rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu"

Transkript

1 Genealogie

2 Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině

3 Genealogické studie

4 AD autosomáln lně dominantní Každý nemocný jedinec má nemocného jednoho z rodičů (kromě de novo mutací) Muži i ženy mají stejné riziko získat mutovanou alelu Riziko výskytu onemocnění pro každého potomka nemocného rodiče je 50% Pouze jedna mutavaná alela stačí k projevu onemocnění Zdraví potomci nemocného rodiče nepředávají znak svým potomkům AD onemocněním: brachydaktylie, achondroplázie, polycystická choroba ledvin, hypercholesterolemie, Huntingtonova chorea, neurofibromatóza

5 AD autosomáln lně dominantní Brachydaktylie mutace v genu BMPR (bone morphogenetic proteine receptor) - kóduje receptor pro kostní morfogenetický protein; porucha kontroly formace chrupavky, která se později stává kostí Achondroplázie bodová mutace (záměna nukleotidu) v genu FGFR 3 (fibroblast growth factor receptor) Krátké končetiny během embryonálního vývoje a dětství rostou kosti končetin pomaleji; velikost těla je průměrná U dětí obtíže: řeč, sluch, dýchání - léčitelné

6 AD autosomáln lně dominantní Polycystická choroba ledvin; 1/ Mutace genu PKD1 (protein polycystin) Do dospělosti žádné symptomy Později vysoký krevní tlak, krev v moči, bolest v břišní dutině, infekce močových cest, selháníčinnosti ledvin 1/3 pacientů cysty v játrech 10% pacientů rozšíření (dilatace) žil v mozku mozkové příhody Léčit infekce, regulovat tlak krve, dialýza, transplantace ledvin

7 AD autosomáln lně dominantní Hypercholesterolemie (1/500 heterozygotů) - mutace v genu kódujícím receptor pro LDL (low density lipoprotein) v cytosolu změna struktury receptoru LDL komplex proteinu a lipidu; hlavní transportní protein cholesterolu Cholesterol vstupuje do buněk endocytózou - pomocí clathrinu fúze s lysozomy proteinová a lipidová složka LDL se zde hydrolýzou oddělí na aminokyseliny, cholesterol, mastné kyseliny Exogenní cholesterol po vstupu do buňky potlačuje syntézu endogenního cholesterolu udržování vyvážené hladiny Mutace receptoru cholesterol cirkuluje v krvi ateroskleróza, infarkt (35-40 let), úmrtí 60 let

8 AD autosomáln lně dominantní Huntingtonova chorea (HD) - mutace v genu kódujícím protein huntingtin (expanze trinukleotidů - CAG) 5 konec genu repetic CAG Pacienti CAG repetic CAG = kód pro glutamin 1/ Postižení nervových buněk mozku; ve středním věku mírné změny osobnosti, během let postupná ztráta kontroly mentálních a fyzických schopností HD není léčitelná; některé symptomy lze léky zpomalit

9 AR autosomáln lně recesivní Muži i ženy - stejná pravděpodobnost výskytu, obě pohlaví mají stejnou výbavu autosomů Čím je onemocnění v populaci vzácnější, tím spíše se jedná o potomka rodičů s příbuzenským sňatkem Všichni potomci nemocného jedince jsou přenašeči Riziko výskytu choroby pravděpodobnost ¼ pro sourozence nemocného jedince Pravděpodobnost heterozygotního stavu pro zdravé sourozence nemocného jedince je 2/3 AR onemocnění: cystická fibróza, fenylketonurie

10 AR fenylketonurie Vrozená metabolická vada (1/10000) Mutace (recesivní) v genu kódujícím fenylalaninhydroxylasu Zdraví rodiče (heterozygoti) Všichni potomci nemocného jedince jsou přenašeči Riziko opakování choroby pro sourozence 25% fenylalanin tyrosin fenylalaninhydroxylasa Kyselina fenylpyrohroznová (v moči) Akumulace fenylalaninu v tělních tekutinách Poškození vývoje CNS v dětství 5. den po narození screening novorozenců Dieta

