantifikaci GMO. Infračervená spektroskopie

17 Určité zásahy do genomu organizmu mohou změnit i strukturu vláken v rostlinách, přestože nejsou detekovatelné žádné významné rozdíly ve složení proteinů nebo olejů (např. Roundup Ready sója). Změny ve struktuře mohou být zaznamenány pomocí infračervené spektroskopie. Nicméně schopnost rozlišit malé množství GMO v nemodifikovaných produktech je v tomto případě rovněž značně obtížné, stejně jako v případě použití chromatografických metod. Závěr V současné době existuje řada principiálně rozdílných metod, jež mohou být použity pro kvantifikaci a charakterizaci transgenní DNA, eventuelně výsledného produktu její exprese. Při výběru vhodných detekčních metod pro konkrétní materiál je vždy předem nutné zvážit výpovědní hodnotu, citlivost, specifičnost a další výhody i nevýhody každého metodického postupu. V souvislosti s tím je důležité přihlédnout též k charakteru, složení a původu testovaného materiálu, který může ovlivnit izolaci DNA nebo bílkovin. Vzhledem k tomu, že se vždy jedná o analýzy citlivé na přesnost provedení, je laboratorní zručnost a zkušenost v dané problematice nezbytnou podmínkou pro úspěšné testování GMO. Nejčastěji jsou průkaz a kvantifikace GMO prováděny molekulárně - biologickou metodou PCR, založenou na detekci nukleových kyselin nebo imunochemickou metodou ELISA, založenou na detekci specifických proteinů pomocí protilátek

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární

Více

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce

Více

Izolace nukleových kyselin

Izolace nukleových kyselin Izolace nukleových kyselin Požadavky na izolaci nukleových kyselin V nativním stavu z přirozeného materiálu v dostatečném množství požadované čistotě. Nukleové kyseliny je třeba zbavit všech látek, které

Více

Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich

Více

Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor

Více

Imunochemické metody. na principu vazby antigenu a protilátky

Imunochemické metody. na principu vazby antigenu a protilátky Imunochemické metody na principu vazby antigenu a protilátky ANTIGEN (Ag) specifická látka (struktura) vyvolávající imunitní reakci a schopná vazby na protilátku PROTILÁTKA (Ab antibody) molekula bílkoviny

Více

Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie

Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Leona Leišová Přírodovědecká fakulta UK, Praha 2009 Metody kvantifikace: Nepřímé metody odhad míry

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2 http://www.paternityexperts.com/basicgenetics.html

Více

Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip

Více

Mikrobiologické diagnostické metody. MUDr. Pavel Čermák, CSc.

Mikrobiologické diagnostické metody. MUDr. Pavel Čermák, CSc. Mikrobiologické diagnostické metody MUDr. Pavel Čermák, CSc. Princip identifikace soubor ZNAKŮ s rozdílnou separační hodnotou S HODNOTA S: S 1 S 2 S 3 Základní problémy Minimum morfologických znaků Podobná

Více

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336

STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 STAFYLOKOKOVÉ ENTEROTOXINY Zdravotní nezávadnost potravin Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 OBSAH: Základní charakteristika Staphylococcus aureus Stafylokokové enterotoxiny

Více

VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ

VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ Lucie Vištejnová 2, Jan Hodek 1, Patrik Sekerka 2, Jaroslava Ovesná 1, Kateřina Demnerová 2 1. Výzkumný ústav rostlinné výroby, Drnovská 507,

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi

Více

Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY ELEKTROFORÉZA K čemu to je? kritérium čistoty preparátu stanovení molekulové hmotnosti makromolekul stanovení izoelektrického

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní

Více

STUDIE GENOMON VÝSKYT GENETICKY MODIFIKOVANÝCH POTRAVIN V TRŽNÍ SÍTI V ČR V ROCE 2010. M. Mendlová, V. Ostrý, J. Ruprich

STUDIE GENOMON VÝSKYT GENETICKY MODIFIKOVANÝCH POTRAVIN V TRŽNÍ SÍTI V ČR V ROCE 2010. M. Mendlová, V. Ostrý, J. Ruprich STUDIE GENOMON VÝSKYT GENETICKY MODIFIKOVANÝCH POTRAVIN V TRŽNÍ SÍTI V ČR V ROCE 2010 M. Mendlová, V. Ostrý, J. Ruprich Státní zdravotní ústav v Praze Centrum zdraví, výživy a potravin Oddělení analýzy

