Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Rozměr: px
Začít zobrazení ze stránky:

Download "Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek"

Transkript

1 Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek

2 Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela shodných alel. Heterozygotní g. kdy je naopak fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela rozdílných alel. Dominance a recesivita kdy funkce jedné alely převládá (dominuje) a ve fenotypu tak překrývá účinek druhé alely, která je recesivní. Úplná dominance fenotypový projev dominantní alely u org. s homozygotně dominantním genotypem (AA dominantní fenotyp) nebo fenotypový projev recesivní alely u org. s homozygotně recesivním genotypem (aa recesivní fenotyp). Neúplná dominance kdy funkce dominantní alely nestačí u heterozygota (Aa) zajistit fenotyp dané vlastnosti ve stejné míře jako u dominantního homozygota (AA). Kodominance žádná z rozdílných alel svým fenotypovým projevem ani nepřevládá, ani není potlačována a u heterozygota se objevují projevy těchto rozdílných alel společně vedle sebe. Zpětné křížení křížení heterozygotního křížence s homozygotním rodičem (recesivní jedinec).

3 Mendel a jeho hrách G. Mendel dobře zvolil jako pokusný matriál hrách setý (Pisum sativum) květní korunní plátky jsou uzavřeny pyl nemůže ven ani dovnitř (samooplození). Variety hrachu jsou velmi málo variabilní z generace na generaci inbrední (křížení příbuzných jedinců). Mendel se zaměřil na studium dědičnosti 1 znaku (výška r. monohybridní z.) nebo studium protichůdných znaků (vysoké x nízké r.) x jeho předchůdci více znaků složité výsledky. Mendel odhalil, že jsou vlastnosti určeny nedělitelnými jednotkami genetické informace (geny, alely forma g.)

4 Mendelovo monohybridní křížení Mendel křížil vysoké a nízké r. stejně vysoké r. (pouze vysoké, nízký h. zmizel). Dále zkoumal potomstvo vysokých r. vysoké a nízké r. (3:1). Nízký vrůst recesivní alela x vysoký v. dominantní a. Takto zkoumal dědičnost dalších 6 znaků: tvar a barvu semen, tvar a barvu lusků, barvu a postavení květů. Při těchto pokusech ještě odhalil pojmy jako homozygot x heterozygot.

5 Křížení, rodičovská generace a generace potomků, hybrid Při pohlavním rozmnožování dochází ke křížení prostřednictvím gamet (haploidní=1n) rodičů - meióza, tím dochází k přenosu 1 mateřské a 1 otcovské alely na potomka (segregace a.). Jedince vznikající křížením nazýváme hybridy. Rodičovskou generaci označujeme symbolem P (parentální). Generaci potomků značíme F (filiální), kde 1. generace potomků je F1 a 2. F2.

6 Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865 J. G. Mendel: 1. Zákon o uniformitě hybridů F 1 generace a identitě reciprokých křížení: Při vzájemném křížení homozygotních rodičů (P) vzniká první filiální generace (F 1 ) potomků, kteří jsou genotypově i fenotypově jednotní. homozygoti B B b Bb Bb b Bb Bb

7 1. Mendelův zákon a lidé Ušní lalůčky některých lidí mají jsou přisedlé (prodloužený krční úpon f) x volné (F). Muž homozygot s volnými lalůčky (FF) x žena h. s přisedlými l. (ff). Všechny jejich děti budou mít volné uši (Ff), protože alela F je dominantní. homozygoti F F f Ff Ff f Ff Ff

8 2. Mendelův zákon (křížení heterozygotů) Alelické páry se u heterozygotů vzájemně nesměšují. Potomstvo F 2 vzniklé křížením heterozygotních jedinců F 1 gen. je nestejnorodé a dochází tak k fenotypovému štěpení. Vzájemným křížením heterozygotů Rr vzniká potomstvo genotypově i fenotypově různorodé. S pravděpodobností 25% mohou vznikat potomci homozygotně dominantní, s pravděpodobností 50% potomci heterozygotní a s pravděpodobností 25% potomci homozygotně recesivní (viz. kombinačníčtverec = Punnettova tabulka). Genotypový štěpný poměr je 1:2:1, fenotypový štěpný poměr je 3:1 při úplné dominanci nebo 1:2:1 při neúplné dominanci. heterozygoti R r R RR Rr r Rr rr