11 AR cystická fibróza Mutace (recesivní) v genu CFTR - protein reguluje funkci kanálků buněčné membrány transmembránový přenos chloridových iontů (Cl - ) Kavkazská rasa 1/2500 postižených Defekt membrány epiteliálních buněk Zvýšená koncentrace Na+ a Cl- v potu Nejvíce postiženy plíce a pankreas Opakované infekce plic, nedostatek pankreatických enzymů Smrt kolem 26 roku

12 AR cystická fibróza

13 GD rodokmen (X-vázan zané onemocnění) GD nemoci: vitamin D-rezistentní křivice Přenos není z otce na syna Postižení muži přenášejí mutovanou alelu pouze na dcery Pokud je žena heterozygot, její potomci budou nositeli mutované alely s pravděpodobností 50% Pro muže bývá postižení s větším rozsahem (i letální) muži nemají druhou nemutovanou alelu, která by postižení kompenzovala U žen je vyšší pravděpodobnost výskytu GD choroby mutovanou alelu mohou získat jak od postiženého otce tak od postižené matky

14 GR genealogie (X-vázan zané onemocnění) Není přenos z otce na syna. Muži jsou postiženi častěji než ženy pouze jedna alela (jeden X chromosom) není kompenzována druhou alelou Postižení synové získají mutovanou alelu od matky, synové heterozygotní matky mají 50% riziko zisku mutované alely Dcery heterozygotní matky jsou přenašečkami (50%) Dcery postižených mužů se stanou přenašečkami (100%) Typickým projevem GR onemocnění je výskyt u muže v I. generaci a 50% výskyt u jeho vnuků (III. generace) GR nemoci: hemofilie, barvoslepost, Duschenova/Beckerova muskulární dystrofie

15 GR genealogie (X-vázan zané onemocnění) Není přenos z otce na syna. Muži jsou postiženi častěji než ženy Hemofilie A 1/ postižených mužů - mutace v genu pro tvorbu koagulačního faktoru VIII Hemofilie B mutace genu pro koagulační faktor IX

16 KRÁLOVSK LOVSKÁ HEMOFILIE

17 GONOSOMÁLNĚ RECESIVNÍ ONEMOCNĚNÍ Duchenova muskulární dystrofie 1/ 3300 chlapců geneticky letální Nové mutace frekvence 10-4 Svalová ochablost nastupuje mezi rokem Mutace v genu kódujícím protein dystrofin (bodové mutace, částečné duplikace nebo delece) Dystrofin integrita membrány svalových buněk Beckerova muskulární dystrofie mírnější projev, reprodukce u 70% jedinců

18 Holandrická dědičnost Pouze s výskytem u mužů, jedná se o mutovanou formu genu lokalizovaném na Y chromosomu Výskyt v linii mužů celého rodu Příklad: srostlé prsty pavučinovitou tkání

19 Příklady O jaký typ dědičnosti se jedná? Autosomálně dominantní typ dědičnosti

20 Příklady Polycystická choroba ledvin (AD) Napište genotypy členů rodokmenu! I/1 Aa I/2 aa II/1 aa II/2 Aa II/3 aa II/4 Aa (50%), aa (50%) A* a a A*a aa a A*a aa

21 Příklady Cystická fibróza (AR) Napište genotypy členů rodokmenu! I/1 Aa I/2 Aa II/1 AA (1/3) nebo Aa (2/3) II/2 AA (1/3) nebo Aa (2/3) II/3 aa II/4 AA (25%), nebo Aa (50%), a nebo aa (25%) A a* A a* AA Aa* Aa* a*a*

