Rozměr: px
Začít zobrazení ze stránky:



1 ÚSTAV FYZIKÁLNÍ BIOLOGIE JIHOČESKÁ UNIVERZITA V ČESKÝCH BUDĚJOVICÍCH ZPRÁVA O UKONČENÍ PROJEKTU Projekt Název projektu: Multilocus sequence analysis as a tool for robust phylogeny in heterocytous cyanobacteria Průběh řešení projektu : V průběhu řešení projektu byly splněny všechny hlavní cíle stanovené v původním návrhu. Bylo shromážděno několik desítek izolátů málo prostudovaných zástupců terestrických heterocytózních sinic r. Scytonema, Brasilonema, Microchaete, Tolypothrix a dalších, a přibližně 20 environmentálních vzorků obtížně kultivovatelných sinic r. Stigonema a Petalonema pro amplifikaci z izolovaných buněk (single cells). Vzorky pocházejí z široké škály geografických oblastí včetně málo prostudovaných tropických oblastí (Filipíny, Havajské ostrovy, Kostarika) a lokalit v temperátním pásmu (Evropa, USA). V úvodní části projektu byla podrobně zpracována fylogeneze celé skupiny (Nostocales) na základě všech kvalitních (> cca 800 bp) sekvencí z databáze GenBank a vlastních sekvencí získaných před zahájením a v průběhu práce na projektu. Tato fylogenetická studie představuje dosud nejkompletnější a nejaktuálnější přehled o evoluci heterocytózních sinic a bude využita v několika připravovaných publikacích a v důležité monografii řádu Nostocales (viz výsledky). Na základě výsledků této předběžné analýzy byly vybrány vhodné kmeny pro testování multilokusové analýzy (Tab. 1., Obr. 1.). Hlavním cílem projektu byla optimalizace multilokusové fylogenetické analýzy pro použití na vzorky terestrických heterocytózních sinic. V průběhu projektu byly na fylogeneticky reprezentativním výběru kmenů testovány primery a PCR protokoly pro amplifikaci pěti široce využívaných lokusů s použitím dříve publikovaných prací s vlastními úpravami (Tab. 2.). Dosud byla optimalizována amplifikace a sekvenace tří různých markerů.

2 Dalším cílem projektu bylo zavedení metod izolace jednotlivých buněk (single cells) obtížně kultivovatelných zástupců pro molekulární analýzu. Tato metodika byla úspěšně optimalizována pro relativně širokou škálu vzorků r. Stigonema, u kterých se zdařilo z izolovaných buněk amplifikovat gen pro 16S rrna (Obr. 1., Tab. 1.). Vzhledem k náročné optimalizaci izolace buněk a navazujících PCR protokolů nebyly u těchto vzorků dosud studovány ostatní markery. Byly též učiněny pokusy o amplifikaci celého genomu z buněk metodou multiple displacement amplification (MDA, Ishoey et al. 2008). Tato metoda přinesla úspěch pouze u jednoho vzorku a bude vyžadovat další optimalizaci. Dosažené výsledky: Byla zpracována celková fylogenetická analýza heterocytózních sinic na základě všech dostupných dat z databáze GenBank a vlastních nepublikovaných sekvencí zástupců méně prostudovaných čeledí Microchaetaceae, Stigonemataceae, Rivulariaceae a Scytonemataceae. Výsledky fylogenetické analýzy budou mimo vlastního projektu a navazujících studií použity pro 2 další publikace, které jsou v současnosti v recenzním řízení nebo v přípravě do tisku: 1. Komárek J. & Mareš J. (2012): Modern taxonomy (2011) of freshwater planktic heterocytous cyanobacteria. - Submitted to Hydrobiologia. 2. Komárek J. (2012): Cyanoprokaryota. 3. Teil: Nostocales. Süβwasserflora von Mitteleuropa 19/3. - Spektrum Akademischer Verlag, Elsevier GmbH, München, in prep. Na základě stromu byli vybráni zástupci fylogenetických větví, které dosud nebyly studovány pomocí multilokusové analýzy (viz Obr. 1.). Vybrané kmeny posloužily k testování zvolených markerů, které se běžně využívají zejména ve studiích zaměřených na planktonní typy heterocytózních sinic (Rajaniemi et al. 2005, Lyra et al. 2005, Moreira et al. 2011). Doposud byla provedena optimalizace PCR pro tyto testovací kmeny a sekvenace 3 vybraných lokusů - rbclx, rpoc1 a nifd (viz. Tab. 2. a 3.). Fungující protokoly budou využity v nejbližší době pro konstrukci statisticky robustního fylogenetického stromu heterocytózních sinic a dále v následných podrobných studiích jednotlivých skupin (Scytonemataceae, Stigonemataceae, Microchaetaceae, Rivulariaceae).

