Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:



1 Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální ph 12< (renaturace) + DN (denaturace) chromosomální DN + buněčné zbytky membrána supernatant bakteriálního lyzátu vazba DN promývání eluce DN čistá plasmidová DN RESTRIKČNÍ ŠTĚPENÍ GELOVÁ ELEKTROFORÉZ restrikční místo neštěpený vzorek štěpený vzorek OC L štěpení DN CCC restrikčním enzymem

2 Příprava inzertu IZOLCE ROSTLINNÉ DN PCR amplifikace DN 5 primer F DN lokus 3 3 primer R 5 lyze Taq polymeráza homogenizace denaturace C annealing C extenze 72 C dsdn primer F DN lokus primer R kolonková izolace DN PCR produkt (dsdn) IZOLCE MPLIKONU Z GELU separace amplikonů: gelová elektroforéza vyříznutí vybraného amplikonu z gelu kolonková izolace DN

3 T klonování a transformace bakterií LIGCE T klonování TRNSFORMCE TEPELNÝM ŠOKEM fragment DN E. coli ligáza/ topoizomeráza I lacz gen molekula CaCl 2 + teplotní šok rekombinantní 4 C/5 min. vektor DN 42 C/30 s 4 C/2 min. gen antibiotické rezistence Ca 2+ Ca 2+ Ca 2+ Ca 2+ transport plasmidu do hostitelské buňky neúspěšná transformace transformace plasmidu s inzertem transformace plasmidu bez inzertu selekce buněk: detekce inzertu růst v přítomnosti antibiotika na základě modrobílého testu

4 Modrobílý test () Vektor bez vloženého inzertu klonovací místo (MCS = multiple cloning site) promotor operátor lacz další geny kultivace na LB médiu s ampicilinem, Xgal, IPTG RNpolymeráza represor mrn βgalaktosidáza IPTG XGal buňky s plasmidem bez inzertu (B) Vektor s vloženým inzertem klonovací místo narušení exprese βgalaktosidázy promotor operátor lacz další geny RNpolymeráza represor vložený inzert buňky s plasmidem s inzertem mrn βgalaktosidáza IPTG XGal inzert, který nenarušuje čtecí rámec

5 Imunodetekce proteinů PŘÍPRV VZORKU redukční činidlo (např. βmerkaptoethanol, HS SS dithiotreitol) SH lyze SDS buňky, tkáně tepelná denaturace v přítomnosti SDS TRNSFER PROTEINŮ SDSPGE IMUNODETEKCE N MEMBRÁNU enzym primární protilátka rozeznává protein filtrační papír rozdělené proteiny gel membrána enzymem značená sekundární protilátka substrát filtrační papír rozeznává primární protilátku produkt chemiluminiscence

6 Příprava rekombinantního proteinu příprava vektoru příprava inzertu E. coli restrikční endonukleáza izolace vektoru vektor/ plasmid lyze homogenizace selekční znak cdn kolonková ligace izolace RN vektor/ plasmid izolovaná RN cdn reverzně transkripční PCR E. coli transformace regenerace, selekce transformantů izolace proteinů detekce proteinů

7 Transgenní zvířata injekce cizorodé DN do jednoho z projader projádra fertilizovaný myší oocyt před fúzí samčího a samičího projádra přenos injikovaných oocytů do pěstounských matek přibližně % potomstva obsahuje injikovanou cizorodou DN cizorodá DN je přítomna ve stejném množství ve všech tkáních myši, které exprimují cizorodou DN jsou rozmnožovány a tak se rekombinantní DN přenáší v zárodečné linii

8 Knockoutované myši injekce embryonálních zárodečný buněk do dutiny blastocoelu časného embrya chirurgický přenos embrya do pseudopregnantní myši chimérické potomstvo homozygotní bílé potomstvo křížení chimérické myši s myší homozygotní černé potomstvo, které vzniklo z linie pohlavních buněk odvozených z embryonálních zárodečných buněk a je heterozygotní v poškozeném genu X

9 Formy buněčné smrti preautofagozomální struktura svraštění buňky a rozpad cytoskeletu lysozóm pyknóza chromatinu autofágní měchýřky lyze buňky autolysozóm fragmentace buňky a jádra apoptotická tělíska autolysozóm NEKRÓZ POPTÓZ UTOFÁGIE