22 Příklady AUTOSOMÁLNĚ RECESIVNÍ ONEMOCNĚNÍ (FENYLKETONURIE) 1 2 Určete pravděpodobné genotypy jedinců v genealogickém schématu! Stanovte pravděpodobnost postižení plodů 1 a 2! 1 postižení, heterozygot 1/3 (2/3 x 1/2) 2 postižení, heterozygot 100%

23 Příklady GONOSOMÁLNĚ RECESIVNÍ ONEMOCNĚNÍ (Beckerova muskulární dystrofie) 1 2 Určete pravděpodobné genotypy jedinců v genealogickém schématu! Stanovte pravděpodobnost postižení plodů 1, 2 a 3! 1 a 3 postižení chlapci s 50% pravděpodobností 2 postižení 3

24 Inbreeding příbuzenské sňatky Příklad příbuzenského sňatku určete pravděpodobnost výskytu defektu (AR - aa) u zatím nenarozeného potomka! otec heterozygot 100% (1) x matka heterozygot 1/3 (2/3 x 1/2) potomek: 1 x 1/3 x 1/4( pravděpodobnost aa konstituce) = pravděpodobnost výskytu AR

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto

Více

DĚDIČNOST Monogenní dědičnost Multifaktoriální dědičnost Expresivita Penetrance Gen (strukturní gen

DĚDIČNOST Monogenní dědičnost Multifaktoriální dědičnost Expresivita Penetrance Gen (strukturní gen DĚDIČNOST Předtím než se začneme věnovat jednotlivým typům genetické determinace a přenosu genetické informace z rodičovské generace na potomky, objasníme si některé termíny. Monogenní dědičnost znamená

Více

CZ.1.07/1.5.00/

CZ.1.07/1.5.00/ Projekt: Příjemce: Digitální učební materiály ve škole, registrační číslo projektu CZ.1.07/1.5.00/34.0527 Střední zdravotnická škola a Vyšší odborná škola zdravotnická, Husova 3, 371 60 České Budějovice

Více

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto

Více

Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

KBI/GENE Mgr. Zbyněk Houdek

KBI/GENE Mgr. Zbyněk Houdek Genealogie KBI/GENE Mgr. Zbyněk Houdek Rodokmenové schéma Shromáždění informací o rodině je 1. důležitým krokem v genetickém poradenství. Rodokmenové schéma musí být srozumitelné a jednoznačné. Poskytuje

Více

genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace

Více

Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální

Více

NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ

NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ Doc. MUDr. A. Šantavá, CSc. Ústav lékařské genetiky a fetální medicíny LF a UP Olomouc Význam genetiky v diagnostice neuromuskulárních onemocnění Podílí

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Genetické aspekty vrozených vad metabolismu

Genetické aspekty vrozených vad metabolismu Genetické aspekty vrozených vad metabolismu Doc. MUDr. Alena Šantavá, CSc. Ústav lékařské genetiky a fetální medicíny FN a LF UP Olomouc Johann Gregor Mendel (1822-1884) Sir Archibald Garrod britský pediatr

Více

Hemofilie dnes. Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost

Hemofilie dnes. Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost Hemofilie dnes Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost Zdroje: Evropský sociální fond v ČR Evropská unie Ministerstvo školství, mládeže a tělovýchovy OPVK

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou

Více

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka

Více

Genetika člověka GCPSB

Genetika člověka GCPSB Inovace předmětu Genetika člověka GCPSB Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/28.0032 Genetika člověka / GCPSB 7. Genetika

Více

MUTACE mutageny: typy mutací:

MUTACE mutageny: typy mutací: MUTACE charakteristika: náhodné změny v genotypu organismu oproti normálu jsou poměrně vzácné z hlediska klinické genetiky, jsou to právě mutace, které způsobují genetické choroby nebo nádorové bujení

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21

Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21 Glosář - Cestina alely aneuploidie asistovaná reprodukce autozomálně dominantní autozomálně recesivní BRCA chromozom chromozomová aberace cytogenetický laborant de novo Různé formy genu, které se nacházejí

