Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Rozměr: px
Začít zobrazení ze stránky:

Download "Polymorfizmy detekované. polymorfizmů (Single Nucleotide"


1 Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs)

2 Příklad jednonukleotidových polymorfizmů Krevní skupina A B C G T G G T G A C C C C T T C G T C G T C A C C G C T A 0 C G T G G T - A C C C C T T Příklady běžných chorob detekovatelných pomocí SNPs Parkinsonova choroba Alzheimerova choroba Diabetes typu II Crohnova choroba Obezita

3 Schematické znázornění metod s vysokou rozlišovací schopností pro identifikaci polymorfizmů v genomech

4 Přehled základních metod Enzymatické Ligázová řetězová reakce Ligace prostřednictvím RCA AFLP Sangerovo sekvencování Pyrosekvencování CFLP Kleaváza + vetřelec Konformační SSCP ddf DGGE DCSA Hybridizační Oligonukleotidové čipy Sekvencování hybridizací Kvantitativí PCR s fluorescenčními hybridizačními sondami PNA-sondy Fluorescenční výměny Molekulární majáky FRET Fluorescenční polarizace Hmotnostní spektrometrie

5 Polymorfizmy detekované speciálními elektroforetickými metodami Odhalení lokálních polymorfizmů v DNA je závislé na použití speciálních elektroforetických Krátké fragmenty DNA o konstantní délce Elektroforetické separace v závislosti na jejich odlišné sekvenci Elektroforéza se obvykle provádí v polyakrylamidových gelech Metody jsou vhodné zejména pro srovnání polymorfizmu na úrovni genů, aniž by bylo nutné stanovovat přímo jejich sekvenci. Úseky DNA s vhodnou velikostí ( bp) se pro analýzy připravují: 1. Klonováním 2. Restrikčním štěpením 3. Polymerázovou řetězovou reakcí (PCR) Výsledky mohou být ovlivněny hustotou a síťováním polyakrylamidového gelu teplotou gelu obsahem přídatných chemických látek v gelu délkou analyzovaného fragmentu lokalizací rozdílných sekvencí na analyzovaných fragmentech

6 Konformační polymorfizmus jednořetězců (Single-Strand Conformation Polymorphism - SSCP) SSCP analýza se obvykle používá pro detekci sekvenčních rozdílů mezi různými alelami téhož genu Metoda je vhodná pro sledování změn (mutací) na krátkých fragmentech DNA o velikosti bp Metoda využívá vytváření rozdílné sekvenčně specifické intramolekulární struktury ssdna ovlivňující rychlost pohybu při nedenaturujících elektroforetických podmínkách U delších fragmentů se snižuje diskriminační účinnost a reprodukovatelnost

7 Princip metody SSCP zvýšení účinnosti SSCP se dosahuje různými modifikacemi: RFLP-SSCP přístup kombinující štěpení DNA restriktázami s následnou SSCP vzdálenost polymorfizmu od konce fragmentu Vazbou různých látek ovlivňujících elektroforetickou mobilitu ssdna RNA-SSCP (je nutno připravit ssrna transkripcí pomocí T7- nebo SP6-RNA polymerázy) SSCP je vhodná pro analýzu mutací v SSCP je vhodná pro analýzu mutací v prokaryotických (rdna), eukaryotických a virových genomech Homozygotní DNA vytváří 2 elektroforetické formy Heterozygotní DNA obsahující sekvence dvou různých alel vytváří 4 elektroforetické formy

8 Dideoxy fingerprinting (ddf-sscp) Hybridní diagnostická metoda využívající dva metodické přístupy: Sangerovo sekvencování, reakce je na rozdíl od klasického sekvencování prováděna pouze s jedním dideoxy terminátorem. SSCP Používá se zejména k detekci mutací u eukaryotických genů. Mutace jsou detekovány jako výsledek ztráty nebo Mutace jsou detekovány jako výsledek ztráty nebo získání dideoxy-terminačního segmentu nebo na základě rozdílné elektroforetické mobility u alespoň jednoho z dideoxy-terminačních segmentů.