3 Tabulka č. 1. Vybrané kmeny heterocytózních sinic použité v rámci projektu pro testování markerů a single-cell PCR. Název vorku Původ Izolace / Sekvence Brasilonema sp. F20B II. Filipíny 16S+ITS r, rbclx, rpoc1, nifd Scytonema sp. F26 II. Filipíny 16S+ITS r, rbclx, rpoc1, nifd Tolypothrix sp. T3 nárost, skleník, bot. zahrada Teplice 16S+ITS r, rbclx, rpoc1, nifd Scytonema hyalinum Havaj 16S+ITS r, rbclx, rpoc1, nifd Scytonema sp. F26 III. Filipíny 16S+ITS r, rbclx, rpoc1, nifd Scytonematopsis sp. Sic09 kámen, Cava Grande di Cassibile, Sicílie 16S+ITS r, rbclx, rpoc1, nifd Microchaete sp. T10 nárost, skleník, bot. zahrada Teplice 16S+ITS r, rbclx, rpoc1 Tolypothrix distorta CCALA 194 půda, květináč, Nizozemsko 16S+ITS r, rbclx, rpoc1 Stigonema cf. mammilosum 5-4 CR Stigonema mammilosum Nor Stigonema mammilosum CDBWA Stigonema cf. tomentosum CAT1C Stigonema ocellatum CAT1 IIII Stigonema informe CAT5C Stigonema hormoides CAT3A Stigonema ocellatum NRO Stigonema cf. mammilosum CDBWD Stigonema panniforme CZ Stigonema panniforme Hawaii kámen, horský mlžný les, Kostarika kámen, potok, Norsko skalní stěna, Great vlhký kámen, Great Smoky Mts., USA vlhký kámen, Great Smoky Mts., USA kámen, Great kámen, Great mrtvé dřevo, Great kámen, Great skála, Holubovské hadce, CZ skála, ostrov Kauai, Havaj

4 V rámci testování metod pro analýzu izolovaných buněk (single-cells) byla úspěšně optimalizována amplifikace genu pro z buněk u 11 vybraných kmenů r. Stigonema (Tab. 1, Obr. 1.). Opakovaná sekvenace buněk ze všech vzorků potvrdila reprodukovatelnost výsedků. Fylogenetická analýza potvrdila existenci monofyletického rodu Stigonema a upřesnila jeho postavení v rámci systému sinic. Genomová amplifikace (MDA), PCR amplifikace dalších markerů, a studium dalších nekultivovatelných sinic nebyly dosud dokončeny nebo zoptimalizovány a jsou v plánu v následujícím roce. Tabulka č. 2. Testované primery pro multilokusovou analýzu. primer sekvence cíl zdroj úspěšnost* HEPF 5 -TTT GGG GTT AAC TTT TTT GGG CAT AGT C-3 mcye Jungblut & Neilan 2006? 1 HEPR 5 -AAT TCT TGA GGC TGT AAA TCG GGT TT-3 mcye Jungblut & Neilan 2006? 1 mcye-f2 5 -GAA ATT TGT GTA GAA GGT GC-3 mcye Rantala et al mcye-r4 5 -AAT TCT AAA GCC CAA AGA CG-3 mcye Rantala et al nifd552-f 5 -TCC GKG GKG TDT CTC AGT C-3 nifd Roeselers et al % nifd861-r 5 -CGR CWG ATR TAG TTC AT-3 nifd Roeselers et al % nifd-f 5 -GAT GGC GAT GTA TGC TGC TAA CAA C-3 nifd Henson et al nifd-r 5 -GTA CGG AAG TAA GCA ACG CAA CCT TG-3 nifd Henson et al CW 5 -CGT AGC TTC CGG TGG TAT CCA CGT-3 rbclx Rudi et al % CX 5 -GGG GCA GGT AAG AAA GGG TTT CGT A-3 rbclx Rudi et al % rpc/mf 5 -GGT GAR GTN ACN AAR CCA GAR AC-3 rpoc1 Seo & Yokota % rpc/cr-1 5 -CCA GAR TAG TCN ACC CGT TTA CC-3 rpoc1 Seo & Yokota % GB/3MF 5 -AAG CGH CCN GSN ATG TAY ATH GG-3 gyrb Seo & Yokota GB/CR-2 5 -CCN GCN GAR TCN CCY TCN AC-3 gyrb Seo & Yokota gyrb-f 5 -GGC ATC ATT TCA CCC AAA CCT TTG-3 gyrb vlastní design - gyrb-r 5 -ATG ACG AGC AGT TAC AGT GCC GA-3 gyrb vlastní design - * vztahuje se k 9 vybraným kmenům pro testování multilokusových markerů 1 dosud není dokončena optimalizace PCR

5 Obrázek č. 1. strom heterocytózních sinic (Maximum likelihood, 512 boostrap replikací, phyml GTR+G+I, 168 OTUs). Modrá čára rod Stigonema, tučně jsou vyznačeny sekvence získané po PCR amplifikaci single cells; zelené šipky fylogenetické větve, v rámci kterých již byla provedena multilokusová analýza jinými autory; červené šipky fylogenetické větve, ze kterých byli vybráni zástupci pro multilokusovou analýzu v rámci projektu.