9 Dědičnost krevních skupin Vznik krevní skupiny u čl. je dán větším počtem alel: 2 dominantní I A, I B 1 recesivní I 0. Krevní skupiny: Stav, kdy se při vyjádření znaku uplatní obě alely stejně kodominance. Skupina A Skupina B Skupina AB Skupina 0 I A I A I B I B I A I B i 0 i 0 I A i 0 I B i 0

10 3. Zákon o volné kombinovatelnosti vloh Stejné zabarvení značí stejný genotyp. Mezi alelami genů, které leží v různých chromozomech, existuje vzájemná volná a nezávislá kombinovatelnost. V potomstvu F2 pak vznikne tolik zygotických genotypových kombinací, kolik je jich možných mezi na sobě matematicky nezávislými veličinami. Při zkoumání 2 alel současně dochází k téže pravidelné segregaci. Máme-li 2 dihybridy AaBb může každý tvořit 4 různé gamety (AB, Ab, ab, ab). Při vzájemném křížení tedy z těchto 2 gamet vzniká 16 různých zygotických kombinací. Některé kombinace se ovšem opakují, takže nakonec vzniká pouze 9 různých genotypů. V F2 generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

11 3. Mendelův zákon: Máme 2 dihybridy GgYy (rodiče heterozygotní ve 2 různých párech alel). Každý z nich může vytvořit pohlavní buňky - gamety obsahující se stejnou pravděpodobností 1 ze 4 možných kombinací mezi alelami těchto 2 alelových párů: GY, Gy, gy, gy.

12 Alelové série Původní mendelovská představa byla, že pro každý gen existují pouze 2 alelové formy. V současnosti víme, že tato hypotéza není vždy platná, protože existují geny se třemi, čtyřmi a více alelami = alelová série. Např. gen pro barvu srsti králíků c má 4 alely: c (albín), c h (himalájský), c ch (činčila), c + (standardní). V homozygotním stavu má každá z alel svůj charakteristický fenotyp. Může vzniknout 6 různých barevných heterozygotů: c h c, c ch c, c + c, c ch c h, c + c h a c + c ch. Standardní a. je dominantní nad ostatními, ch je neúplně dominantní nad h a c. Alela h je úplně dominantní nad c (c + >c ch >c h >c).

13 Výjimky z Mendelových zákonů Penetrace a expresivita. Genové interakce. Genetická vazba. Na pohlaví vázané vlivy. Polygenní stavy. Mitochondriální dědičnost.

14 Penetrace a expresivita Neúplná penetrace jestliže se u jedinců s odpovídajícím genotypem neprojevuje určitý znak (u člověka polydaktylie). Neúplná penetrace, pak může vést k nesprávnému určení genotypů. Expresivita znak se nemanifestuje stejným způsobem u všech jedinců, kteří ho mají. Neúplná penetrace a expresivita ukazují, že cesta mezi genotypem a příslušným fenotypem může být značně ovlivněna (vnější prostředí, genetické pozadí genové interakce).

15 Genové interakce Mendel a jeho současníci předpokládali, že 1 gen 1 znak. Dnes víme, že jsou to situace vzácné. Znak vzniká spolupůsobením více genů: Pokud na vzniku znaku spolupracují 2 geny (např. barva květu hrachoru musí být přítomna alespoň vždy 1 dominantní alela od každého genu CR, aby byl květ barevný, jinak je bílý.) komplementarita.

16 Epistáze Další genovou interakcí je epistáze, kdy určitá alela jednoho genu potlačuje projev jiného genu. Vyskytuje se případ i recesivní epistáze, kdy recesivní alela jednoho g. potlačuje projev dominantní alely jiného g. Např. krevní skupina dítěte je určována nejen alelami genu I A, I B a i 0 po rodičích, ale navíc dominantní a. H nebo vzácnou recesivní a. h. Pokud se vyskytne ojedinělá homozygotní konstituce hh pak má dítě bez ohledu na konstituci alel AB0 vždy krevní skupinu 0. Avšak dítě má většinou dominantní a. H, pak může mít krevní skupinu AB.

17 Duplicitní interakce V určitých případech může být jeden znak různými g. a k jeho vyjádření pak obvykle stačí jediná dominantní alela jednoho z těchto g. = duplicitní interakce. Geny mají v tomto případě stejnou funkci, ale nejspíše i evoluční původ (duplikace určitého genu). Jindy se účinek těchto genů sčítá, pak mluvíme o kumulativní duplicitní interakci. Projev znaku je pak počtem dominantních alel dvou nebo více genů.