Více

MIKROBIOLOGIE V BIOTECHNOLOGII

MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického

Více

Metody testování humorální imunity

Metody testování humorální imunity Metody testování humorální imunity Co je to humorální imunita? Humorální = látková Buněčné produkty Nespecifická imunita příklady:» Lysozym v slinách, slzách» Sérové proteiny (proteiny akutní fáze)» Komplementový

Více

Mikročipy v mikrobiologii

Mikročipy v mikrobiologii Mikročipy v mikrobiologii doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 Obsah přednášky 1) Charakteristika biočipů, DNA microarrays a DNA chip 2) Výroba čipů, charakteristika

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby

Více

Písemná zpráva zadavatele

Písemná zpráva zadavatele Písemná zpráva zadavatele veřejné zakázky zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, ve znění účinném ke dni zahájení zadávacího řízení (dále jen ZVZ ). Veřejná zakázka Název: Ostatní

Více

Organizace a kontrola pěstování GM plodin v ČR. Ing. Jana Trnková MZe, odbor rostlinných komodit

Organizace a kontrola pěstování GM plodin v ČR. Ing. Jana Trnková MZe, odbor rostlinných komodit Organizace a kontrola pěstování GM plodin v ČR Ing. Jana Trnková MZe, odbor rostlinných komodit Geneticky modifikované plodiny GM plodiny, transgenní rostliny změněn dědičný materiál (DNA) pomocí genových

Více

Geneticky modifikované potraviny a krmiva

Geneticky modifikované potraviny a krmiva Geneticky modifikované potraviny a krmiva Co je to geneticky modifikovaný organismus (GMO)? Za GMO je považován organismus, s výjimkou člověka, jehož dědičná informace uložená v DNA byla změněna pomocí

Více

Obsah. Sarkosin Charakterizace slepičích protilátek proti sarkosinu. Dagmar Uhlířová

Obsah. Sarkosin Charakterizace slepičích protilátek proti sarkosinu. Dagmar Uhlířová Investice do rozvoje vzdělávání Charakterizace slepičích protilátek proti sarkosinu Dagmar Uhlířová 7.2.2014 Reg.č.projektu: CZ.1.07/2.4.00/31.0023 NanoBioMetalNet Název projektu: Partnerská síť centra

Více

Diagnostické metody v analýze potravin. Matej Pospiech, FVHE Brno

Diagnostické metody v analýze potravin. Matej Pospiech, FVHE Brno Diagnostické metody v analýze potravin Matej Pospiech, FVHE Brno Důvody diagnostiky potravin Dodržování legislativních požadavků Vlastní kontrola v provozu Národní legislativa Evropská a mezinárodní legislativa

Více

Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,

Více

Metody studia genové exprese

Metody studia genové exprese Metody studia genové exprese Ing. Lucie Němcová, Ph.D. Laboratoř vývojové biologie nemcova@iapg.cas.cz Transkriptom Genová exprese: Geny jsou exprimovány tehdy, jsou-li přepsány do RNA (mrna). Rozdílná

Více

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.

Více

MIKROBIOLOGIE V BIOTECHNOLOGII

MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Termín biotechnologie byl poprvé použit v roce 1917 Procesy, při kterých se na tvorbě výsledného produktu podílejí živé organismy Širší definice: biotechnologie

Více

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Modifikace PCR, sekvenování Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Multiplex PCR Reakční směs obsahuje ne jeden, ale několik párů primerů rozpoznávajících různé cílové sekvence

Více

Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová

Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová Enterotoxiny Staphylococcus aureus Jana Kotschwarová Andrea Koťová Obsah Charakteristika Staphylococcus aureus Vlastnosti Faktory virulence Enterotoxiny Patogeneze Výskyt Metody stanovení Prevence výskytu