6 Stav čerpání finančních prostředků: Byly vyčerpány veškeré finanční prostředky na nákup laboratorního materiálu pro molekulární analýzy podle navrženého rozpočtu, viz Tabulku č. 3. Byla zakoupena učebnice bioinformatiky Beginning Perl for Bioinformatics (Tisdall, J. 2001, O Reilly Media, USA) v hodnotě 700 Kč. Tabulka č. 3. Čerpání finančních prostředků (materiál). Popis materiálu Cena včetně DPH (Kč) Qiagen REPLI-g Mini Kit (100) - 1x Invisorb Fragment CleanUp, 250 purifications - 1x X Red PCR Master mix; 500 reactions - 2x Rukavice latexové nezaprašované S - 40x 5680 Rukavice latexové nezaprašované M - 10x 1420 Celkem Využitelnost dosažených výsledků a navazující práce: Výsledky projektu budou použity v řadě navazujících prací v rámci dlouhodobého výzkumu evoluce a taxonomie heterocytózních sinic v naší laboratoři. Fylogenetický strom vypočtený v průběhu projektu z dat je součástí dvou publikací v recenzním řízení a nadále bude využíván jako základní srovnávací model pro další studie. Optimalizované protokoly pro amplifikaci 3 dalších markerů nám v nejbližších měsících umožní rychle shromáždit data potřebná pro tvorbu fylogenetického stromu Nostocales na základě dosud nejreprezentativnějšího datasetu (4 lokusy, přítomnost sekvencí z málo prostudovaných vývojových větví). Očekáváme odeslání těchto výsledků k publikaci v příštím roce. Multilokusová analýza bude dále využita při řešení projektu GAČR P506/12/1818 zaměřeného na fylogenezi a diverzitu čeledi Scytonemataceae. Důležitým výsledkem je také úspěšné zavedení metodiky sekvenace z izolovaných buněk u nekultivovatelných sinic r. Stigonema. Výsledky této práce budou v příštím roce připraveny k publikaci. Pokud se potvrdí využitelnost i pro další typy sinic, bude se jednat o metodický průlom v současné molekulární taxonomii sinic. V Českých Budějovicích dne RNDr. Jan Mareš (řešitel projektu)

7 Literatura: Henson B.J., Hesselbrock S.M., Watson L.E. & Barnum S.R Molecular phylogeny of the heterocystous cyanobacteria (subsections IV and V) based on nifd. Int. J. Syst. Evol. Microbiol. 54: Ishoey T., Woyke T., Stepanauskas R., Novotny M. & Lasken R.S Genomic sequencing of single microbial cells from environmental samples. Curr. Opin. Microbiol. 11: Jungblut A.-D. & Neilan B.A Molecular identification and evolution of the cyclic peptide hepatotoxins, microcystin and nodularin, synthetase genes in three orders of cyanobacteria. Arch. Microbiol. 185: Lyra C., Laamanen M., Lehtimaki J.M., Surakka A. & Sivonen K Benthic cyanobacteria of the genus Nodularia are non-toxic, without gas vacuoles, able to glide and genetically more diverse than planktonic Nodularia. Int. J. Syst. Evol. Microbiol. 55: Moreira C., Fathalli A., Vasconcelos V. & Antunes A Genetic diversity and structure of the invasive toxic cyanobacterium Cylindrospermopsis raciborskii. Curr. Microbiol. 62: Rajaniemi P., Hrouzek P., Kaštovská K., Williame R., Rantala A., Hoffmann L., Komárek J. & Sivonen K. 2005: Phylogenetic and morphological evaluation of the genera Anabaena, Aphanizomenon, Trichormus and Nostoc (Nostocales, Cyanobacteria). Int. J. Syst. Evol. Microbiol. 55: Rantala A., Fewer D.P., Hisbergues M., Rouhiainen L., Vaitomaa J., Borner T. & Sivonen K Phylogenetic evidence for the early evolution of microcystin synthesis. Proc. Nat.l Acad. Sci. U S A 101: Roeselers G., Stal L.J., van Loosdrecht M.C.M. & Muyzer G Development of a PCR for the detection and identification of cyanobacterial nifd genes. J. Microbiol. Meth. 70: Rudi K., Skulberg O.M. & Jakobsen K.S Evolution of Cyanobacteria by exchange of genetic material among phyletically related strains. J. Bacteriol. 180: Seo P-S. & Yokota A The phylogenetic relationships of cyanobacteria inferred from 16SrRNA, gyrb, rpoc1 and rpod1 gene sequences. J. Gen. Appl. Microbiol. 49:

Autoindex nad DNA sekvencemi

Autoindex nad DNA sekvencemi Autoindex nd DNA sekvenemi do. Ing. Jn Holub, Ph.D. ktedr teoretiké informtiky Fkult informčníh tehnologií České vysoké učení tehniké v Prze ENBIK 2014 10. 6. 2014 ENBIK 2014, 10. 5. 2014 J. Holub: Autoindex





Využití DNA sekvencování v

Využití DNA sekvencování v Využití DNA sekvencování v taxonomii prokaryot Mgr. Pavla Holochová, doc. RNDr. Ivo Sedláček, CSc. Česká sbírka mikroorganismů Ústav experimentální biologie Přírodovědecká fakulta Masarykova univerzita,





Havarijní plán PřF UP

Havarijní plán PřF UP Havarijní plán PřF UP v němž se nakládá s geneticky modifikovanými organismy (GMO), zpracovaný podle 20, odst. 4 zákona č. 78/2004 Sb. pro pracoviště kateder Buněčné biologie a genetiky a Oddělení molekulární



PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER Trojan V., Hanáček P., Havel L. Department of Plant Biology, Faculty of Agronomy, Mendel University of Agriculture and Forestry in Brno, Zemedelska


Populační genetika. ) a. Populační genetika. Castle-Hardy-Weinbergova zákonitost. Platí v panmiktické populaci za předpokladu omezujících podmínek

Populační genetika. ) a. Populační genetika. Castle-Hardy-Weinbergova zákonitost. Platí v panmiktické populaci za předpokladu omezujících podmínek Poulační genetika Poulační genetika ORGANISMUS Součást výše organizované soustavy oulace POPULACE Soubor jedinců jednoho druhu Genotyově heterogenní V určitém čase má řirozeně vymezený rostor Velký očet


Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray












ANALYSIS OF SERPINE1 GENE VARIABILITY IN PIGS ANALYSIS OF SERPINE1 GENE VARIABILITY IN PIGS Weisz F., Knoll A. Department of Animal Morphology, Physiology and Genetics, Faculty of Agronomy, Mendel University of Agriculture and Forestry in Brno, Zemedelska


Lucie Kárná, Michal Křížek, Pavel Křížek

Lucie Kárná, Michal Křížek, Pavel Křížek genetika Genetický kód z pohledu matematiky Lucie Kárná, Michal Křížek, Pavel Křížek RNDr. Lucie Kárná, Ph.D. (*1969) vystudovala obor matematická analýza na Matematickofyzikální fakultě UK a v současnosti


Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno urban@mendelu.cz htt://www.mendelu.cz/af/genetika/ Seminář doktorského grantu 53/03/H076 : Molekulárn





Determinační schůzka Centra pro cyanobakterie a jejich toxiny, 9. 2. 2007 Mgr. Lenka Šejnohová, CCT. & Masarykova Univerzita

Determinační schůzka Centra pro cyanobakterie a jejich toxiny, 9. 2. 2007 Mgr. Lenka Šejnohová, CCT. & Masarykova Univerzita Sinice vodních květů v ČR Determinační schůzka Centra pro cyanobakterie a jejich toxiny, 9. 2. 2007 Mgr. Lenka Šejnohová, CCT ddělení experimentální fykologie a ekotoxikologie Botanický ústav Akademie


Schéma průběhu transkripce

Schéma průběhu transkripce Molekulární základy genetiky PROTEOSYNTÉZA A GENETICKÝ KÓD Proteosyntéza je složitý proces tvorby bílkovin, který zahrnuje proces přepisu genetické informace z DNA do kratšího zápisu v informační mrna


V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)


Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská


Botanický ústav AV ČR pracoviště Třeboň. Botanický ústav AV ČR, Průhonice u Prahy

Botanický ústav AV ČR pracoviště Třeboň. Botanický ústav AV ČR, Průhonice u Prahy Botanický ústav AV ČR pracoviště Třeboň Botanický ústav AV ČR, Průhonice u Prahy První pracoviště Botanického ústavu ČSAV vrámci mezinárodního programu IBP. Cíl projektu: Biologické podklady pro hodnocení


Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae).

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). Populační studie Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). American Journal of Botany 87(8): 1128


Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky

Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky Biotechnologický kurz Biotechnologický kurz III. letní škola metod molekulární biologie nukleových kyselin a genomiky 18. - 22. 6. 2012 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně


Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí,

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí, Využití molekulárních markerů v systematice a populační biologii rostlin 12. Shrnutí, Přehled molekulárních markerů 1. proteiny isozymy 2. DNA markery RFLP (Restriction Fragment Length Polymorphism) založené


Strom života. Cíle. Stručná anotace

Strom života. Cíle. Stručná anotace Předmět: Doporučený ročník: Vazba na ŠVP: Biologie 1. ročník Úvod do taxonomie Cíle Studenti zařadí člověka do příslušných taxonů taxonomického systému. Studenti se seznámí s principem fylogenetického