18 Pleiotropie Existují případy, kdy jeden určitý gen může ovlivnit více fenotypových znaků pleiotropní g. Člověk g. pro fenylketonurii (recesivní mutantní a. způsobuje tvorbu toxických sloučenin, které se kumulují v mozku mentální postižení). Dále působí na syntézu barviva melaninu světlejší vlasy.

19 Geny velkého účinku Kvalitativní znaky jsou ovlivňovány geny velkého účinku (majorgeny). Určují dva nebo více alternativních projevů (barva květů, tvar semen, krevní skupiny atd.). Kvantitativní (metrické) znaky (výška těla, hmotnost, IQ) řízeny velkým počtem genů (polygeny = geny malého účinku).

20 Vazba genů Mendelův zákon o nezávislé kombinovatelnosti alel platí jen pro alely, které jsou uloženy na různých párech homologních chromozomů a mohou se tedy při meiotické segregaci nezávisle kombinovat. Soubor genů 1 chromozomu (neboli soubor parů alel 1 páru homolog. ch.) tvoří tzv. vazbovou skupinu genů. Základní poznatky o vazbě genů zformuloval na základě pokusů s drosofilou T.H. Morgan 2 Morganovy zákony.

21 Morganovy zákony 1. Zákon o uložení genů: Geny v chromozomech jsou uspořádány lineárně v řadě za sebou ve zcela určitých chromozomových místech, genových lokusech. 2. Zákon o vazbě genů: Soubor genů umístěných v určitém chromozomu tvoří vazbovou skupinu. Všechny geny téhož ch. jsou vzájemně vázány. Nezávisle kombinovatelné jsou jen s geny jiných vazbových skupin. Počet vazbových skupin je dán počtem párů homologních ch.

22 Genetická rekombinace Změna v uspořádání alel vzájemně vázaných genů, která je možná jen náhodnou strukturní výměnou částí nesesterských chromatid mezi párovými ch. K těmto výměnám dochází v profázi 1. meiotického dělení (ve stádiu bivalentů). Tento proces se nazývá crossing-over. Rozlišujeme jednoduchý crossing-over (vzniká na základě jednoho překřížení a chromatidy si při něm prohodí konce) a vícenásobný crossing-over (několikanásobném překřížení).

23 Síla vazby genů Pravděpodobnost vzniku crossing overu mezi vzdálenými geny je větší než mezi geny blízkými. O síle vazby mezi geny nás informuje Morganovo číslo. Dá se zjistit pořadí a vzdálenost genů (cm - centimorgan) na chromozomu. Tak můžeme získat i genetickou mapu chromozomu.

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil

Více

Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem

Více

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u

Více

Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého

Více

12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat

Více

13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových

Více

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v

Více

Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského

Více

Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

Druhová a mezidruhová hybridizace

Druhová a mezidruhová hybridizace Druhová a mezidruhová hybridizace Obsah Druhová a mezidruhová hybridizace... 1 Obsah... 1 Monohybridní křížení... 1 Dihybridní křížení... 2 Polyhybridní křížení... 3 Souhrn Mendelismus v dědičnosti kvalitativních

Více

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů

Více

Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho

Více

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním

Více

genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace

Více

Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem

Více

GENETIKA A JEJÍ ZÁKLADY

GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou

Více

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce

Více

Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci

Více

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že

Více

Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje

Více

"Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Základy Genetiky

Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT . Základy Genetiky "Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Základy Genetiky ROSTLINNÁ BUŇKA aaaaaaaa jádro mitochondrie chromatin (DNA) aaaaaaaa aaaaaaa aaaaaaaa aaaaaaaa plastid

Více

GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D.

GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D. GENETIKA Mendelistická dědičnost 2014 Doc. MVDr. Eva Bártová, Ph.D. Nauka o DĚDIČNOSTI (HEREDITA) a PROMĚNLIVOSTI (VARIABILITA) termín genetika poprvé použil v r. 1905 W. BATESON název genetika odvozen

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový

Více

Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák

Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák KVANTITATIVNÍ GENETIKA dědičnost kvantitativních znaků ZNAKY KVALITATIVNÍ: gen znak barva hrachu: žlutá zelená (i komplikovaněji penetrace, epresivita,

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)

Více

Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským

Více

Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Obecná genetika Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Ing. Roman Longauer, CSc. Ústav zakládání a pěstění lesů, LDF MENDELU Brno Tento projekt je spolufinancován Evropským

Více

Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti

Více

Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka

Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka Genetická determinace zbarvení vlasů u člověka Genetická determinace zbarvení očí u člověka znaky polygenní, které však při studiu dědičnosti v rodinách vykazují zdánlivě jednoduchou dědičnost výzkumem

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

RURGenetika zápočtový program Programování II

RURGenetika zápočtový program Programování II RURGenetika zápočtový program Programování II Rudolf Rosa cvičící: Doc. RNDr. Pavel Töpfer, CSc. Obsah Specifikace...1 Původní specifikace...1 Upravená specifikace...2 Program...3 třída Populace...4 Datové

Více

S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef

Více

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům

=schopnost organismů uchovávat soubory genetických informací a předávat je potomkům Otázka: Genetika Předmět: Biologie Přidal(a): t.klodnerova REALIZACE GENETICKÉ INFORMACE, MUTACE, ZÁKLADNÍ GENETICKÉ POJMY: GEN, ZNAK, ALELA, GENOTYP, FENOTYP, HOMOZYGOT, HETEROZYGOT, HYBRIDIZACE, DOMINANCE,

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ

Více

Základy genetiky 1. PŘEDNÁŠKA

Základy genetiky 1. PŘEDNÁŠKA Základy genetiky 1. PŘEDNÁŠKA Genetika jako vědní obor vznikla na počátku 20. Století, ačkoli její principy se využívaly zejména ve formě křížení a šlechtění užitkových rostlin a domestikaci hospodářských

Více

Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):

Více

GENETIKA. zkoumá dědičnost a proměnlivost organismů

GENETIKA. zkoumá dědičnost a proměnlivost organismů GENETIKA zkoumá dědičnost a proměnlivost organismů Dědičnost: schopnost organismů uchovávat informace o své struktuře a funkčních schopnostech a předávat je svým potomkům Proměnlivost (variabilita) je

Více

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010

Více

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch

Více

GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných

Více

žádný c.o. NCO ABC dva c.o. DCO AbC dva c.o. DCO abc žádný c.o. NCO abc žádný c.o. NCO ABC jeden c.o. SCO Abc jeden c.o. SCO abc žádný c.o.

žádný c.o. NCO ABC dva c.o. DCO AbC dva c.o. DCO abc žádný c.o. NCO abc žádný c.o. NCO ABC jeden c.o. SCO Abc jeden c.o. SCO abc žádný c.o. Rekominční mpování B C B C c c gmety žádný c.o. NCO BC dv c.o. DCO C dv c.o. DCO Bc žádný c.o. NCO c B C B C c c žádný c.o. NCO BC jeden c.o. SCO c jeden c.o. SCO BC žádný c.o. NCO c Tříodové mpování u

Více

Stavba chromozomů Lidský karyotyp

Stavba chromozomů Lidský karyotyp Přípravný kurz z biologie 5 Stavba chromozomů Lidský karyotyp 3. 12. 2011 Mgr. Kateřina Caltová Stavba chromozomů Lidský karyotyp Chromozom buněčná struktura v jádře eukaryotních buněk řec. chroma = barva,

Více

Příbuznost a inbreeding

Příbuznost a inbreeding Příbuznost a inbreeding Příbuznost Přímá (z předka na potomka). Souběžná (mezi libovolnými jedinci). Inbreeding Inbrední koeficient je pravděpodobnost, že dva geny přítomné v lokuse daného jedince jsou

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů 9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou

Více

OBECNÁ GENETIKA 2006. - jeho dílo (Versuche über Pflanzen Hybriden - Pokusy s rostlinnými hybridy )

OBECNÁ GENETIKA 2006. - jeho dílo (Versuche über Pflanzen Hybriden - Pokusy s rostlinnými hybridy ) OBECNÁ GENETIKA 2006 - přesné datum narození Mendela (20.7.1822) - kdy uveřejnil Mendel výsledky své práce (8. 2. a 8. 3. 1865) - kdy byl Mendel pokřtěn (22. 7. 1822 v Dolním Vražném) - kde se narodil