10 poptóza při vývoji mnohobuněčných organismů Vyřezání buněk Odstranění struktur Odstranění nebezpečných nebo poškozených buněk Nastavení počtu buněk

11 Molekulární signalizace v buňce přímým kontaktem dutým spojem synaptická endokrinní parakrinní krevní řečiště autokrinní: jedna signální buňka autokrinní: skupina signálních buněk

12 Southernův přenos () Přenos DN z gelu na membránu DN standard štěpená DN filtrační papír nylonová membrána gel pufr nylonová membrána agarózový gel podložka (B) Hybridizace DN sonda hybridizační pruhy nylonová membrána autoradiograf

13 Modely replikace podle MeselsonStahlova experimentu původní (rodičovské) konzervativní disperzní semikonzervativní molekuly DN původní DN ( 15 N) nová DN ( 14 N) nové (dceřiné) molekuly DN reálný výsledek očekávané 1 zóna centrifugační zóny druhá generace molekul DN očekávané centrifugační 2 zóny zóny

Exprese rekombinantních proteinů

Exprese rekombinantních proteinů Exprese rekombinantních proteinů Exprese rekombinantních proteinů je proces, při kterém můžeme pomocí různých expresních systémů vytvořit protein odvozený od konkrétního genu, nebo části genu. Tento protein


Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip


ÚLOHA C Klonování PCR produktu do plasmidu

ÚLOHA C Klonování PCR produktu do plasmidu Jméno a učo: Datum: ÚLOHA C Klonování PCR produktu do plasmidu TEORETICKÝ ÚVOD Při klonování PCR produktů do plasmidů se využívá vlastnosti Taq polymerasy, a jiných non-proofreading polymeras, přidávat


Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna

Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna Obsah přednášky 1) Klonování složených eukaryotických genů 2) Úprava rekombinantních genů 3) Produkce rekombinantních proteinů v expresních systémech 4) Promotory 5) Vektory 6) Reportérové geny Zdrojem


Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární


Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk


Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních


Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace





Příprava rekombinantních molekul pro diagnostické účely

Příprava rekombinantních molekul pro diagnostické účely 1 Příprava rekombinantních molekul pro diagnostické účely doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 2 Obsah přednášky 1) Pojem rekombinantní DNA 2) Historické milníky


Izolace nukleových kyselin

Izolace nukleových kyselin Izolace nukleových kyselin Požadavky na izolaci nukleových kyselin V nativním stavu z přirozeného materiálu v dostatečném množství požadované čistotě. Nukleové kyseliny je třeba zbavit všech látek, které


Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického


Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava



Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Popis Column DNA Lego Kit je základ moderní stavebnicové (Lego) soupravy pro izolaci čisté DNA různého


2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících


Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje


Klonování gen a genové inženýrství

Klonování gen a genové inženýrství Klonování gen a genové inženýrství Genové inženýrství užite né termíny Rekombinantní DNA = DNA, ve které se nachází geny nejmén ze dvou zdroj, asto ze dvou zných druh organism Biotechnologie = manipulace


Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich


1. Metodika. Protokol č. F1-4 Metodika: Srovnávací analýza efektivity přípravy rekombinantního proteinu ve fermentoru

1. Metodika. Protokol č. F1-4 Metodika: Srovnávací analýza efektivity přípravy rekombinantního proteinu ve fermentoru Protokol č.: F1-4 Datum: 20.12.2010 Metodika: analýza efektivity přípravy výběr z výsledků ze zkušebních provozů výroby antigenů. Vypracoval: Ing. Václav Filištein, Mgr. Tereza Chrudimská, Spolupracující



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Termín biotechnologie byl poprvé použit v roce 1917 Procesy, při kterých se na tvorbě výsledného produktu podílejí živé organismy Širší definice: biotechnologie


Imunochemické metody. na principu vazby antigenu a protilátky

Imunochemické metody. na principu vazby antigenu a protilátky Imunochemické metody na principu vazby antigenu a protilátky ANTIGEN (Ag) specifická látka (struktura) vyvolávající imunitní reakci a schopná vazby na protilátku PROTILÁTKA (Ab antibody) molekula bílkoviny


Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží


MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční


Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018

Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018 Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018 2.4 GENETICKÉ MANIPULACE in vitro - nekonvenční techniky, kterými lze modifikovat rostlinný


analýza dat a interpretace výsledků

analýza dat a interpretace výsledků Genetická transformace bakterií III analýza dat a interpretace výsledků Předmět: Biologie ŠVP: Prokaryotní organismy, genetika Doporučený věk žáků: 16-18 let Doba trvání: 45 minut Specifické cíle: analyzovat


4. Genové inženýrství ve farmaceutické biotechnologii

4. Genové inženýrství ve farmaceutické biotechnologii 4. Genové inženýrství ve farmaceutické biotechnologii Hlavními produkty rekombinantních technologií ve farmacii jsou rekombinantní proteiny, které budeme označovat spíše jako terapeutické proteiny, protože



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách

Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách Molekulární biotechnologie č.8 Produkce heterologního proteinu v eukaryontních buňkách Eukaryontní buňky se využívají v případě, když Eukaryontní proteiny syntetizované v baktériích postrádají biologickou


IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek

IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek IZOLACE, SEPARACE A DETEKCE PROTEINŮ I Vlasta Němcová, Michael Jelínek, Jan Šrámek Studium aktinu, mikrofilamentární složky cytoskeletu pomocí dvou metod: detekce přímo v buňkách - fluorescenční barvení


Replikace, transkripce a translace

Replikace, transkripce a translace Replikace, transkripce a translace Pravděpodobnost zařazení chybné báze cca 1:10 4, reálně 1:10 10 ; Proč? Výběr komplementární base je zásadní pro správnost mezigeneračního předávání genetické informace


Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,


STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336

STAFYLOKOKOVÉ ENTEROTOXINY. Zdravotní nezávadnost potravin. Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 STAFYLOKOKOVÉ ENTEROTOXINY Zdravotní nezávadnost potravin Veronika Talianová, FPBT, kruh: 346 Angelina Anufrieva, FPBT, kruh: 336 OBSAH: Základní charakteristika Staphylococcus aureus Stafylokokové enterotoxiny


Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů


25.2.2014. Genomika. Obor genetiky, který se snaží. stanovit úplnou genetickou informaci. organismu a interpretovat ji v. termínech životních pochodů.

25.2.2014. Genomika. Obor genetiky, který se snaží. stanovit úplnou genetickou informaci. organismu a interpretovat ji v. termínech životních pochodů. Genomika Obor genetiky, který se snaží stanovit úplnou genetickou informaci organismu a interpretovat ji v termínech životních pochodů. 1 Strukturní genomika stanovení sledu nukleotidů genomu organismu,


J09 Průkaz nukleové kyseliny

J09 Průkaz nukleové kyseliny J09 Průkaz nukleové kyseliny VLLM0421c (jaro 2016) Osnova využití a metody průkazu NK PCR a její modifikace proces prokazování specifické sekvence NK 2/55 Přímé vs. nepřímé metody přímé hledáme mikroba,


Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,


První testový úkol aminokyseliny a jejich vlastnosti

První testový úkol aminokyseliny a jejich vlastnosti První testový úkol aminokyseliny a jejich vlastnosti Vysvětlete co znamená pojem α-aminokyselina Jaký je rozdíl mezi D a L řadou aminokyselin Kolik je základních stavebních aminokyselin a z čeho jsou odvozeny



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit


Praktické cvičení: Izolace a purifikace rekombinantního proteinu

Praktické cvičení: Izolace a purifikace rekombinantního proteinu Praktické cvičení: Izolace a purifikace rekombinantního proteinu Toto blokové praktické cvičení spočívá v teoretickém i praktickém seznámení s rekombinantními proteiny, jejich izolací, purifikací a využitím.


Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2 http://www.paternityexperts.com/basicgenetics.html



MODERNÍ BIOFYZIKÁLNÍ METODY: MODERNÍ BIOFYZIKÁLNÍ METODY: POKROČILÉ PRAKTICKÉ VZDĚLÁVÁNÍ V EXPERIMENTÁLNÍ BIOLOGII Operační program Vzdělávání pro konkurenceschopnost Číslo projektu: CZ.1.07/2.3.00/09.0046 Praktický kurz pokročilých


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,



VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ Lucie Vištejnová 2, Jan Hodek 1, Patrik Sekerka 2, Jaroslava Ovesná 1, Kateřina Demnerová 2 1. Výzkumný ústav rostlinné výroby, Drnovská 507,


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní



BAKTERIÁLNÍ REZISTENCE BAKTERIÁLNÍ REZISTENCE Petr Zouhar, Fyziologický ústav AV ČR, v. v. i.; UK v Praze, PřF, Katedra fyziologie V této úloze se v hrubých rysech seznámíte s některými metodami používanými v běžné molekulárně


TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně


Havarijní plán PřF UP

Havarijní plán PřF UP Havarijní plán PřF UP v němž se nakládá s geneticky modifikovanými organismy (GMO), zpracovaný podle 20, odst. 4 zákona č. 78/2004 Sb. pro pracoviště kateder Buněčné biologie a genetiky a Oddělení molekulární


Exprese a purifikace rekombinantních proteinů

Exprese a purifikace rekombinantních proteinů Jméno a učo: Datum: Exprese a purifikace rekombinantních proteinů Teoretická část Pomocí různých expresních systémů je možné vytvořit rekombinantní protein odvozený od konkrétního genu, nebo části genu.


Kyselina hyaluronová. Kyselina hyaluronová. Streptococcus equi subsp. produkovaná kyselina hyaluronová a. Autor prezentace: Mgr.

Kyselina hyaluronová. Kyselina hyaluronová. Streptococcus equi subsp. produkovaná kyselina hyaluronová a. Autor prezentace: Mgr. Kyselina hyaluronová Streptococcus equi subsp. zooepidemicus a jím produkovaná kyselina hyaluronová a glukuronidáza Marcela Tlustá Biotechnologická laborato Meyer a Palmer, 1934 Extracelulární matrix,


Definice genového inženýrství

Definice genového inženýrství Definice genového inženýrství Genové inženýrství se zabývá vytvářením pozměněných či nových genů nebo přípravou nových ( nepřirozených ) kombinací genů a jejich zaváděním do genomu organizmů s cílem rekonstruovat


Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Využití houbových organismů v genovém inženýrství MIKROORGANISMY - bakterie, kvasinky a houby využíval


Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD

Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD Optimalizace metody PCR pro její využití na vzorky KONTAMINOVANÝCH PITNÝCH VOD Dana Vejmelková, Milan Šída, Kateřina Jarošová, Jana Říhová Ambrožová VODÁRENSKÁ BIOLOGIE, 1. 2. 2017 ÚVOD Sledované parametry,


Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová

Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová Enterotoxiny Staphylococcus aureus Jana Kotschwarová Andrea Koťová Obsah Charakteristika Staphylococcus aureus Vlastnosti Faktory virulence Enterotoxiny Patogeneze Výskyt Metody stanovení Prevence výskytu



KURZ ZÁKLADNÍCH METOD MOLEKULÁRNÍ BIOLOGIE EKOTECH KURZ ZÁKLADNÍCH METOD MOLEKULÁRNÍ BIOLOGIE Biologické centrum AV ČR, České Budějovice Lektoři: Radmila Čapková Frydrychová Miroslava Sýkorová Jindra Šíchová Václav Brož OBSAH STR. PŘÍPRAVA ROZTOKŮ.


Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních


Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky


Genové inženýrství a Geneticky modifikované organizmy

Genové inženýrství a Geneticky modifikované organizmy Genové inženýrství a Geneticky modifikované organizmy Definice GMO biologická Pojem GMO zahrnuje takové organizmy, jejichž genetický základ byl úmysln pozm n vnesením i vyjmutím n jakého genu (gen ). Definice


Buňky, tkáně, orgány, soustavy

Buňky, tkáně, orgány, soustavy Lidská buňka buněčné organely a struktury: Jádro Endoplazmatické retikulum Goldiho aparát Mitochondrie Lysozomy Centrioly Cytoskelet Cytoplazma Cytoplazmatická membrána Buněčné jádro Jadérko Karyoplazma


Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace laboratorních úloh genetických předmětů metodikami pracujícími s ribonukleovými kyselinami pšenice Metodické návody pro laboratorní


Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková Diagnostika retrovirů Lentiviry - HIV Vladislava Růžičková VI. Třída RNA-viry se zpětnou transkriptázou RT Čeleď: Retroviridae (hostitelé: Obratlovci) Rody: Alpharetrovirus Betaretrovirus Gammaretrovirus


Protokoly Transformace plasmidu do elektrokompetentních buněk BL21 Pracovní postup:

Protokoly Transformace plasmidu do elektrokompetentních buněk BL21 Pracovní postup: Protokoly Pracovní potřeby, pufry a chemikálie jsou uvedeny na konci protokolu. Pracovní postupy jsou odvozeny od těchto kitů: Champion pet160 Directional TOPO Expression Kit with Lumio Technology (Invitrogen)


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY ELEKTROFORÉZA K čemu to je? kritérium čistoty preparátu stanovení molekulové hmotnosti makromolekul stanovení izoelektrického


Transformace ptdna tabáku genem E7/GUS a eliminace selekčního genu za využití homologní rekombinace

Transformace ptdna tabáku genem E7/GUS a eliminace selekčního genu za využití homologní rekombinace Transformace ptdna tabáku fúzním genem E7/GUS a eliminace selekčního genu za využití homologní rekombinace Jiřich ich BřízaB 1,, Josef Vlasák 1, Štěpán n Ryba, Viera Ludvíkov ková 3, Hana Niedermeierová


Okruhy otázek ke zkoušce

Okruhy otázek ke zkoušce Okruhy otázek ke zkoušce 1. Úvod do biologie. Vznik života na Zemi. Evoluční vývoj organizmů. Taxonomie organizmů. Původ a vývoj člověka, průběh hominizace a sapientace u předků člověka vyšších primátů.


Metody studia exprese mrna. jádro a genová exprese 2007

Metody studia exprese mrna. jádro a genová exprese 2007 Metody studia exprese mrna Buněčné jádro a genová exprese 2007 Aktivita genu je primárn ě vyjád ř ena jeho transkripcí-prvním krokem vedoucím k syntéze kódovaného proteinu. Cíle metod Ur č ení mno ž ství


GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu


Metody testování humorální imunity

Metody testování humorální imunity Metody testování humorální imunity Co je to humorální imunita? Humorální = látková Buněčné produkty Nespecifická imunita příklady:» Lysozym v slinách, slzách» Sérové proteiny (proteiny akutní fáze)» Komplementový


ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)


Anotace: Materiál je určen k výuce přírodopisu v 6. ročníku ZŠ. Seznamuje žáky se základní stavbou rostlinné a živočišné buňky.

Anotace: Materiál je určen k výuce přírodopisu v 6. ročníku ZŠ. Seznamuje žáky se základní stavbou rostlinné a živočišné buňky. Anotace: Materiál je určen k výuce přírodopisu v 6. ročníku ZŠ. Seznamuje žáky se základní stavbou rostlinné a živočišné buňky. Materiál je plně funkční pouze s použitím internetu. základní projevy života


Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?


~ 10 base pairs (3.4 nm)

~ 10 base pairs (3.4 nm) Metody molekulární biologie 1. Manipulace s DNA - mutace, delece, - genomová DNA x cdna - restrikční endonukleasy a enzymy modifikující DNA - DNA a RNA polymerasy - syntetické oligonukleotidy (primery



ZÁKLADY BAKTERIÁLNÍ GENETIKY Zdroj rozmanitosti mikrorganismů ZÁKLADY BAKTERIÁLNÍ GENETIKY Různé sekvence nukleotidů v DNA kódují různé proteiny Různé proteiny vedou k různým organismům s různými vlastnostmi Exprese genetické informace


BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc.

BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. BAKTERIÁLNÍ GENETIKA Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. -dědičnost u baktérií principiálně stejná jako u komplexnějších organismů -genom haploidní a značně menší Bakteriální genom


Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:


DNA se ani nezajímá, ani neví. DNA prostě je. A my tancujeme podle její muziky. Richard Dawkins: Řeka z ráje.