Využití PCR pro studium mikrobiologických biodegradačních procesů. Bc. Tereza Dobešová

Využití PCR pro studium mikrobiologických biodegradačních procesů. Bc. Tereza Dobešová Využití PCR pro studium mikrobiologických biodegradačních procesů Bc. Tereza Dobešová Diplomová práce 011 ABSTRAKT Cílem diplomové práce bylo ověřit funkčnost a optimalizovat podmínky primerů, jejichž


Jihočeská univerzita v Českých Budějovicích Přírodovědecká fakulta

Jihočeská univerzita v Českých Budějovicích Přírodovědecká fakulta Jihočeská univerzita v Českých Budějovicích Přírodovědecká fakulta Bakalářská práce Druhová identifikace korovnic (Adelgidae) na základě molekulárních markerů Pavlína Věchtová Školitel: PaedDr. Martina


Fotobionti aneb lišejník není jen houba, ale i řasa. Ondřej Peksa

Fotobionti aneb lišejník není jen houba, ale i řasa. Ondřej Peksa Fotobionti aneb lišejník není jen houba, ale i řasa Ondřej Peksa Lišejníky definice lišejníku podvojný (komplexní) organismus složený z houby (mykobionta) a fotosyntetizujícího partnera (fotobionta) Stélka


Nové technologie v mikrobiologické diagnostice a jejich přínos pro pacienty v intenzivní péči

Nové technologie v mikrobiologické diagnostice a jejich přínos pro pacienty v intenzivní péči B I O M E D I C AL Nové technologie v mikrobiologické diagnostice a jejich přínos pro pacienty v intenzivní péči Jaroslav Hrabák CHARLES UNIVERSITY IN PRAGUE Obsah prezentace ČSIM 2016 Mikrobiologická


Molekulárn. rní genetika

Molekulárn. rní genetika Molekulárn rní genetika Centráln lní dogma molekulárn rní biologie cesta přenosu genetické informace: DNA RNA proteiny výjimkou reverzní transkripce retrovirů: RNA DNA Chemie nukleových kyselin dusíkaté



MODERNÍ BIOFYZIKÁLNÍ METODY: MODERNÍ BIOFYZIKÁLNÍ METODY: POKROČILÉ PRAKTICKÉ VZDĚLÁVÁNÍ V EXPERIMENTÁLNÍ BIOLOGII Operační program Vzdělávání pro konkurenceschopnost Číslo projektu: CZ.1.07/2.3.00/09.0046 Praktický kurz pokročilých


Studium polymorfismu u vybraných populací smrku ztepilého Picea abies (L.)

Studium polymorfismu u vybraných populací smrku ztepilého Picea abies (L.) Výzkum možností minimalizace obsahů organických škodlivin ve zdrojích pitných vod v Krušných horách Studium polymorfismu u vybraných populací smrku ztepilého Picea abies (L.) Karsten pomocí DNA analýz


velké fragmenty střední fragmenty malé fragmenty

velké fragmenty střední fragmenty malé fragmenty velké fragmenty střední fragmenty malé fragmenty Southern 1975 Northern Western denaturace DNA hybridizace primerů (annealing) (mají délku kolem 20 bází) syntéza nové DNA termostabilní polymerázou vstup


Determinace sinic vodních květů v ČR Polyfázický přístup on species level

Determinace sinic vodních květů v ČR Polyfázický přístup on species level Determinace sinic vodních květů v ČR Polyfázický přístup on species level Determinační praktikum PřF UK, 19. 11. 2007 Mgr. Lenka Šejnohová, Botanický ústav AVČR, Brno Oddělení experimentální fykologie


1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.





Průkaz viru influenzy u vakcinovaných koní v ČR v roce 2008 Souhrn Úvod

Průkaz viru influenzy u vakcinovaných koní v ČR v roce 2008 Souhrn Úvod Průkaz viru influenzy u vakcinovaných koní v ČR v roce 2008 Doc. MVDr. Petr Lány, Ph.D., Mgr. Kateřina Rosenbergová, Ph.D., Mgr. Vojtěch Baláž* Ústav infekčních chorob a mikrobiologie, FVL, VFU Brno, *Ústav


PhD. České Budějovice

PhD. České Budějovice PhD. České Budějovice Sledování a využívání poznatků o genetické biodiverzitě mezi populacemi hospodářských zvířat Dvořák Josef prof. Genetiky živočichů Ústavu genetiky MZLU v Brně Pro seminář doktorského


Mutageneze vznik chyby na DNA mutagen (chemická látka / záření)

Mutageneze vznik chyby na DNA mutagen (chemická látka / záření) Genotoxicita - úvod Genotoxicita: toxická látka ovlivňuje genetický materiál buňky (nukleové kyseliny) Při působení vyšších koncentrací genotoxických látek dochází k přímému úhynu buněk Nižší koncentrace


Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right





Molekulární analýza mitochondriálního genomu Diuraphis noxia (Aphididae)