Více

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Hemofilie Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Definice hemofilie Nevyléčitelná vrozená krvácivá choroba s nedostatkem plazmatických faktorů FVIII hemofile A FIX hemofile

Více

Buňky, tkáně, orgány, soustavy

Buňky, tkáně, orgány, soustavy Lidská buňka buněčné organely a struktury: Jádro Endoplazmatické retikulum Goldiho aparát Mitochondrie Lysozomy Centrioly Cytoskelet Cytoplazma Cytoplazmatická membrána Buněčné jádro Jadérko Karyoplazma

Více

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky

Více

Předmět: PŘÍRODOPIS Ročník: 8. Časová dotace: 2 hodiny týdně. Konkretizované tématické okruhy realizovaného průřezového tématu

Předmět: PŘÍRODOPIS Ročník: 8. Časová dotace: 2 hodiny týdně. Konkretizované tématické okruhy realizovaného průřezového tématu Předmět: PŘÍRODOPIS Ročník: 8. Časová dotace: 2 hodiny týdně Výstup předmětu Rozpracované očekávané výstupy září popíše základní rozdíly mezi buňkou rostlin, živočichů a bakterií a objasní funkci základních

Více

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům Karlova univerzita, Lékařská fakulta Hradec Králové Obor: všeobecné lékařství - test z biologie Vyberte tu z nabídnutých odpovědí (1-5), která je nejúplnější. Otázka Odpověď 1. Mezi organely membránového

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

+ F1 F2 + TRANSPLANTAČNÍ PRAVIDLA. Inbrední kmen A. Inbrední kmen B. Genotyp aa. Genotyp bb. Genotype ab. ab x ab. aa ab ab bb Genotypy

+ F1 F2 + TRANSPLANTAČNÍ PRAVIDLA. Inbrední kmen A. Inbrední kmen B. Genotyp aa. Genotyp bb. Genotype ab. ab x ab. aa ab ab bb Genotypy IMUNOGENETIKA II TRANSPLANTAČNÍ PRAVIDLA Inbrední kmen A Inbrední kmen B - F1 - e x F2 y y TRANSPLANTAČNÍ PRAVIDLA Inbrední kmen A Inbrední kmen B - F1 - e 3 4 x 3 4 F2 - - y y Transplantace orgánů,, které

Více

Genetická "oblast nejasnosti" u HCH: co to znamená? Genetický základ

Genetická oblast nejasnosti u HCH: co to znamená? Genetický základ Novinky ve výzkumu Huntingtonovy nemoci. Ve srozumitelném jazyce. Napsáno vědci. Určeno široké huntingtonské veřejnosti. Genetická "oblast nejasnosti" u HCH: co to znamená? Přechodní alely a alely s redukovanou

Více

Deficit antagonisty IL-1 receptoru (DIRA)

Deficit antagonisty IL-1 receptoru (DIRA) www.printo.it/pediatric-rheumatology/cz/intro Deficit antagonisty IL-1 receptoru (DIRA) Verze č 2016 1. CO JE DIRA? 1.1 O co se jedná? Deficit antagonisty IL-1Receptoru (DIRA) je vzácné vrozené onemocnění.

Více

Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice

Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice Účinnost k 1. 12. 2014 Doporučený postup č. 3 Genetické laboratorní vyšetření v reprodukční genetice Stav změn: 1. vydání Základním předpokladem genetického laboratorního vyšetření v reprodukční genetice

Více

Deficit mevalonátkinázy (MKD) (nebo hyper IgD syndrom)

Deficit mevalonátkinázy (MKD) (nebo hyper IgD syndrom) www.printo.it/pediatric-rheumatology/cz/intro Deficit mevalonátkinázy (MKD) (nebo hyper IgD syndrom) Verze č 2016 1. CO JE MKD? 1.1 Co je to? Deficit mevalonákinázy patří mezi dědičná onemocnění. Jedná

Více

Jak se objednat na vyšetření?