Více

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR)

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek

Více

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů

Více

Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi

Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Co je to vlastně ta fluorescence? Některé látky (fluorofory)

Více

Nové směry v rostlinných biotechnologiích

Nové směry v rostlinných biotechnologiích Nové směry v rostlinných biotechnologiích Tomáš Moravec Ústav Experimentální Botaniky AV ČR Praha 2015-05-07 Praha Prvních 30. let transgenních rostlin * V roce 2014 byly GM plodiny pěstovány na ploše

Více

METODY STUDIA PROTEINŮ

METODY STUDIA PROTEINŮ METODY STUDIA PROTEINŮ Mgr. Vlasta Němcová vlasta.furstova@tiscali.cz OBSAH PŘEDNÁŠKY 1) Stanovení koncentrace proteinu 2) Stanovení AMK sekvence proteinu Hmotnostní spektrometrie Edmanovo odbourávání

Více

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika

Více

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin

Více

Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace

Více

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky.

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální

Více

TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně

Více

Změny sazebníku výkonů pro mikrobiologické obory

Změny sazebníku výkonů pro mikrobiologické obory Změny sazebníku výkonů pro mikrobiologické obory Ing. Hana Hrbáčková LTK CEM SZÚ 2011 - Původní návrh MZ Grant Evropského fondu pro regionální rozvoj Vítěznou nabídku na řešení Kultivace Seznamu zdravotních

Více

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských

Více

Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202)

Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Popis Column DNA Lego Kit je základ moderní stavebnicové (Lego) soupravy pro izolaci čisté DNA různého

Více

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková Diagnostika retrovirů Lentiviry - HIV Vladislava Růžičková VI. Třída RNA-viry se zpětnou transkriptázou RT Čeleď: Retroviridae (hostitelé: Obratlovci) Rody: Alpharetrovirus Betaretrovirus Gammaretrovirus

Více

Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka

Více

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková Metody detekce a identifikace MO se zaměřením na PCR a její variace Kamila Zdeňková Metody detekce a identifikace MO rozdělení metod pro mikrobiologické zkoušení potravin přehled rychlých metod detekce

Více

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014 Molekulárně biologické metody v mikrobiologii Mgr. Martina Sittová Jaro 2014 Harmonogram 1. den Izolace DNA 2. den Měření koncentrace DNA spektrofotometricky, real-time PCR 3. den Elektroforéza Molekulární

Více

Nové metody v průtokové cytometrii. Vlas T., Holubová M., Lysák D., Panzner P.

Nové metody v průtokové cytometrii. Vlas T., Holubová M., Lysák D., Panzner P. Nové metody v průtokové cytometrii Vlas T., Holubová M., Lysák D., Panzner P. Průtoková cytometrie Analytická metoda využívající interakce částic a záření. Technika se vyvinula z počítačů částic Počítače

Více

Magnetické částice, izolace a detekce chřipky (hemaglutininu)

Magnetické částice, izolace a detekce chřipky (hemaglutininu) Název: Magnetické částice, izolace a detekce chřipky (hemaglutininu) Školitel: Ludmila Krejčová, MVDr. Datum: 7.11. 2013 Reg.č.projektu: CZ.1.07/2.4.00/31.0023 Název projektu: Partnerská síť centra excelentního

Více

IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek

IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek IZOLACE, SEPARACE A DETEKCE PROTEINŮ I Vlasta Němcová, Michael Jelínek, Jan Šrámek Studium aktinu, mikrofilamentární složky cytoskeletu pomocí dvou metod: detekce přímo v buňkách - fluorescenční barvení

Více

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci

Více

Antiparalelní beta list

Antiparalelní beta list Antiparalelní beta list Paralelní beta list Schematický model beta listu (stužkový) Proteiny obsahují zpětné kličky (beta kličky nebo vlásenkové ohyby). Obvykle je CO skupina i-té aminokyseliny vázána

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 5. Metody molekulární biologie II DNA footprinting hledání interakcí DNA s proteiny Polymerázová řetězová reakce (Polymerase chain reaction PCR) Malé