Molekulární analýza mitochondriálního genomu Diuraphis noxia (Aphididae) Jihočeská univerzita v Českých Budějovicích Přírodovědecká fakulta Diplomová práce Molekulární analýza mitochondriálního genomu Diuraphis noxia (Aphididae) Bc. Daniela Chundelová Školitel : PaedDr. Martina



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit


Ceník izolačních kitů STRATEC v mikrodestičkách

Ceník izolačních kitů STRATEC v mikrodestičkách Izolace plasmidové DNA ST7010300200 Invisorb Plasmid HTS 96 Kit for 2 x 96 preps 9 229 ST7010300300 isolation of pdna from up to 2.0 ml 4 x 96 preps 15 120 bacteria suspension in a 96-well format ST7010300400





Molekulární genetika

Molekulární genetika Molekulární genetika Upozornění: ukončení semestru ZÁPOČTOVÝ TEST a) Dědičnost krevně skupinových systémů (AB0, MN, Rh) b) Přepis úseku DNA do sekvence aminokyselin c) Populační genetika výpočet frekvence


Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní


Zaměření bakalářské práce (témata BP)

Zaměření bakalářské práce (témata BP) Zaměření bakalářské práce (témata BP) Obor: Buněčná a molekulární diagnostika - zadává katedra - studenti si témata losují Obor: molekulární biologie a genetika - témata BP vychází z vybraného tématu DP


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


Botanika bezcévných rostlin pro učitele 1. praktické cvičení

Botanika bezcévných rostlin pro učitele 1. praktické cvičení Botanika bezcévných rostlin pro učitele 1. praktické cvičení INFORMACE O ORGANIZACI CVIČENÍ cíl praktického cvičení: na konkrétním materiálu se seznámit s reprezentativními zástupci nejdůležitějších systematických


Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010 Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem Milan Bartoš Forum veterinarium, Brno 2010 Vývoj farmakogenetické diagnostické soupravy pro stanovení genetických polymorfismů


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Využití metagenomiky při hodnocení sanace chlorovaných ethylenů in situ Výsledky pilotních testů

Využití metagenomiky při hodnocení sanace chlorovaných ethylenů in situ Výsledky pilotních testů Využití metagenomiky při hodnocení sanace chlorovaných ethylenů in situ Výsledky pilotních testů Stavělová M.,* Macháčková J.*, Rídl J.,** Pačes J.** * Earth Tech CZ, s.r.o ** ÚMG AV ČR PROČ METAGENOMIKA?


Vyhledávání podobných sekvencí BLAST

Vyhledávání podobných sekvencí BLAST Vyhledávání podobných sekvencí BLAST Základní informace Následující text je součástí učebních textů předmětu Analýza sekvencí DNA a je určen hlavně pro studenty Matematické biologie. Může být ovšem přínosný


Ústav klinické mikrobiologie a Národní referenční laboratoř pro cytomegaloviry, FN v Hradci Králové 2



Polyfazický přístup k taxonomii sinic řádu Oscillatoriales

Polyfazický přístup k taxonomii sinic řádu Oscillatoriales Biologická fakulta Jihočeské univerzity České Budějovice BAKALÁŘSKÁ PRÁCE Polyfazický přístup k taxonomii sinic řádu Oscillatoriales Ana Lokmer 2004 vedoucí práce: RNDr. Jan Kaštovský, Ph.D. 1 LOKMER,


Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8






EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence


Evoluce (nejen) rostlinné buňky Martin Potocký laboratoř buněčné biologie ÚEB AV ČR, v.v.i. potocky@ueb.cas.cz http://www.ueb.cas.cz Evoluce rostlinné buňky Vznik a evoluce eukaryotních organismů strom


Interakce viru klíšťové encefalitidy s hostitelským organismem a patogeneze infekce

Interakce viru klíšťové encefalitidy s hostitelským organismem a patogeneze infekce Parazitologický ústav, Akademie věd České republiky Laboratoř interakcí vektor-hostitel České Budějovice Interakce viru klíšťové encefalitidy s hostitelským organismem a patogeneze infekce Daniel Růžek,


Pracovní list. (3) školní automatická stanice

Pracovní list. (3) školní automatická stanice Pracovní list Prší, prší, jen se leje... 1. Zahájení celoročního měření srážek a výparu Obr. 1 Různé typy srážkoměrů (1) příklad vlastní výroby (2) domácí jednoduchý (3) školní automatická stanice (4)


Vysoká škola chemicko-technologická v Praze. Ing. Iva Pacovská Ústav biochemie a mikrobiologie, VŠCHT Praha