Jak se objednat na vyšetření? Jak se objednat na vyšetření? Ke genetické konzultaci nebo vyšetření v těhotenství odesílá praktický lékař, specialista nebo ošetřující gynekolog, který vystaví žádanku k vyšetření. Vyšetření provedená

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

Genetika populací a. Gentika populací. Autogamická populace

Genetika populací a. Gentika populací. Autogamická populace Genetika populací a člověka Mgr. Aleš RUDA Gentika populací Populace = všichni jedinci téhož druhu, kteří obývají vdaném čase stejné území GENOFOND soubor alel v gametách všech členů populace GENETIKA

Více

Praktické cvičení z genetiky: Dědičnost kvalitativních znaků, mimojaderná dědičnost, genetika člověka

Praktické cvičení z genetiky: Dědičnost kvalitativních znaků, mimojaderná dědičnost, genetika člověka Praktické cvičení z genetiky: Dědičnost kvalitativních znaků, mimojaderná dědičnost, genetika člověka Dědičnost kvantitativních znaků 1) Plemena Bantam a Plymouth představují dva kontrastní typy slepic.

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

TERATOGENEZA ONTOGENEZA

TERATOGENEZA ONTOGENEZA TERATOGENEZA ONTOGENEZA Vrozené vývojové vady (VVV) Jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo 3-5 % novorozenců.

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Duchenneova/Beckerova svalová dystrofie a Parent Project

Duchenneova/Beckerova svalová dystrofie a Parent Project Duchenneova/Beckerova svalová dystrofie a Parent Project Oddělení lékařské genetiky FN Brno Renata Gaillyová Vzácné nemoci V EU se nemoc považuje za vzácnou, jestliže postihuje méně než 5 osob z každých

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní

Více

1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,

Více

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat.

Pojem plemeno je používán pro rasy, které vznikly záměrnou činností člověka, např. plemena hospodářských zvířat. POPULAČNÍ GENETIKA Populační genetika se zabývá genetickými zákonitostmi v definovaných souborech jedinců téhož druhu. Genetické vztahy uvnitř populace jsou komplikované, a proto se v populační genetice

Více

Význam genetického vyšetření u pacientů s mentální retardací

Význam genetického vyšetření u pacientů s mentální retardací Význam genetického vyšetření u pacientů s mentální retardací Šantavá, A., Hyjánek, J., Čapková, P., Adamová, K., Vrtěl, R. Ústav lékařské genetiky a fetální medicíny FN a LF UP Olomouc Mentální retardace

Více

Rozštěpy rtu a patra Vrozená vývojová vada, kterou dnes již nemusíte (na první pohled) vidět Pohled genetika. Renata Gaillyová, OLG FN Brno

Rozštěpy rtu a patra Vrozená vývojová vada, kterou dnes již nemusíte (na první pohled) vidět Pohled genetika. Renata Gaillyová, OLG FN Brno Rozštěpy rtu a patra Vrozená vývojová vada, kterou dnes již nemusíte (na první pohled) vidět Pohled genetika Renata Gaillyová, OLG FN Brno Lékařská genetika Interdisciplinární spolupráce Preventivní medicína

Více

Suchá krevní skvrna (Suchá krevní kapka, Dried Blood Spot)

Suchá krevní skvrna (Suchá krevní kapka, Dried Blood Spot) Suchá krevní skvrna (Suchá krevní kapka, Dried Blood Spot) Kapka kapilární krve nanesena na testovací kartičku filtračního papíru a vysušena odběr z prstu ušního lalůčku z patičky (u novorozenců) odběrová

Více

Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár

Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár schopen spontánní koncepce, ale žena není schopna donosit

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika 1/6 3.2.11.18 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost

Více

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza Iveta Valášková ivalskova@fnbrno.cz Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza nejčastěji se vyskytující autozomálně recesivní dědičná metabolická porucha v zakavkazské

Více

Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI

Více

Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem

Více

Suchá krevní skvrna (Suchá krevní kapka, Dried Blood Spot)

Suchá krevní skvrna (Suchá krevní kapka, Dried Blood Spot) Suchá krevní skvrna (Suchá krevní kapka, Dried Blood Spot) Kapka kapilární krve (z prstu, ušního lalůčku nebo v případě novorozenců z patičky), je nanesena na testovací kartičku filtračního papíru a vysušena

Více

Pohled genetika na racionální vyšetřování v preventivní kardiologii

Pohled genetika na racionální vyšetřování v preventivní kardiologii Pohled genetika na racionální vyšetřování v preventivní kardiologii Tomáš Freiberger Genetická laboratoř, Centrum kardiovaskulární a transplantační chirurgie Brno, ČR Osnova Genetické faktory vzniku KV

Více

Mo M nogenně d ědič i n č á onemocn c ění Renata Gaillyová LF ZL

Mo M nogenně d ědič i n č á onemocn c ění Renata Gaillyová LF ZL Monogenně dědičná onemocnění Renata Gaillyová LF 2008 - ZL Genetická onemocnění Vrozené chromosomové aberace Monogenně podmíněné nemoci Polygenně a multifaktoriálně dědičná onemocnění Mitochondriální choroby

Více

DMPK (ZNF9) V DIFERENCOVANÝCH. Z, Kroupová I, Falk M* M

DMPK (ZNF9) V DIFERENCOVANÝCH. Z, Kroupová I, Falk M* M FISH ANALÝZA m-rna DMPK (ZNF9) V DIFERENCOVANÝCH TKÁNÍCH PACIENT IENTŮ S MYOTONICKOU DYSTROFI FIÍ Lukáš Z, Kroupová I, Falk M* M Ústav patologie FN Brno *Biofyzikáln lní ústav AVČR R Brno Definice MD Myotonická

Více

Zvláš. áštnosti studia genetiky člověka: nelze z etických důvodd experimenty a selekci. ství potomků. ším m prostřed (sociáln ůže sledovat maximáln

Zvláš. áštnosti studia genetiky člověka: nelze z etických důvodd experimenty a selekci. ství potomků. ším m prostřed (sociáln ůže sledovat maximáln Genetika člověka Zvláš áštnosti studia genetiky člověka: Na člověku nelze z etických důvodd vodů provádět experimenty a selekci. Člověk k mám většinou za život velmi malé množstv ství potomků. Fenotyp

Více

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00

Více

Biochemie kosti. Anatomie kosti. Kostní buňky. Podpůrná funkce. Udržování homeostasy minerálů. Sídlo krvetvorného systému

Biochemie kosti. Anatomie kosti. Kostní buňky. Podpůrná funkce. Udržování homeostasy minerálů. Sídlo krvetvorného systému Biochemie kosti Podpůrná funkce Udržování homeostasy minerálů Sídlo krvetvorného systému Anatomie kosti Haversovy kanálky okostice lamely oddělené lakunami Kostní buňky Osteoblasty Osteocyty Osteoklasty

Více

ZÁKLADY FUNKČNÍ ANATOMIE

ZÁKLADY FUNKČNÍ ANATOMIE OBSAH Úvod do studia 11 1 Základní jednotky živé hmoty 13 1.1 Lékařské vědy 13 1.2 Buňka - buněčné organely 18 1.2.1 Biomembrány 20 1.2.2 Vláknité a hrudkovité struktury 21 1.2.3 Buněčná membrána 22 1.2.4

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Mutační změny genotypu

Mutační změny genotypu Mutační změny genotypu - změny genotypu: segregace, kombinace + MUTACE - náhodné změny Mutace - genové - spontánní - chromozómové - indukované (uměle vyvolané) - genomové A) Genové mutace - změna (ztráta)

