Maligní nádory. Nádorová onemocnění. Protoonkogeny. Maligní nádorová onemocnění. Protoonkogeny - amplifikace sekvence DNA.

Rozměr: px
Začít zobrazení ze stránky:

Download "1.12.2009. Maligní nádory. Nádorová onemocnění. Protoonkogeny. Maligní nádorová onemocnění. Protoonkogeny - amplifikace sekvence DNA."


1 NÁDORY BENIGNÍ Nádorová onemocnění rostou v původním loţisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazivní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu, metastazují Maligní nádory - zvýšená proliferační aktivita, nereaguje na fyziologické regulační podněty - invazivně prorůstá do okolní tkáně, indukuje vlastní angiogenezu (krevní zásobení), metastazuje Maligní nádorová onemocnění MALIGNÍ PROCES VÍCESTUPŇOVÝ několik na sobě nezávislých změn v genomu jedné buňky premaligní stadium / maligní stadium mutace v protoonkogenech, tumor-supresorových genech, mutátorových genech FAKTORY VNĚJŠÍHO PROSTŘEDÍ Chemické látky polycyklické a aromatické uhlovodíky, nitrosaminy, těţké kovy, mykotoxiny, azbest.. Fyzikální vlivy ionizující záření, UV záření Biologické vlivy DNA viry (adenoviry, herpes viry, hepdnaviry, papovaviry), retroviry (HIV, HTVL-1) VROZENÉ DISPOSICE vrozené defekty reparace DNA EPIGENETICKÉ FAKTORY genomický imprinting - souvislost s metylací bazí genů Protoonkogeny PROTOONKOGENY geny se skrytým onkogenním potenciálem REGULACE BUNĚČNÉHO MNOŢENÍ NA VŠECH ÚROVNÍCH SIGNÁLNÍCH DRAH většinou somatické mutace dominantní charakter MUTACE bodové substituce, delece, adice chromosomální přestavby translokace, amplifikace inserce virového genomu Protoonkogeny PROTOONKOGENY úloha v regulaci buněčného dělení Růstové faktory: sis (virus opičího sarkomu) - PDGF, hst (heparin-binding secretory transforming gene) FGF Receptory růstových faktorů: proteiny s tyrosinkinázovou aktivitou - erb-b (virus ptačí erytroblastózy) receptor pro EGF Proteiny vázající GTP (G-proteiny): genová rodina ras Tyrosinkinázy plasmatické membrány: fosforylace tyrosinu abl (virus Abelsonovy myší leukemie), src (virus Rousova sarkomu) Cytoplasmatické proteiny: MAP-kinázy Raf, MEK, MAP (signál cytoplasma jádro) Transkripční faktory: protoonkogen fos, jun, erb-a Kontrola buněčného cyklu: protoonkogen myc, myb stimulují přechod z G1 do S fáze Protoonkogeny - amplifikace sekvence DNA Protoonkogen Her-2/neu (erbb2) Human epidermal growth factor receptor-2 kóduje receptor pro epidermální růstový faktor s tyrosinkinázovou aktivitou amplifikace Her-2/neu Prognostický a diagnostický marker u karcinomů prsu i dalších nádorů (např. nádory močového měchýře) Rodina protoonkogenů myc (virus myeloblastózy kuřat) N-myc neuroblastom L-myc malobuněčné karcinomy plic regulace buněčného cyklu - geny časné odpovědi aktivace např. růstovými faktory nebo amplifikace genu 1

