Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Rozměr: px
Začít zobrazení ze stránky:

Download "Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek"


1 Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek

2 Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto genech pak dochází k odchylkám vůči normální mendelovské dědičnosti a tato dědičnost se nazývá pohlavně vázaná nebo gonozomální.

3 Chromozomy X a Y Liší se tvarem a velikostí, kdy Y je mnohem menší. Velká heterologníčást chromozomu X tvoří zvláštní vazbovou skupinu. Naopak geny na malém homologním úseku obou chromozomů podléhají synapsi a může mezi nimi probíhat c.-o. (g. neúplně vázané na pohlaví).

4 Geny úplně vázané na pohlaví V genotypu muže je pouze 1 X ch. hemizygotní. Pseudodominance je fenotypový projev recesivní alely způsobený nepřítomností párové alely dominantní např. u hemizygota. U čl. jsou to např. recesivní alely pro hemofílii (poruchu srážlivosti), daltonismus (barvoslepost).

5 X-vázaná recesivní dědičnost (např.daltonismus): Zdravá žena X D X D, Žena přenašečka X D X d, Nemocná žena X d X d, Zdravý muž X D Y, Nemocný muž X d Y otec matka dcery synové X d Y X D X D X D X d X D Y X D Y X d X d X D X d X d Y X D Y X D X d X D X D X D X d X d Y X D X d X D X d X d X d, X D Y X d Y X D Y X d Y

6 Dědičnost křížem Od postiženého otce zdědí defekt dcery (přenašečky) a matka přenašečka zase přenáší chorobu na ½ synů (nemocní) a ½ dcer (přenašečky). Tento typ dědičnosti také způsobuje nápadný rozdíl v četnosti výskytu mezi pohlavými. Choroby se totiž mnohem častěji vyskytují u jedinců XY (1:10 000) než u XX (1: ).

7 X-vázaná dominantní a Y-vázaná dědičnost X-vázané dominantní poruchy jsou vzácné: stav je exprimován i přenášen u obou pohlaví a vyskytuje se 2x častěji u žen než mužů (křivice). Y-vázaná dědičnost (z otce na syna) geny na chromozomu Y (produkce samčího hormonu, zrání spermií). Nazýváme ji také dědičnost holoandrická. Protože neexistuje partnerská alela, má příslušný gen heterozygotní zastoupení (buď-anebo). Geny na ch. Y jsou exprimovány pouze u mužů a otcové je přenášejí na všechny své syny.

8 Dědičnost pohlavím ovládaná nebo ovlivněná Dědičnost pohlavím ovládaná když se gen lokalizovaný na autozomu manifestuje pouze u jednoho pohlaví (např. rozštěp močové trubice - onemocní jen muži, ale ženy ji mohou přenášet). Dědičnost pohlavím ovlivněná heterozygotní sestava páru alel autozomálního genu se projeví fenotypově jako dominantní u jednoho a recesivní u druhého pohlaví (např. předčasná plešatost, za kterou odpovídá alela P PP, Pp muži jsou plešatí a pp ne. U žen je to tak, že pouze PP ženy mají tuto vadu, Pp a pp mají vlasy normální). V roce 2005 vědecký tým popsal první známý gen spojený s předčasnou plešatostí. Gen leží na pohlavním chromozomu X, který se přenáší v mateřské linii. Objev vysvětluje fakt, proč se plešatý muž tak často podobá svému dědečkovi z matčiny strany. Předčasná plešatost, ale často postihuje i muže, jejichž dědečci z matčiny strany si vlasový porost udrželi až do vysokého věku. Na mužské plešatosti se podílejí ještě další geny.

9 Dědičnost pohlavně vázaná - řízena geny na gonozómech 1. Gen pro červenou barvu očí W je vázán na X chromozóm, mutovaná forma w (bílé oči) je recesivní. Divoké zbarvení těla je podmíněno přítomností genu Z na X chromozómu, sestava zz odpovídá žlutému zbarvení. Jaké bude potomstvo, pokud křížíte bělookého samečka s divokým zbarvením se samičkou červenookou, žlutou?

10 Řešení: WW, Ww červené oči; ww bílé oči ZZ, Zz divoké zbarvení; zz žluté zb. Z X w Y z * X W z X W Samička červené o. a divoké zb. Sameček červené o. a žluté zb. 1:1 g. z X W z X W Z X w Zz XX Ww Zz XX Ww Y z X W Y z X W Y

11 Druhá možnost: Z X w Y * z X W z X w Samička červené nebo bílé o. a divoké zb. Sameček červené nebo bílé o. a žluté zb. 1:1:1:1 g. z X W z X w Z X w Y Zz XX Ww z X W Y Zz XX ww z X w Y

12 Dědičnost pohlavně ovlivněná heterozygotní situace u páru alel (na autozómu) se fenotypově projeví jako dominantní u jednoho pohlaví a u druhého pohlaví jako recesivní 2. Krávy a býci MM jsou mahagonoví, mm -červenostrakatí. Býci heterozygoti jsou mahagonoví, krávy jsou červenostrakaté. Červenostrakatá kráva byla křížena s červenostrakatým býkem. Jaký je fenotyp a genotyp potomků?