Více

Kardiovaskulární systém

Kardiovaskulární systém Kardiovaskulární systém Arterio-nebo ateroskleróza (askl.) pomalu postupující onemocnění tepen, při němž je ztluštělá intima fibrózními uloženinami, které postupně zužují lumen a současně jsou místem vzniku

Více

Výskyt MHC molekul. RNDr. Ivana Fellnerová, Ph.D. ajor istocompatibility omplex. Funkce MHC glykoproteinů

Výskyt MHC molekul. RNDr. Ivana Fellnerová, Ph.D. ajor istocompatibility omplex. Funkce MHC glykoproteinů RNDr. Ivana Fellnerová, Ph.D. Katedra zoologie, PřF UP Olomouc = ajor istocompatibility omplex Skupina genů na 6. chromozomu (u člověka) Kódují membránové glykoproteiny, tzv. MHC molekuly, MHC molekuly

Více

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch

Více

Vrozené trombofilní stavy

Vrozené trombofilní stavy Vrozené trombofilní stavy MUDr. Dagmar Riegrová, CSc. Název projektu: Tvorba a ověření e-learningového prostředí pro integraci výuky preklinických a klinických předmětů na Lékařské fakultě a Fakultě zdravotnických

Více

Vrozené (metabolické) choroby

Vrozené (metabolické) choroby Vrozené (metabolické) choroby A. E. Garrod - 1908 - alkaptonurie, cystinurie, pentosurie, albinismus Geneticky podmíněna nepřítomnost nebo modifikace specifických proteinů Příčiny = mutace bodová delece

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

Seznam šablon - Přírodopis

Seznam šablon - Přírodopis Seznam šablon - Přírodopis Autor: Mgr. Vlastimila Bártová Vzdělávací oblast: Člověk a jeho svět Tematický celek: Člověk Ročník: 8 Číslo Označení Název Materiál Využití Očekávané výstupy Klíčové kompetence

Více

HEMOFILIE A a B. Alžběta Petruchová, Vendula Trunčíková, Dominika Reňáková, Milena Vévodová, Petra Peňázová, Jan Dobrovolný

HEMOFILIE A a B. Alžběta Petruchová, Vendula Trunčíková, Dominika Reňáková, Milena Vévodová, Petra Peňázová, Jan Dobrovolný HEMOFILIE A a B Alžběta Petruchová, Vendula Trunčíková, Dominika Reňáková, Milena Vévodová, Petra Peňázová, Jan Dobrovolný Projevy onemocnění Hemofilie A a B jsou dědičné krvácivé choroby, které jsou způsobeny

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

ANAMNESTICKÝ ZDRAVOTNÍ DOTAZNÍK

ANAMNESTICKÝ ZDRAVOTNÍ DOTAZNÍK ANAMNESTICKÝ ZDRAVOTNÍ DOTAZNÍK Pro účely preventivní sportovně-kardiologické prohlídky ve zdravotnickém zařízení ProCorde s.r.o. v Chomutově. Příjmení, jméno:............................... Rodné číslo:.....................

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

www.printo.it/pediatric-rheumatology/cz/intro

www.printo.it/pediatric-rheumatology/cz/intro www.printo.it/pediatric-rheumatology/cz/intro Candle Verze č 2016 1. CO JE CANDLE 1.1 Co je to? Chronická atypická neutrofilní dermatóza s lipodystrofií a zvýšenou teplotou (CANDLE) patří mezi vzácná dědičná

Více

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D.