9 Princip ddf

10 Denaturační gradientová gelová elektroforéza (Denaturating Gradient Gel Electrophoresis - DGGE) Metoda využívá rozdílné elektroforetické mobility u částečně denaturované DNA a DNA v nedenaturovaném stavu Vzorky o velikosti bp se analyzují v polyakrylamidovém gelu s denaturačním gradientem zajištěným postupně vzrůstající teplotou (TGGE) vzrůstající koncentrací denaturačního činidla formamidu močoviny dsdna se pohybuje během elektroforézy v závislosti na její velikosti a pozvolně denaturuje na začátku elektroforézy není patrný žádný rozdíl v elektroforetické mobilitě po určité době denaturace ovlivní rychlost elektroforetické migrace (zpomalení vzhledem k dsdna) elektroforéza sama umožní odlišit sekvenční polymorfizmus na základě odlišné hodnoty Tm srovnávaných vzorků Zvýšení rozlišovací schopnosti dosáhneme připojením GC-svorek na konce analyzovaných fragmentů zamezíme tím úplné denaturaci až do jednořetězcových forem a zvýšíme provedením 2-D (dvojrozměrné) DGGE

11 DGGE je vhodná pro analýzu mutací v eukaryotických genech diagnostiku dědičných chorob analýzu mutací v prokaryotických genech charakterizaci bakteriálních populací na základě DGGE 16S rdna 1D 2D TGGE

12 Sekvenčně specifická elektroforéza zprostředkovaná vmezeření barviv do DNA Zřídka používaná metoda ke stanovení sekvenčních rozdílů v dsdna fragmentech do velikosti 1500 bp využívá vazbu bis-benzimidu (H33342) na AT páry Elektroforéza se provádí v agarózových gelech s bisbenzimid-polyetylen glykolem Princip metody Princip metody a) vazba bis-benzimidu na AT bohaté fragmenty DNA b) následné zpomalení elektroforetické mobility dlouhými molekulami polyetylenglykolu u DNA fragmentů bohatých na AT

13 Analýza konformace dvouřetězcové DNA (Double Strand Conformation Analysis - DSCA) Diagnostická metoda, která využívá rozdílných ohybů v dsdna (double strand conformation polymorphism - DSCP) ovlivňujících elektroforetickou pohyblivost při nedenaturujících elektroforetických podmínkách v polyakrylamidovém gelu a umožňuje tak rozlišit DNA-řetězce s různou sekvencí. Metoda využívá předpokladu, že dsdna ve vodném roztoku zaujímá složitou konformaci s vnitřním zakřivením, které závisí na nukleotidové sekvenci Zakřivení DNA se může přímo vztahovat ke tření, které fragment dsdna překonává při elektroforéze v porézních gelech Substituce páru bází v kritickém místě dsdna fragmentu vede ke změně vinutí a může zásadně ovlivnit elektroforetickou mobilitu během nedenaturační polyakrylamidové gelové elektroforézy s vysokou rozlišovací schopností Využívá se k detekci bodových mutací v eukaryotických genech (fragmenty o délce bp)

14 Heteroduplexní analýza, analýza pohyblivosti heteroduplexů (Heteroduplex Mobility Assay HMA) Diagnostická metoda, která využívá rozdílné elektroforetické pohyblivosti heteroduplexů. Používá se k lokalizaci a detekci bodových mutací v eukaryotických a virových genomech. homoduplex (homoduplex). Hybridní molekula DNA, jejíž řetězce se vyznačují úplnou komplementaritou. heteroduplex (heteroduplex). Hybridní molekula DNA vyznačující se neúplnou komplementaritou.

15 Analýza elektroforetické pohyblivosti heteroduplexů

16 Polymorfizmus délky fragmentů vytvořených štěpením enzymem Cleavase (Cleavase Fragment Length Polymorphisms - CFLP) Diagnostická metoda, která využívá enzymu kleavázy k detekci a lokalizaci polymorfizmů v jednořetězcové DNA Optimální velikost fragmentů pro tuto analýzu je do 2700 bp. ssdna vytváří různé sekundární struktury (vlásenky, vlásenky se smyčkou, křížové struktury) v závislosti na primární struktuře. Cleavase je specifická endonukleáza, jejíž cílové místo se nachází vždy u paty vytvořené vlásenky na molekule ssdna. Enzym nepůsobí na všechny vlásenky (pravděpodobně v závislosti na dalších faktorech ovlivněných strukturou ssdna). Mutace (bodové, delece, inzerce) a modifikace v nukleotidových sekvencích ovlivňují sekundární strukturu ssdna a konečným výsledkem se vytvoření rozdílných míst rozpoznávaných enzymem.