13 Řešení: Červenostrakatá k. XX Mm : XY mm červenostrakatý b. genotypový štěpný poměr - 1:1:1:1 g. X M X m X m XX Mm XX mm Y m XY Mm XY mm fenotypově - 2 červenostr. k. a 1 červenostr. a 1 mahagonový b.

14 Druhá možnost: Červenostrakatá k. XX mm : XY mm červenostrakatý b. genotypový štěpný poměr - 1:1 g. X m X m X m XX mm XX mm Y m XY mm XY mm fenotypově 1 červenostr. k. a 1 červenostr. b.

15 Dědičnost pohlavně ovládaná gen na autozómu se projeví jen u jednoho pohlaví 3a. U bojovnic je délka ploutví pohlavně ovládaná. Samci AA a Aa mají dlouhé ploutve, aa mají ploutve krátké. Samice mají vždy krátké ploutve. Jak bude vypadat potomstvo vzniklé křížením heterozygotního samce s homozygotně recesivní samicí? 3b. Jak bude vypadat potomstvo vzniklé křížením dominantně homozygotního samce s homozygotně recesivní samicí?

16 Řešení 3a: krátkoploutvá samička XX aa * dlouhoploutvý sameček XY Aa Genotypový štěpný poměr 1:1. Fenotypově krátkoploutvý sameček 1:1 krátkoploutvá samička. g. X A Y a X a XX Aa XY aa X a XX Aa XY aa

17 Řešení 3b: krátkoploutvá samička XX aa * dlouhoploutvý sameček XY AA Genotypový štěpný poměr 1:1. Fenotypově dlouhoploutvý sameček 1:1 krátkoploutvá samička. g. X A Y A X a XX Aa XY Aa X a XX Aa XY Aa

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické Gonozomáln lní dědičnost Mgr. Aleš RUDA Chromozomové určení pohlaví autozomy gonozomy člověk má 22 párůp autozomů a 1 pár p gonozomů označen ení pohlavních chromozomů: : X a Y. jsou možné celkem 3 kombinace:


Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). Orphanet - Volně přístupné webové stránky s informacemi


Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;

Více Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem



GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou


Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21

Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21 Glosář - Cestina alely aneuploidie asistovaná reprodukce autozomálně dominantní autozomálně recesivní BRCA chromozom chromozomová aberace cytogenetický laborant de novo Různé formy genu, které se nacházejí


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 Mutace Mutace - náhodná změna v genomu organismu - spontánní


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce


Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Hemofilie Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Definice hemofilie Nevyléčitelná vrozená krvácivá choroba s nedostatkem plazmatických faktorů FVIII hemofile A FIX hemofile



TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST DĚDIČNOST POHLAVNĚ VÁZANÁ geny lokalizované na pohlavních chromozomech X nebo Y řídí vznik nejen primárních pohlavních znaků přenos genů na potomky je vázán na přenos



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je


Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil



TERATOGENEZA ONTOGENEZA TERATOGENEZA ONTOGENEZA Vrozené vývojové vady (VVV) Jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo 3-5 % novorozenců.


MUTACE mutageny: typy mutací:

MUTACE mutageny: typy mutací: MUTACE charakteristika: náhodné změny v genotypu organismu oproti normálu jsou poměrně vzácné z hlediska klinické genetiky, jsou to právě mutace, které způsobují genetické choroby nebo nádorové bujení


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Hemofilie dnes. Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost

Hemofilie dnes. Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost Hemofilie dnes Investice do rozvoje a vzdělávání Operační program Vzdělávání pro konkurenceschopnost Zdroje: Evropský sociální fond v ČR Evropská unie Ministerstvo školství, mládeže a tělovýchovy OPVK


Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické


1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Druhová a mezidruhová hybridizace

Druhová a mezidruhová hybridizace Druhová a mezidruhová hybridizace Obsah Druhová a mezidruhová hybridizace... 1 Obsah... 1 Monohybridní křížení... 1 Dihybridní křížení... 2 Polyhybridní křížení... 3 Souhrn Mendelismus v dědičnosti kvalitativních


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


Dědičnost pohlaví a znaků s pohlavím souvisejících

Dědičnost pohlaví a znaků s pohlavím souvisejících Dědičnost pohlaví a znaků s pohlavím souvisejících Rozmnožování Nepohlavní amixis, bez zvýšení genotypové proměnlivosti Pohlavní amfimixis střídání 2n a n fáze, zvýšení genotypové proměnlivosti Hermafrodité:


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Stavba chromozomů Lidský karyotyp