DNA se ani nezajímá, ani neví. DNA prostě je. A my tancujeme podle její muziky. Richard Dawkins: Řeka z ráje. Genomika DNA se ani nezajímá, ani neví. DNA prostě je. A my tancujeme podle její muziky. Richard Dawkins: Řeka z ráje. Obor genetiky, který se snaží stanovit úplnou genetickou informaci organismu a interpretovat


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován



MOLEKULÁRNÍ BIOLOGIE I PŘÍPRAVA TKÁNĚ K IZOLACI DNA Cvičení 9,10,11: MOLEKULÁRNÍ BIOLOGIE Jméno: Skupina: Cíl: Seznámení se se základními metodami, využívanými k analýze DNA 1. izolace DNA 2. amplifikace DNA pomocí PCR 3. restrikční štěpení PCR produktu





1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.





Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Využití techniky RACE (Rapid amplification of complementary DNA ends) pro identifikaci genů pro metalothioneiny Metodické návody pro





Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Vztah struktury a funkce nukleových kyselin. Replikace, transkripce

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Vztah struktury a funkce nukleových kyselin. Replikace, transkripce Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Vztah struktury a funkce nukleových kyselin. Replikace, transkripce Nukleová kyselina gen základní jednotka informace v živých systémech,


Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika


Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Dle čl. 7 odst. 2 Směrnice děkana pro realizaci bakalářských


Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014 Molekulárně biologické metody v mikrobiologii Mgr. Martina Sittová Jaro 2014 Harmonogram 1. den Izolace DNA 2. den Měření koncentrace DNA spektrofotometricky, real-time PCR 3. den Elektroforéza Molekulární


Definice genového inženýrství

Definice genového inženýrství Definice genového inženýrství Genové inženýrství se zabývá vytvářením pozměněných či nových genů nebo přípravou nových ( nepřirozených ) kombinací genů a jejich zaváděním do genomu organizmů s cílem rekonstruovat


In vitro testování scaffoldů pro tkáňové inženýrství. Mgr. Jana Horáková

In vitro testování scaffoldů pro tkáňové inženýrství. Mgr. Jana Horáková In vitro testování scaffoldů pro tkáňové inženýrství Mgr. Jana Horáková 9.12.2015 Proces tkáňového inženýrství 1. Návrh nosiče Seznámení se s problematikou dané tkáně/orgánu Návrh nosiče pro danou aplikaci



SYLABY VZDĚLÁVACÍCH MODULŮ A JEJICH PŘEDMĚTŮ SYLABY VZDĚLÁVACÍCH MODULŮ A JEJICH PŘEDMĚTŮ EKOTECH Multidisciplinární výchova odborníků pro využití biotechnologií v ekologických oblastech 1) Název modulu: Transgenoze rostlin a její využití Garant:


Základy buněčné biologie

Základy buněčné biologie Maturitní otázka č. 8 Základy buněčné biologie vypracovalo přírodozpytné sympózium LP, AM & DK na konferenci v Praze, 1. Máje 2014 Buňka (cellula) je nejmenší známý útvar, který je schopný všech životních


Pulzní gelová elektroforéza Při konvenční gelové elektroforéze je rozdělení molekul je podmíněno rychlejším průchodem menších molekul pórovitou

Pulzní gelová elektroforéza Při konvenční gelové elektroforéze je rozdělení molekul je podmíněno rychlejším průchodem menších molekul pórovitou Pulzní gelová elektroforéza Při konvenční gelové elektroforéze je rozdělení molekul je podmíněno rychlejším průchodem menších molekul pórovitou strukturou gelové matrice. Tento princip separace se uplatňuje


Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní


Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování


Antigeny. Hlavní histokompatibilitní komplex a prezentace antigenu

Antigeny. Hlavní histokompatibilitní komplex a prezentace antigenu Antigeny Hlavní histokompatibilitní komplex a prezentace antigenu Antigeny Antigeny: kompletní (imunogen) - imunogennost - specificita nekompletní (hapten) - specificita antigenní determinanty (epitopy)


CENÍK. Restrikční enzymy

CENÍK. Restrikční enzymy CENÍK obchodní divize Forenzní DNA servis, s.r.o. Budínova 2, 180 81 Praha 8, CZE tel/fax: 233 931 123, GSM: 731 503 250 e-mail: amplicon@dna.com.cz Cena chlazených a mražených produktů neobsahuje dopravné