17 CFLP Po stěpení enzymem Cleavase vzniká spektrum fragmentů charakteristické pro danou molekulu Separaci fragmentů provádíme na krátkém denaturačním polyakrylamidovém gelu Metoda CFLP je metodou porovnávající tvorbu vlásenek v jednotlivých jednořetězcích, ale z obecného hlediska je polymorfizmus CFLP analogický s RFLP. Metoda byla použita na odlišení bakteriálních patogenů detekci mutací u rychle mutujících virů detekci mutací v genech pro rezistenci u bakterií detekci mutací v eukaryotických genech (např. gen pro p53)

18 Schematický postup CFLP 1. Příprava koncově značené dsdna (na obrázku je znázorněno *) 2. Teplotní denaturace DNA 3. Ochlazení DNA a vytvoření vlásenek 4. Štěpení Cleavase I (na obrázku znázorněno ) 5. Elektroforéza v denaturačním polyakrylamidovém gelu (pouze koncově značené DNA jsou detekovány) polymorfizmu CFLP u 16S rdna různých bakteriálních druhů

19 Vetřelec (Invader ) Dva oligonukleotidy jako hybridizační sondy: 1. Invader 2. Primární signální sonda Může nést fluorescenční značku Komplex ve tvaru klapky: Signální sonda hybridizuje k cílové molekule DNA blíže k jejímu 5 - konci Invader naruší tento komplex proti směru a vytěsní 1 bázi Kleaváza: Rozpozná vzniklou sekundární strukturu a rozštěpí klapku v pozici 5 -ramene + 1 báze ze signální sondy signální sondy Detekce: Na základě vzniku fluorescence metodou FRET Pomocí hmotnostní spektrometrie SNP

20 Test rezistence k RNáze (RNase protection analysis) Diagnostická metoda používaná k detekci a lokalizaci bodových mutací v RNA. Používá se RNáza A, která štěpí úseky ssrna, kde nedošlo k vazbě 32 P značené sondy připravené ze standardního genu. Touto metodou lze detekovat ~ 50% bodových mutací. Využívá se zejména u rychle mutujících RNA-virů

21 DNA čipy pro hybridizační analýzu DNA čipy slouží k paralelnímu provádění DNA hybridizace testované DNA s velkým počtem (desetitisíce) sond. Jejich hlavní aplikací je vyhledávání polymorfizmů, např. SNP, nebo srovnávání vzorků RNA izolovaných z různých buněk. DNA čip je malá destička nesoucí velký počet sond DNA, které se vzájemně liší svou nukleotidovou sekvencí a na čipu jsou umístěny v definovaných polohách. Sondy jsou synteticky připravené oligonukleotidy přímo na povrchu čipu Krátké molekuly DNA nanášené s použitím robotických systémů na skleněný či nylonový povrch matrice array cdna PCR produkty U prvních používaných DNA čipů byly sondy DNA nakapány na povrch mikroskopického sklíčka nebo na nylonovou membránu za vzniku uspořádaného seskupení 6400 (80x80) sond na ploše 18x18 mm.

22 Novější technologie přípravy DNA čipů využívají fotolitografii Umožnuje syntetizovat sondy s různou sekvencí přímo na povrchu čipu a dosáhnout tak na stejné ploše podstatně vyšší hustoty sond (až milion oligonukleotidů na cm 2 ). Při vyhledávání SNP je tak možné v jediném pokuse prověřit až půl milionu polymorfismů za předpokladu, že jsou k dispozici oligonukleotidy pro obě alely každého SNP. Prakticky se při práci s DNA čipy postupuje tak, že je čip inkubován se značenou cílovou DNA za podmínek, umožňujících hybridizaci k sondě. Poloha oligonukleotidové sondy, k níž se hybridizuje testovaná DNA, se stanoví detekováním emitované fluorescence na povrchu čipu pomocí konfokálního mikroskopu nebo laserového detektoru.