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D. GENETICKÉ PORADENSTVÍ u pacientů s epidermolysis bullosa congenita MUDr. Renata Gaillyová, Ph.D. Homozygot jedinec, který zdědil po rodičích tutéž alelu. Jedinec nebo genotyp s identickými alelami v daném

Více

Nemoc a její příčiny

Nemoc a její příčiny Nemoc a její příčiny Definice zdraví a nemoc zdraví stav úplné tělesné, duševní a sociální pohody s harmonickým průběhem vitálních procesů nemoc porucha zdraví poškození určitého počtu bb. (bb. reagují

Více

Základní škola Náchod Plhov: ŠVP Klíče k životu

Základní škola Náchod Plhov: ŠVP Klíče k životu VZDĚLÁVACÍ OBLAST: VZDĚLÁVACÍ OBOR: PŘEDMĚT: ČLOVĚK A PŘÍRODA PŘÍRODOPIS PŘÍRODOPIS 8.ROČNÍK Téma, učivo Rozvíjené kompetence, očekávané výstupy Mezipředmětové vztahy Poznámky Úvod, opakování učiva ue

Více

Živočišné tkáně. Vznik - histogeneze diferenciace proliferace

Živočišné tkáně. Vznik - histogeneze diferenciace proliferace Živočišné tkáně Vznik - histogeneze diferenciace proliferace Soudržnost, adhezivita. Mezibuněčná hmota!! - vláknitá kolagen, elastin amorfní voda, anorg, ionty, glykosoaminoglykany a strukturální glykoproteiny

Více

SEMINÁRNÍ PRÁCE Z BIOLOGIE

SEMINÁRNÍ PRÁCE Z BIOLOGIE SEMINÁRNÍ PRÁCE Z BIOLOGIE TÉMA: G. J. MENDEL & GENETIKA 24. duben 2006 Ondrej ZAHRADNÍČEK, MB Gregor Johann Mendel (20.7.1822-6.1.1882) "Otec genetiky" Gregor Johann Mendel, muž, považovaný za zakladatele

Více

Vaše cesta ke zdravému dítěti

Vaše cesta ke zdravému dítěti Vážení klienti, Vaše cesta ke zdravému dítěti Preimplantační genetická diagnostika Sanatorium REPROMEDA patří již téměř 15 let mezi přední česká i evropská centra reprodukční medicíny. Již od počátku své

Více

Kouření vonných listů, kořeníči drog se vyskytuje v lidské společnosti tisíce let. Do Evropy se tabák dostal po roce 1492 v té době byl považován za

Kouření vonných listů, kořeníči drog se vyskytuje v lidské společnosti tisíce let. Do Evropy se tabák dostal po roce 1492 v té době byl považován za Mgr. Jakub Dziergas Střední škola, Havířov-Šumbark, Sýkorova 1/613, příspěvková organizace Tento výukový materiál byl zpracován v rámci akce EU peníze středním školám - OP VK 1.5. Výuková sada OBČANSKÁ

Více

Předmět: VÝCHOVA KE ZDRAVÍ Ročník: 8. Časová dotace: 2 hodiny týdně. Konkretizované tématické okruhy realizovaného průřezového tématu

Předmět: VÝCHOVA KE ZDRAVÍ Ročník: 8. Časová dotace: 2 hodiny týdně. Konkretizované tématické okruhy realizovaného průřezového tématu Předmět: VÝCHOVA KE ZDRAVÍ Ročník: 8. Časová dotace: 2 hodiny týdně Výstup předmětu Rozpracované očekávané výstupy září popíše základní rozdíly mezi buňkou rostlin, živočichů a bakterií a objasní funkci

Více

Příbuznost a inbreeding

Příbuznost a inbreeding Příbuznost a inbreeding Příbuznost Přímá (z předka na potomka). Souběžná (mezi libovolnými jedinci). Inbreeding Inbrední koeficient je pravděpodobnost, že dva geny přítomné v lokuse daného jedince jsou

Více

GENETIKA A JEJÍ ZÁKLADY

GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky

Více

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

Vrozené vývojové vady. David Hepnar

Vrozené vývojové vady. David Hepnar Vrozené vývojové vady David Hepnar Vrozené vývojové vady (VVV) jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo

Více

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že

Více