Stavba chromozomů Lidský karyotyp Přípravný kurz z biologie 5 Stavba chromozomů Lidský karyotyp 3. 12. 2011 Mgr. Kateřina Caltová Stavba chromozomů Lidský karyotyp Chromozom buněčná struktura v jádře eukaryotních buněk řec. chroma = barva,


Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že


Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého



OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 Genetika a plemenné znaky u králíků Chov králíků, II. Kategorie Johana Vinšová *13. 8. 1997 Žabonosy 113, Kolín 2, 280 02 ZO ČSCH Kolín 1 Práce započata dne: 25. 11. 2014

Více Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových


Imunologie krevní skupiny 109.3059

Imunologie krevní skupiny 109.3059 Imunologie krevní skupiny 109.3059 Strana 1 z 22 SIMULAČNÍ SOUPRAVA PRO AB0 & Rh TYPIZACI KRVE Strana 2 z 22 SOMERSET educational (Pty) LTD SIMULOVANÉ SOUPRAVY PRO STANOVENÍ KREVNÍ SKUPINY AB0 a Rh FAKTORU


Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Chromozomová teorie dědičnosti KBI / GENE Mgr. Zbyněk Houdek Proč octomilka a T.H. Morgan? Drosophila melanogaster ideální objekt pro genetický výzkum : Rychlý reprodukční cyklus a snadný chov v laboratorních


genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace


Praktické cvičení z genetiky: Dědičnost kvalitativních znaků, mimojaderná dědičnost, genetika člověka

Praktické cvičení z genetiky: Dědičnost kvalitativních znaků, mimojaderná dědičnost, genetika člověka Praktické cvičení z genetiky: Dědičnost kvalitativních znaků, mimojaderná dědičnost, genetika člověka Dědičnost kvantitativních znaků 1) Plemena Bantam a Plymouth představují dva kontrastní typy slepic.


Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka

Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka Genetická determinace zbarvení vlasů u člověka Genetická determinace zbarvení očí u člověka znaky polygenní, které však při studiu dědičnosti v rodinách vykazují zdánlivě jednoduchou dědičnost výzkumem


Genetická "oblast nejasnosti" u HCH: co to znamená? Genetický základ

Genetická oblast nejasnosti u HCH: co to znamená? Genetický základ Novinky ve výzkumu Huntingtonovy nemoci. Ve srozumitelném jazyce. Napsáno vědci. Určeno široké huntingtonské veřejnosti. Genetická "oblast nejasnosti" u HCH: co to znamená? Přechodní alely a alely s redukovanou


=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům Otázka: Genetika Předmět: Biologie Přidal(a): t.klodnerova REALIZACE GENETICKÉ INFORMACE, MUTACE, ZÁKLADNÍ GENETICKÉ POJMY: GEN, ZNAK, ALELA, GENOTYP, FENOTYP, HOMOZYGOT, HETEROZYGOT, HYBRIDIZACE, DOMINANCE,


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití).

QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití). QTL u koní Dnešní plemena koní se odvozují od divokých předků, od: Equus przewalskii (kůň Převalského-kertaka) Equus gmelini (kůň západní) Equus gracilis (kůň severský) Pojmy plemenitby Plemeno je skupina


Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským



21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka


Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi


Základní barvy holuba domácího

Základní barvy holuba domácího Základní barvy holuba domácího Ing. Juraj Kafka Národní komise pro standardy holubů ČSCH 5 Popis původního zbarvení Columba livia, (L.) modré černopruhé 4 3 1 2 1. Krk část opeření s rozprostřenými pigmentovými


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů 9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou


Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability

Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability Heritabilita Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability h 2 = V A / V P Výpočet genetické determinance znaku h 2 = V G / V P Heritabilita závisí


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


Praktická cvičení z biologie Letní semestr

Praktická cvičení z biologie Letní semestr Univerzita Palackého v Olomouci Ústav biologie, Lékařská fakulta Praktická cvičení z biologie Letní semestr Olomouc 2014 Podpořeno projektem EU: Implementace laboratorní medicíny do systému vzdělávání


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti



CZ.1.07/1.5.00/ Projekt: Příjemce: Digitální učební materiály ve škole, registrační číslo projektu CZ.1.07/1.5.00/34.0527 Střední zdravotnická škola a Vyšší odborná škola zdravotnická, Husova 3, 371 60 České Budějovice


Příbuznost a inbreeding

Příbuznost a inbreeding Příbuznost a inbreeding Příbuznost Přímá (z předka na potomka). Souběžná (mezi libovolnými jedinci). Inbreeding Inbrední koeficient je pravděpodobnost, že dva geny přítomné v lokuse daného jedince jsou



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D.

GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D. GENETIKA Mendelistická dědičnost 2014 Doc. MVDr. Eva Bártová, Ph.D. Nauka o DĚDIČNOSTI (HEREDITA) a PROMĚNLIVOSTI (VARIABILITA) termín genetika poprvé použil v r. 1905 W. BATESON název genetika odvozen