23 Stanovení SNP pomocí DNA čipu 1. Varianta Prodloužení primeru vázaného na čipu Jeden primer pro každý SNP, který genotypizujeme je imobilizován na sklíčku. K čipu jsou přidány multiplex PCR produkty, 3 fluorescenčně značené ddntps a DNA-polymeráza. Proběhne prodloužení primeru o jeden ddntp a výsledek reakce je vyhodnocen. Pozice primeru na čipu definuje, který SNP analyzujeme a fluorescence nukleotidu určuje genotyp příslušného SNP.

24 Stanovení SNP pomocí DNA čipu 2. Varianta Alelově specifické prodloužení primeru Na sklíčku jsou imobilizovány dva alelově-specifické primery s bází na 3 -konci komplementární k oběma možným variantám nukleotidů v každém SNP. Produkty multiplex PCR jsou přepsány do mnoha kopií RNA pomocí RNApolymerázy. Molekuly RNA hybridizují k čipu a slouží jako templát pro prodloužení primeru, které je katalyzované pomocí zpětné transkriptázy Během zpětné transkripce jsou do každého produktu začleněny fluorescenčně značené dntp. Pro homozygotní genotypy je signál tvořený pouze jedním ze dvou alelověspecifických primerů kdežto u heterozygotních genotypů je signál tvořený oběma primery.

25 Stanovení SNP pomocí DNA čipu - minisekvencování 3. Varianta Prodloužení primerů nesoucích specifickou sekvenci na 5 -konci Cyklické prodloužení primeru o jeden dideoxynukleotid je prováděno s denaturovanou DNA v roztoku za přítomnosti fluorescenčně značených ddntps, DNA-polymerázy primerů nesoucích na 5 -konci přídatnou sekvenci (tag). DNA-čip, který je komplementární k přídatným sekvencím primerů (tag array) je potom použit pro zachycení produktů cyklické minisekvenační reakce.

26 Stanovení SNP pomocí DNA čipu - RCA (Rolling Circle Amplification) Metoda pracuje na principu amplifikace signálu na DNA-čipu Studovaná cílová molekula DNA je denaturována Při hybridizaci k cílové sekvenci ligáza katalyzuje spojení dvou oligonukleotidových sond z nichž jedna je imobilizovaná na pevném podkladu čipu Ligace nastane pouze tehdy jestliže je 5 báze v místě SNP přesně komplementární k cílové DNA (je 500 efektivnější než při nehomologickém páru) Rozdíly v sekvenci na 5 -konci poskytují možnost specificky a simultánně detekovat jednotlivé varianty SNP φ29 DNA-polymeráza katalyzuje izotermní replikaci formou otáčivé kružnice, inkorporuje značené nukleotidy a rostoucí řetězec je vytěsňován

27 RCA v homogenním roztoku Ligáza katalyzuje ligaci sondy ve formě otevžené kružnice, která přesně svými 3 - a 5 -konci hybridizuje k místu se SNP Hybridizace náhodných hexanukleotidů Replikace otáčivou kružnicí pomocí DNA-polymerázy fága 29 Vznikme až 10 9 kopií sekvence Rca.swf

28 Alelově specifické ologonukleotidy (ASO) Identifikace PCR-produktů Rutinně lze provádět obrácenou tečkovou hybridizací:

Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip


Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání





Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání


Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní


Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje


Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární


Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp.

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp. BIOLOGICKÉ LISTY 68 (3): 207-211, 2003 Způsoby detekce polymorfismu homologních DNA a jejich využití při studiu změn ve struktuře rodičovských genomů u modelových allotetraploidních druhů rodu Nicotiana



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní


Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit


2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících


Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi


Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava


Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková Diagnostika retrovirů Lentiviry - HIV Vladislava Růžičková VI. Třída RNA-viry se zpětnou transkriptázou RT Čeleď: Retroviridae (hostitelé: Obratlovci) Rody: Alpharetrovirus Betaretrovirus Gammaretrovirus


Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor


Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní


Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:


ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)


Enzymy používané v molekulární biologii

Enzymy používané v molekulární biologii Enzymy používané v molekulární biologii Rozdělení enzymů 1. Podle substrátové specifity: většina metod molekulární biologie je závislá na použití enzymů, jejichž substrátem jsou nukleové kyseliny. Tyto


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní


Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika


MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční



Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální


Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Modifikace PCR, sekvenování Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Multiplex PCR Reakční směs obsahuje ne jeden, ale několik párů primerů rozpoznávajících různé cílové sekvence


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Izolace nukleových kyselin

Izolace nukleových kyselin Izolace nukleových kyselin Požadavky na izolaci nukleových kyselin V nativním stavu z přirozeného materiálu v dostatečném množství požadované čistotě. Nukleové kyseliny je třeba zbavit všech látek, které


Microfluidic systems, advantages and applications Monika Kremplová, Mgr.

Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Název: Školitel: Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Datum: 21. 6. 2013 Reg.č.projektu: CZ.1.07/2.3.00/20.0148 Název projektu: Mezinárodní spolupráce v oblasti "in



POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin






ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN Fragmenty nukleových kyselin lze dle jejich velikosti rozdělit elektroforézou. Elektroforéza využívá rozdílné pohyblivosti jednotlivých fragmentů, danou právě


Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right


Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika


Elektroforéza nukleových kyselin. Molekulární biologie v hygieně potravin 2, 2014/15, Ivo Papoušek

Elektroforéza nukleových kyselin. Molekulární biologie v hygieně potravin 2, 2014/15, Ivo Papoušek Elektroforéza nukleových kyselin Molekulární biologie v hygieně potravin 2, 2014/15, Ivo Papoušek Elektroforéza Patří mezi nejpoužívanější separační techniky při izolaci a analýze nukleových kyselin (X





Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk


Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,


Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace


Elektroforéza nukleových kyselin

Elektroforéza nukleových kyselin Elektroforéza nukleových kyselin Elektroforéza nukleových kyselin je založena na tom, že NK jsou v neutrálním nebo zásaditém prostředí polyanionty. Protože se zvyšujícím se počtem nukleotidů v molekule


Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray


Genetické markery - princip a využití

Genetické markery - princip a využití Genetika a šlechtění lesních dřevin Genetické markery - princip a využití Doc. Ing. RNDr. Eva Palátová, PhD. Ing. R. Longauer, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován


Metody studia exprese mrna. jádro a genová exprese 2007

Metody studia exprese mrna. jádro a genová exprese 2007 Metody studia exprese mrna Buněčné jádro a genová exprese 2007 Aktivita genu je primárn ě vyjád ř ena jeho transkripcí-prvním krokem vedoucím k syntéze kódovaného proteinu. Cíle metod Ur č ení mno ž ství


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY ELEKTROFORÉZA K čemu to je? kritérium čistoty preparátu stanovení molekulové hmotnosti makromolekul stanovení izoelektrického


Příprava rekombinantních molekul pro diagnostické účely

Příprava rekombinantních molekul pro diagnostické účely 1 Příprava rekombinantních molekul pro diagnostické účely doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 2 Obsah přednášky 1) Pojem rekombinantní DNA 2) Historické milníky



DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby


Environmentální aplikace molekulární biologie

Environmentální aplikace molekulární biologie Environmentální aplikace molekulární biologie Petra Jančová, Kristýna Maršálková, Jana Šerá, Hana Pištěková Ústav Inženýrství Ochrany Životního Prostředí, Fakulta Technologická, Univerzita Tomáše Bati


Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA



MOLEKULÁRNÍ TAXONOMIE - 4 MOLEKULÁRNÍ TAXONOMIE - 4 V této přednášce si představíme metody, které získávají molekulární znaky bez použití sekvenace. Všechny tyto metody je teoreticky možné sekvenací nahradit. Oproti sekvenaci celých


Vícefunkční chemické a biochemické mikrosystémy Strana 1. Mikrofluidní bioaplikace

Vícefunkční chemické a biochemické mikrosystémy Strana 1. Mikrofluidní bioaplikace Vícefunkční chemické a biochemické mikrosystémy Strana 1 Mikrofluidní bioaplikace Vícefunkční chemické a biochemické mikrosystémy Strana 2 Mikrofluidní aplikace pro bioanalýzu Transport, dávkování, promíchávání


Pulzní gelová elektroforéza Při konvenční gelové elektroforéze je rozdělení molekul je podmíněno rychlejším průchodem menších molekul pórovitou