Více

Vybrané imunochemické metody

Vybrané imunochemické metody ÚSTAV LÉKAŘSKÉ BIOCHEMIE A LABORATORNÍ DIAGNOSTIKY 1. LF UK Vybrané imunochemické metody Praktické cvičení z lékařské biochemie Všeobecné lékařství Lenka Fialová 2013 Úloha 1 Imunoprecipitační křivka lidského

Více

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI INDUKOVANÉ PŮSOBENÍM ORGANICKÝCH LÁTEK Z PRACHOVÝCH ČÁSTIC V OVZDUŠÍ Kateřina Hanzalová Oddělení genetické ekotoxikologie Ústav experimentální medicíny AV ČR v.v.i.

Více

FLUORESCENČNÍ MIKROSKOP

FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po

Více

Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin

Více

Vizualizace DNA ETHIDIUM BROMID. fluorescenční barva interkalační činidlo. do gelu do pufru barvení po elfu SYBR GREEN

Vizualizace DNA ETHIDIUM BROMID. fluorescenční barva interkalační činidlo. do gelu do pufru barvení po elfu SYBR GREEN ETHIDIUM BROMID fluorescenční barva interkalační činidlo do gelu do pufru barvení po elfu Vizualizace DNA SYBR GREEN Barvení proteinů Coommassie Brilliant Blue Coomassie Blue x barvení stříbrem Porovnání

Více

První testový úkol aminokyseliny a jejich vlastnosti

První testový úkol aminokyseliny a jejich vlastnosti První testový úkol aminokyseliny a jejich vlastnosti Vysvětlete co znamená pojem α-aminokyselina Jaký je rozdíl mezi D a L řadou aminokyselin Kolik je základních stavebních aminokyselin a z čeho jsou odvozeny

Více

Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018

Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018 Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018 2.4 GENETICKÉ MANIPULACE in vitro - nekonvenční techniky, kterými lze modifikovat rostlinný

Více

DY D NE N X Hana Vlastníková

DY D NE N X Hana Vlastníková DYNEX Hana Vlastníková Molekulární biologie: Vybavení laboratoře na klíč Přístrojová technika Kompatibilní diagnostické soupravy Profesionální přístup SOP Technická podpora Servis Přístrojové vybavení:

Více

Typy molekul, látek a jejich vazeb v organismech

Typy molekul, látek a jejich vazeb v organismech Typy molekul, látek a jejich vazeb v organismech Typy molekul, látek a jejich vazeb v organismech Organismy se skládají z molekul rozličných látek Jednotlivé látky si organismus vytváří sám z jiných látek,

Více

1. Metodika. Protokol č. F1-4 Metodika: Srovnávací analýza efektivity přípravy rekombinantního proteinu ve fermentoru

1. Metodika. Protokol č. F1-4 Metodika: Srovnávací analýza efektivity přípravy rekombinantního proteinu ve fermentoru Protokol č.: F1-4 Datum: 20.12.2010 Metodika: analýza efektivity přípravy výběr z výsledků ze zkušebních provozů výroby antigenů. Vypracoval: Ing. Václav Filištein, Mgr. Tereza Chrudimská, Spolupracující

Více

Microfluidic systems, advantages and applications Monika Kremplová, Mgr.

Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Název: Školitel: Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Datum: 21. 6. 2013 Reg.č.projektu: CZ.1.07/2.3.00/20.0148 Název projektu: Mezinárodní spolupráce v oblasti "in

Více

KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR)

KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) Metoda Real-time PCR slouží pro kvantifikaci DNA a transkripce. Metoda je založena na klasické PCR, ovšem s využitím speciálního cycleru, který v průběhu PCR

Více

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou

Více

Chemické senzory Principy senzorů Elektrochemické senzory Gravimetrické senzory Teplotní senzory Optické senzory Fluorescenční senzory Gravimetrické chemické senzory senzory - ovlivňov ování tuhosti pevného

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza Exprese genetického kódu Centrální dogma molekulární biologie - genetická informace v DNA -> RNA -> primárního řetězce proteinu 1) transkripce - přepis z DNA do mrna 2) translace - přeložení z kódu nukleových