Více

Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Chromozomová teorie dědičnosti KBI / GENE Mgr. Zbyněk Houdek Proč octomilka a T.H. Morgan? Drosophila melanogaster ideální objekt pro genetický výzkum : Rychlý reprodukční cyklus a snadný chov v laboratorních

Více

Mendelistická genetika

Mendelistická genetika Mendelova práce Se svými hybridizačními pokusy s hrachem (Pisum L.) začal Mendel v roce 1856 v klášterní zahradě na Starém Brně. Experimenty prováděl do roku 1868, když byl zvolen za opata kláštera. V

Více

Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k

Více

21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST

21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka

Více

Genetika populací. Doposud genetika na úrovni buňky, organizmu

Genetika populací. Doposud genetika na úrovni buňky, organizmu Doposud genetika na úrovni buňky, organizmu - jedinec nás nezajímá - pouze jeho gamety a to jako jedny z mnoha = genofond = soubor všech gamet skupiny jedinců Populace mnoho různých definic - skupina organizmů

Více

PRAKTIKUM Z OBECNÉ GENETIKY

PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie lizal@sci.muni.cz 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

MENDELISMUS GENOVÉ INTERAKCE NEMENDELISMUS

MENDELISMUS GENOVÉ INTERAKCE NEMENDELISMUS MENDELISMUS GENOVÉ INTERAKCE NEMENDELISMUS Biologie a genetika BSP, LS4, 2014/2015, Ivan Literák 4. GENOVÉ INTERAKCE Dva (příp. více) geny ovlivňují 1 znak (kvalitativní!) 2 major-geny se ovlivňují -

Více

Praktická cvičení z biologie Letní semestr

Praktická cvičení z biologie Letní semestr Univerzita Palackého v Olomouci Ústav biologie, Lékařská fakulta Praktická cvičení z biologie Letní semestr Olomouc 2014 Podpořeno projektem EU: Implementace laboratorní medicíny do systému vzdělávání

Více

1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,

Více

GENETIKA V MYSLIVOSTI

GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností

Více

Rozmnožování buněk Vertikální přenos GI. KBI / GENE Mgr. Zbyněk Houdek

Rozmnožování buněk Vertikální přenos GI. KBI / GENE Mgr. Zbyněk Houdek Rozmnožování buněk Vertikální přenos GI KBI / GENE Mgr. Zbyněk Houdek Buněčný cyklus Buňky vznikají z bb. a jedinou možnou cestou, jak vytvořit více bb. je jejich dělením. Vertikální přenos GI: B. (mateřská)

Více

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením

Více

KBI/GENE Mgr. Zbyněk Houdek

KBI/GENE Mgr. Zbyněk Houdek Genealogie KBI/GENE Mgr. Zbyněk Houdek Rodokmenové schéma Shromáždění informací o rodině je 1. důležitým krokem v genetickém poradenství. Rodokmenové schéma musí být srozumitelné a jednoznačné. Poskytuje

Více

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít?

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Základy genetiky Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Johann Gregor Mendel (1822 1884) O jeho životě byl mnich, zakladatel genetiky a opat augustiniánského kláštera v Brně studium

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností

Více

Virtuální svět genetiky 1

Virtuální svět genetiky 1 Chromozomy obshují mnoho genů pokud nejsou rozděleny crossing-overem, pk lely přítomné n mnoh lokusech kždého homologního chromozomu segregují jko jednotk během gmetogeneze. Rekombinntní gmety jsou důsledkem

Více

Cvičení z genetiky a cytogenetiky na Přírodovědecké fakultě UK v Praze

Cvičení z genetiky a cytogenetiky na Přírodovědecké fakultě UK v Praze Cvičení z genetiky a cytogenetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Studenti si tvoří vlastní studijní plán, ale musejí naplnit povinný limit kreditů Velká pestrost

Více

Krevní skupiny a jejich genetika. KBI / GENE Mgr. Zbyněk Houdek

Krevní skupiny a jejich genetika. KBI / GENE Mgr. Zbyněk Houdek Krevní skupiny a jejich genetika KBI / GENE Mgr. Zbyněk Houdek Systém AB0 V lidské populaci se vyskytují jedinci s krevní skupinou A, B, AB a 0. Jednotlivé krevní skupiny se od sebe liší tím zda erytrocyty

Více