Pulzní gelová elektroforéza Při konvenční gelové elektroforéze je rozdělení molekul je podmíněno rychlejším průchodem menších molekul pórovitou Pulzní gelová elektroforéza Při konvenční gelové elektroforéze je rozdělení molekul je podmíněno rychlejším průchodem menších molekul pórovitou strukturou gelové matrice. Tento princip separace se uplatňuje



ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce





J09 Průkaz nukleové kyseliny

J09 Průkaz nukleové kyseliny J09 Průkaz nukleové kyseliny VLLM0421c (jaro 2016) Osnova využití a metody průkazu NK PCR a její modifikace proces prokazování specifické sekvence NK 2/55 Přímé vs. nepřímé metody přímé hledáme mikroba,


První testový úkol aminokyseliny a jejich vlastnosti

První testový úkol aminokyseliny a jejich vlastnosti První testový úkol aminokyseliny a jejich vlastnosti Vysvětlete co znamená pojem α-aminokyselina Jaký je rozdíl mezi D a L řadou aminokyselin Kolik je základních stavebních aminokyselin a z čeho jsou odvozeny


Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace



ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů


Elektroforéza Sekvenování

Elektroforéza Sekvenování Elektroforéza Sekvenování Výsledek PCR Elektroforéza V molekulární biologii se používá k separaci nukleových kyselin a bílkovin Principem je pohyb nabitých molekul v elektrickém poli Gelová, polyakrylamidová


Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních


Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování


2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou


TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně


Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna

Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna Obsah přednášky 1) Klonování složených eukaryotických genů 2) Úprava rekombinantních genů 3) Produkce rekombinantních proteinů v expresních systémech 4) Promotory 5) Vektory 6) Reportérové geny Zdrojem


Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka



VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ Lucie Vištejnová 2, Jan Hodek 1, Patrik Sekerka 2, Jaroslava Ovesná 1, Kateřina Demnerová 2 1. Výzkumný ústav rostlinné výroby, Drnovská 507,


Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie

Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Leona Leišová Přírodovědecká fakulta UK, Praha 2009 Metody kvantifikace: Nepřímé metody odhad míry


Metody testování humorální imunity

Metody testování humorální imunity Metody testování humorální imunity Co je to humorální imunita? Humorální = látková Buněčné produkty Nespecifická imunita příklady:» Lysozym v slinách, slzách» Sérové proteiny (proteiny akutní fáze)» Komplementový


Molekulární metody ve studiích kořenových systémů. Jiří Košnar, 2016

Molekulární metody ve studiích kořenových systémů. Jiří Košnar, 2016 Molekulární metody ve studiích kořenových systémů Jiří Košnar, 2016 Úvod Řešení otázek: identifikace (barcoding) a kvantifikace rostlinných druhů ve společenstvu identifikace (barcoding) a kvantifikace


OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases



REPLIKACE A REPARACE DNA REPLIKACE A REPARACE DNA 1 VÝZNAM REPARACE DNA V MEDICÍNĚ Příklad: Reparace DNA: enzymy reparace nukleotidovou excizí Onemocnění: xeroderma pigmentosum 2 3 REPLIKACE A REPARACE DNA: Replikace DNA: 1. Podstata


Genotypování markerů užitkovosti a zdraví u skotu

Genotypování markerů užitkovosti a zdraví u skotu Mezinárodní odborný seminář Využití chovatelských dat onemocnění skotu pro management stád, šlechtění a pro racionální užívání antimikrobik. Genotypování markerů užitkovosti a zdraví u skotu Jitka Kyseľová



REKOMBINACE Přestavby DNA REKOMBINACE Přestavby DNA variace v kombinacích genů v genomu adaptace evoluce 1. Obecná rekombinace ( General recombination ) Genetická výměna mezi jakýmkoli párem homologních DNA sekvencí - často lokalizovaných


DY D NE N X Hana Vlastníková

DY D NE N X Hana Vlastníková DYNEX Hana Vlastníková Molekulární biologie: Vybavení laboratoře na klíč Přístrojová technika Kompatibilní diagnostické soupravy Profesionální přístup SOP Technická podpora Servis Přístrojové vybavení:


STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336

STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 STAFYLOKOKOVÉ ENTEROTOXINY Zdravotní nezávadnost potravin Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 OBSAH: Základní charakteristika Staphylococcus aureus Stafylokokové enterotoxiny


Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2 http://www.paternityexperts.com/basicgenetics.html