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Metody testování humorální imunity

Metody testování humorální imunity Metody testování humorální imunity Co je to humorální imunita? Humorální = látková Buněčné produkty Nespecifická imunita příklady:» Lysozym v slinách, slzách» Sérové proteiny (proteiny akutní fáze)» Komplementový

Více

Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Příprava rekombinantních molekul pro diagnostické účely

Příprava rekombinantních molekul pro diagnostické účely 1 Příprava rekombinantních molekul pro diagnostické účely doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 2 Obsah přednášky 1) Pojem rekombinantní DNA 2) Historické milníky

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

Moderní nástroje pro zobrazování biologicky významných molekul pro zajištění zdraví. René Kizek

Moderní nástroje pro zobrazování biologicky významných molekul pro zajištění zdraví. René Kizek Moderní nástroje pro zobrazování biologicky významných molekul pro zajištění zdraví René Kizek 12.04.2013 Fluorescence je fyzikálně chemický děj, který je typem luminiscence. Luminiscence se dále dělí

Více

Precipitační a aglutinační reakce

Precipitační a aglutinační reakce Základy imunologických metod: Precipitační a aglutinační reakce Ústav imunologie 2.LF UK a FN Motol Metody, ve kterých se používají protilátky Neznačený antigen/protilátka Precipitace Aglutinace Značený

Více

7. Regulace genové exprese, diferenciace buněk a epigenetika

7. Regulace genové exprese, diferenciace buněk a epigenetika 7. Regulace genové exprese, diferenciace buněk a epigenetika Aby mohl mnohobuněčný organismus efektivně fungovat, je třeba, aby se jednotlivé buňky specializovaly na určité funkce. Nový jedinec přitom

Více

In vitro testování scaffoldů pro tkáňové inženýrství. Mgr. Jana Horáková

In vitro testování scaffoldů pro tkáňové inženýrství. Mgr. Jana Horáková In vitro testování scaffoldů pro tkáňové inženýrství Mgr. Jana Horáková 9.12.2015 Proces tkáňového inženýrství 1. Návrh nosiče Seznámení se s problematikou dané tkáně/orgánu Návrh nosiče pro danou aplikaci

Více

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,

Více

Western blotting. 10% APS 20,28 µl 40,56 µl 81,12 µl 20,28 µl 40,56 µl 81,12 µl

Western blotting. 10% APS 20,28 µl 40,56 µl 81,12 µl 20,28 µl 40,56 µl 81,12 µl Western blotting 1. Příprava gelu složení aparatury hustotu gelu volit podle velikosti proteinů příprava rozdělovacího gelu: 10% 12% počet gelů 1 2 4 1 2 4 objem 6 ml 12 ml 24 ml 6 ml 12 ml 24 ml 40% akrylamid

Více

Principy a instrumentace

Principy a instrumentace Průtoková cytometrie Principy a instrumentace Ing. Antonín Hlaváček Úvod Průtoková cytometrie je moderní laboratorní metoda měření a analýza fyzikálních -chemických vlastností buňky během průchodu laserovým

Více

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)

Více

Biochemická laboratoř

Biochemická laboratoř Biochemická laboratoř školní rok 2013/14 Ing. Jarmila Krotká 3. LF UK, Klinická biochemie, bakalářské studium Hlavní úkol biochemické laboratoře Na základě požadavku lékaře vydat co nejdříve správný výsledek

Více

LABORATOŘ OBORU I. Příprava diagnostického testu na bázi lateral flow immunoassay ÚSTAV ORGANICKÉ TECHNOLOGIE (111)

LABORATOŘ OBORU I. Příprava diagnostického testu na bázi lateral flow immunoassay ÚSTAV ORGANICKÉ TECHNOLOGIE (111) LABORATOŘ OBORU I ÚSTAV ORGANICKÉ TECHNOLOGIE (111) C Příprava diagnostického testu na bázi lateral flow immunoassay Vedoucí práce: Ing. Aram Zolal Ing. Lukáš Filip Umístění práce: laboratoř S58 1. Úvod

Více