Vysoká škola chemicko-technologická v Praze. Ing. Iva Pacovská Ústav biochemie a mikrobiologie, VŠCHT Praha Vysoká škola chemicko-technologická v Praze Ing. Iva Pacovská Ústav biochemie a mikrobiologie, VŠCHT Praha dichlordifenyltrichlormethylmethan Insekticid Bílý krystalický prášek Poprvé syntetizován v roce


variabilita genomu bottleneck Nature Science

variabilita genomu bottleneck Nature Science variabilita genomu Nature Science genetická diverzita člověka na úrovni SNP je nízká: asi 0.1% cca. 90% variace je uvnitř populací cca. 10% mezi populacemi (kontinenty) bottleneck personal genomes James


základní znaky živých systémů (definice života výčtem jeho vlastností) složitá organizace a řád regulace a udržování vnitřní homeostázy získávání a

základní znaky živých systémů (definice života výčtem jeho vlastností) složitá organizace a řád regulace a udržování vnitřní homeostázy získávání a definice života živý organismus je přirozeně se vyskytující sám sebe reprodukující systém, který vykonává řízené manipulace s hmotou, energií a informací základní znaky živých systémů (definice života



1. ÚVOD A PROBLEMATIKA 1. ÚVOD A PROBLEMATIKA 1.1. CYTOCHROMY P450 Cytochromy P450 (CYP) jsou biotransformační enzymy odpovědné za detoxikaci a eliminaci organických cizorodých látek (xenobiotik). Jsou zahrnuty v oxidativním


Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o.

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o. Genetické markery ve šlechtění skotu pro masnou produkci Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Genetické markery Polymorfní místa v DNA, které vykazují asociaci na sledované znaky Příčinné


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 5. Metody molekulární biologie II DNA footprinting hledání interakcí DNA s proteiny Polymerázová řetězová reakce (Polymerase chain reaction PCR) Malé


Katarína Mitrová, Jaroslava Ovesná, Leona Svobodová. Použití metody analýzy mikrosatelitů pro charakterizaci odrůd česneku METODIKA PRO PRAXI

Katarína Mitrová, Jaroslava Ovesná, Leona Svobodová. Použití metody analýzy mikrosatelitů pro charakterizaci odrůd česneku METODIKA PRO PRAXI Katarína Mitrová, Jaroslava Ovesná, Leona Svobodová Použití metody analýzy mikrosatelitů pro charakterizaci odrůd česneku METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i., 2015 Metodika byla



TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy


Hydrochemie přírodní organické látky (huminové látky, AOM)

Hydrochemie přírodní organické látky (huminové látky, AOM) Hydrochemie přírodní organické látky (huminové látky, AM) 1 Přírodní organické látky NM (Natural rganic Matter) - významná součást povrchových vod dělení podle velikosti částic: rozpuštěné - DM (Dissolved


GENETIKA U VLS ČR, s. p. Ing. Pavel Češka Vojenské lesy a statky ČR, s. p.

GENETIKA U VLS ČR, s. p. Ing. Pavel Češka Vojenské lesy a statky ČR, s. p. GENETIKA U VLS ČR, s. p. Ing. Pavel Češka Vojenské lesy a statky ČR, s. p. STRUČNÝ POPIS SOUČASNÉHO STAV GENETIKY U VLS je v současnosti využíván především reprodukční materiál z identifikovaných a kvalifikovaných





6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního


Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace


Využití molekulárních markerů v systematice a populační biologii rostlin. 9. Sekvenování DNA II. nrdna, low-copy markery

Využití molekulárních markerů v systematice a populační biologii rostlin. 9. Sekvenování DNA II. nrdna, low-copy markery Využití molekulárních markerů v systematice a populační biologii rostlin 9. Sekvenování DNA II. nrdna, low-copy markery Jaderný genom mnoho genů je v mnoha kopiích (multiple-copy) problém s homologií nevíme,





Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace praktických cvičení molekulárně-biologických předmětů o sekvenční úlohy PRACOVNÍ PROTOKOL PRO PŘEDMĚT GENETCKÁ DIVERZITA Vypracováno








Aktuální význam a rizika skladištních škůdců

Aktuální význam a rizika skladištních škůdců Výzkumný ústav rostlinné výroby, v.v.i. Aktuální význam a rizika skladištních škůdců Ing. Václav Stejskal PhD Výzkum skladištních škůdců v ČR Představení činnosti Oddělení ochrany zásob a bezpečnosti potravin


Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická


Transgenní řepka olejka (Brassica napus L.) její monitoring, molekulární detekce a vliv agrotechniky na eliminaci výdrolu

Transgenní řepka olejka (Brassica napus L.) její monitoring, molekulární detekce a vliv agrotechniky na eliminaci výdrolu Transgenní řepka olejka (Brassica napus L.) její monitoring, molekulární detekce a vliv agrotechniky na eliminaci výdrolu Genové inženýrství umožňuje vnesení hospodářsky významných znaků do zájmových plodin


DY D NE N X Hana Vlastníková

DY D NE N X Hana Vlastníková DYNEX Hana Vlastníková Molekulární biologie: Vybavení laboratoře na klíč Přístrojová technika Kompatibilní diagnostické soupravy Profesionální přístup SOP Technická podpora Servis Přístrojové vybavení:


GENOTOXICITA LÉČIV. Klára A. Mocová. VŠCHT Praha Fakulta technologie ochrany prostředí Ústav chemie ochrany prostředí

GENOTOXICITA LÉČIV. Klára A. Mocová. VŠCHT Praha Fakulta technologie ochrany prostředí Ústav chemie ochrany prostředí GENOTOXICITA LÉČIV Klára A. Mocová VŠCHT Praha Fakulta technologie ochrany prostředí Ústav chemie ochrany prostředí Centralizovaný rozvojový projekt MŠMT č. C29: Integrovaný systém vzdělávání v oblasti


Ondřej Scheinost Nemocnice České Budějovice, a.s.

Ondřej Scheinost Nemocnice České Budějovice, a.s. Ondřej Scheinost Nemocnice České Budějovice, a.s. Nové technologie přelomové období principy technologií klinická použitelnost chips (arrays) sekvenační technologie Důležitost genetických informací i další


Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských



FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po


Nové p ístupy v detekci DNA a protein

Nové p ístupy v detekci DNA a protein Nové p ístupy v detekci DNA a protein DNA je makromolekula ú astnící se klí ových biologických proces Její poškození má za následek: mutace a aberace rakovinu metabolické poruchy které vrozené vady neurodegenerativní


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Můj život s genetikou

Můj život s genetikou Můj život s genetikou Aneta Mikulášová Molekulární biologie a genetika Přírodovědecká fakulta Masarykova univerzita Univerzitní vzdělávání genetiky 150 roků po Mendelovi Brno, 29. 5. 2015 Studium Molekulární


pûvodní práce p fi e h l e d



TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Přehled Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymerasa Princip procesu PCR Optimalizace PCR Typy PCR Aplikace


Jihočeská univerzita v Českých Budějovicích Zemědělská fakulta

Jihočeská univerzita v Českých Budějovicích Zemědělská fakulta Jihočeská univerzita v Českých Budějovicích OP Vzdělávání pro konkurenceschopnost CZ. Koordinátor: Mgr. Martin Šlachta, Ph.D. Metodik: prof. Ing. Jan Frelich, CSc. Finanční manažerka:


Aerofytické řasy tropického deštného lesa zkušenosti z Malajského poloostrova

Aerofytické řasy tropického deštného lesa zkušenosti z Malajského poloostrova Czech Phycology, Olomouc, 1: 31-35, 2001 31 Aerofytické řasy tropického deštného lesa zkušenosti z Malajského poloostrova Aerophytic algae from the tropical rainforests of Peninsular Malaysia Jiří N e


PDF created with FinePrint pdffactory Pro trial version http://www.pdffactory.com

PDF created with FinePrint pdffactory Pro trial version http://www.pdffactory.com Start hry jste úspěšně zvládli. Máte dobré předpoklady k tomu, abyste absolvovali celou hru. - Hra má start, cíl a 13 číslovaných stanovišť, která musíte projít. - Pro každou skupinu je určena jedna zpráva.


Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE

Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE BiochemNet vytvoření sítě pro podporu spolupráce biomedicínských pracovišť a zvýšení uplatnitelnosti absolventů biochemických oborů v praxi Laboratorní workshop s teoreticko praktickou ukázkou molekulárně


Pracovní list: řešení

Pracovní list: řešení Prší, prší, jen se leje... Pracovní list: řešení 1. Zahájení celoročního měření srážek a výparu Obr. 1 Různé typy srážkoměrů (1) příklad vlastní výroby (2) domácí jednoduchý (3) školní automatická stanice


www.glamur.cz * kovové hodiny CENA: 8 046,- Kč bez DPH ROZMĚRY (cm) : š 122 x h 6 HMOTNOST : 13,57 Kg BATERIE: LR06 1.5V AA, 1 ks

www.glamur.cz * kovové hodiny CENA: 8 046,- Kč bez DPH ROZMĚRY (cm) : š 122 x h 6 HMOTNOST : 13,57 Kg BATERIE: LR06 1.5V AA, 1 ks H002 * kovové hodiny ROZMĚRY (cm) : š 122 x h 6 HMOTNOST : 13,57 Kg CENA: 8 046,- Kč bez DPH H003B * bělený kov ROZMĚRY (cm) : v 90 x š 90 HMOTNOST : 7,44 Kg CENA: 6 426,- Kč bez DPH H003A * kov černé


Bioinformatika a výpočetní biologie KFC/BIN. I. Přehled

Bioinformatika a výpočetní biologie KFC/BIN. I. Přehled Bioinformatika a výpočetní biologie KFC/BIN I. Přehled RNDr. Karel Berka, Ph.D. Univerzita Palackého v Olomouci Definice bioinformatiky (Molecular) bio informatics: bioinformatics is conceptualising biology