Klonování gen a genové inženýrství

Klonování gen a genové inženýrství Klonování gen a genové inženýrství Genové inženýrství užite né termíny Rekombinantní DNA = DNA, ve které se nachází geny nejmén ze dvou zdroj, asto ze dvou zných druh organism Biotechnologie = manipulace


Globální pohled na průběh replikace dsdna

Globální pohled na průběh replikace dsdna Globální pohled na průběh replikace dsdna 3' 5 3 vedoucí řetězec 5 3 prodlužování vedoucího řetězce (polymerace ) DNA-ligáza směr pohybu enzymů DNA-polymeráza I DNA-polymeráza III primozom 5' 3, 5, hotový


Sekvenování příští generace (Next Generation Sequencing, NGS)

Sekvenování příští generace (Next Generation Sequencing, NGS) Sekvenování příští generace (Next Generation Sequencing, NGS) Přednáška 6, 2013/14 Ivo Papoušek Next generation sequencing poptávka po nízkonákladovém sekvenování vyvolala tlak na vývoj high-throughput


Mikrobiologické diagnostické metody. MUDr. Pavel Čermák, CSc.

Mikrobiologické diagnostické metody. MUDr. Pavel Čermák, CSc. Mikrobiologické diagnostické metody MUDr. Pavel Čermák, CSc. Princip identifikace soubor ZNAKŮ s rozdílnou separační hodnotou S HODNOTA S: S 1 S 2 S 3 Základní problémy Minimum morfologických znaků Podobná


Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí,

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí, Využití molekulárních markerů v systematice a populační biologii rostlin 12. Shrnutí, Přehled molekulárních markerů 1. proteiny isozymy 2. DNA markery RFLP (Restriction Fragment Length Polymorphism) založené


Mikročipy v mikrobiologii

Mikročipy v mikrobiologii Mikročipy v mikrobiologii doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 Obsah přednášky 1) Charakteristika biočipů, DNA microarrays a DNA chip 2) Výroba čipů, charakteristika


TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Přehled Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymerasa Princip procesu PCR Optimalizace PCR Typy PCR Aplikace


Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK Richard Prùša Richard Prùša Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK . Základy analytických metod v klinické molekulární biologii Richard Prùša Praha 1997 Základy analytických metod


Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD

Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD Dana Vejmelková, Milan Šída, Kateřina Jarošová, Jana Říhová Ambrožová VODÁRENSKÁ BIOLOGIE, 1. 2. 2017 ÚVOD Sledované parametry,


Single nucleotide polymorphisms (SNPs)

Single nucleotide polymorphisms (SNPs) Single nucleotide polymorphisms (SNPs) A/A G/G Single nucleotide polymorphisms (SNPs) SNPs : nuclear genome (consensus) Proč nestačí jednoduše osekvenovat mtdna? Introgrese mtdna Myotis myotis - Evropa


Vizualizace DNA ETHIDIUM BROMID. fluorescenční barva interkalační činidlo. do gelu do pufru barvení po elfu SYBR GREEN

Vizualizace DNA ETHIDIUM BROMID. fluorescenční barva interkalační činidlo. do gelu do pufru barvení po elfu SYBR GREEN ETHIDIUM BROMID fluorescenční barva interkalační činidlo do gelu do pufru barvení po elfu Vizualizace DNA SYBR GREEN Barvení proteinů Coommassie Brilliant Blue Coomassie Blue x barvení stříbrem Porovnání


Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace Genetické markery Genetické markery


V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)


Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění


Nukleové kyseliny Replikace DNA Doc. MVDr. Eva Bártová, Ph.D.

Nukleové kyseliny Replikace DNA Doc. MVDr. Eva Bártová, Ph.D. Nukleové kyseliny Replikace DNA 2013 Doc. MVDr. Eva Bártová, Ph.D. Nukleové kyseliny 7% cytozin Monomer: NUKLEOTID, tvoří jej: uracil kyselina fosforečná pentóza (ribóza, deoxyribóza) tymin organická dusíkatá


Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin Část Molekulární biologie a imunologie 6. Základy dědičnosti Mendelovská dědičnost (autozomálně recesivní, autozomálně dominantní a X-vázaný přenos mutací). Nemendelovská dědičnost (uniparentální disomie,


4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902