2 Protoonkogeny Protoonkogen K-ras produkt je protein, který váţe nukleotid nesoucí guanin asociace s receptorem, který se váţe s různými růstovými faktory po aktivaci receptoru je uvolněn GDP vázaný ke K-ras a naváţe se GTP GTP aktivuje K-ras, ten předá signál fosforylací Raf první v kaskádě MAP-kináz Tato signální dráha vede v jádře k aktivaci transkripčních faktorů nebo genů časné odpovědi jako např. c-myc K-ras se normálně inaktivuje hydrolýzou GTP na GDP Některé mutace v K-ras znemoţní inaktivaci nebo vedou k aktivitě K-ras bez vazby k GTP Výskyt nádorových onemocnění v populaci / v rodině Výskyt sporadický mutace v somatických buňkách výskyt v rodokmenu odpovídá frekvenci onemocnění v populaci Familiární výskyt (5-10%) - děděná predisposice časnější vznik nádoru, multifokální / bilaterální výskyt, více členů v rodokmenu postiženo shodným typem nádoru Mendelovský typ dědičnosti dědičnost AD mutace zárodečná (recesivní) (APC, BRCA1, BRCA2, WT, Rb1) 2. mutace postnatální (somatická, recesivní) Tumor-supresorové geny MUTACE V TUMOR-SUPRESOROVÝCH GENECH - RECESIVNÍ CHARAKTER JEDNA MUTOVANÁ ALELA MŮŽE BÝT ZDĚDĚNA AUTOSOMÁLNĚ DOMINATNÍ TYP DĚDIČNOSTI DĚDÍ SE DISPOSICE Sporadický výskyt nádorového onemocnění: dvě somatické mutace, výskyt odpovídá frekvenci onemocnění v populaci Familiární výskyt: 1. mutace zárodečná, 2. somatická predisposice, časný vznik nádorů, multifokální nedo bilaterální výskyt, více členů rodiny má stejný typ nádoru Hypotéza dvou zásahů (Knudson) Ztráta vrozené heterozygozyty (LOH) vazebná analýza například gen pro esterázu D (marker) je ve vazbě s genem Rb1 Tumor-supresorové geny vybrané příklady Lokalizace nádoru Gen Chromosom Mechanismus působení oči (retinoblastom), kosti, prsa, plíce, močový měchýř, prostata Rb 13q14 ledviny a další orgány (WAGR syndrom) různé typy nádorů (cca 50% všech mutace TP53) tlusté střevo (familiární adenomatózní polypóza, sporadické kolorektální karcinomy) a nádory dalších orgánů prsa, ovaria, prostata, larynx, zažívací trakt, pankreas WT1/WT2 TP53 APC BRCA1 BRCA2 11p13 17p13 5q21 17p21 13q12-q13 Regulace buněčného cyklu Regulace buněčného cyklu Pozastavení cyklu v G1 fázi, transkripční faktor Regulace hladiny beta kateninu (složka cytoskeletu), buněčné proliferace a adheze Chybný repair dvouvláknových zlomů DNA Tumor-supresorové geny příčiny ztráty funkce Tumor-supresorové geny příklad Rb1 (nejčastěji mikrodelece) Delece mohou postihnout různé části genu Mitotická nondisjunkce Mitotická rekombinace Uniparentální disomie (oba chromosomy jsou původem od jednoho z rodičů) Bodová mutace Inaktivace produktu (vyvázání virovým antigenem) MUTACE V SUPRESOROVÝCH GENECH MAJÍ RECESIVNÍ CHARAKTER JEDNA MUTOVANÁ ALELA MŮŢE BÝT ZDĚDĚNA Hypotéza dvou zásahů (Knudson) 2

3 Vazebná analýza: marker gen (alela 1 a 2) a gen BRCA1 Výsledek elektroforézy; u matky opakovaně diagnostikován a odoperován nádor prsu (30 a 45 let) u dcery nádor prsu diagnostikován ve 28 letech Stanovení, zda jde o sporadický nebo familiární výskyt nádoru prsu - marker gen v těsné vazbě s genem BRCA1 Alely Matka Otec Dcera nádor prsu dcery 1 2 BRCA1 + BRCA1 - BRCA1 +/+ BRCA1 + nondisjunkce... Delece, mitotická BRCA1 - BRCA1 -, např. substituce BRCA1 - Vyšetřené buňky matky, otce a dcery: nebo leukocyty Ztráta heterozygosity (LOH) v buňkách nádoru prsu - + TUMOR-SUPRESOROVÝ GEN Rb Rb gen reguluje buněčnou proliferaci produkt jaderný protein p105 fosforylovaná / defosforylovaná forma defosforylovaná forma Rb proteinu se váţe k transkripčnímu faktoru E2F inaktivace E2F ovlivní expresi polymerázy alfa a PCNA, který interaguje s polymerázou delta blokáda přechodu z G1 do S fáze fosforylovaný Rb je neaktivní, komplex E2F - Rb se oddělí a uvolní E2F nastane přechod z G1 do S fáze Tumor-supresorové geny vybrané příklady: RB1 Retinoblastom nádor očí Většinou výskyt u dětí Výskyt sporadický unilaterální, 60% pacientů Familiární výskyt 40% pacientů - zárodečná mutace, bilaterální onemocnění Mutace v obou genech jsou nezbytné pro manifestaci nádorové choroby Tumor-supresorové geny příčiny ztráty funkce Hybridizace (Southern blot) s DNA normálních jedinců a s DNA pacientů s jednostranným nebo oboustranným Velikost fragmentů (kb) 9,8 7,5 6,2 5,3 normální pacient s bilaterálním tumor pacient s unilaterálním tumor Restrikční mapa fragment (kb) FIBROBLASTY normální pacient s bilaterálním tumor restrikční mapa: velikost a pořadí HindIII restrikčních fragmentů v Rb1 genu pacient sunilaterálním tumor RETINOBLASTOM Somatická mutace Tumor-supresorový gen WT1 WT1 kóduje zink-finger protein - transkripční aktivátor nebo represor (podle buněčného kontextu) EGR1, PDGFA, CSF-1, TGF-ß, Pax2 Formace genitourinárního systému a mesenchymálních tkání Ztráta funkce genu WT komplex neoplasií, které vznikají jiţ během embryonálního vývoje, velká histologická variabilita Wilmsův tumor (1 : ), WAGR (Wilms tumor aniridia genitourinary anomalies mental retardation) Wilmsův tumor sporadicky - 95% případů Familiární autosomálně dominantní onemocnění dětí - 5% případů S hereditární formou jsou asociované nejméně dva lokusy na chromosomu 11p 11p13 (WT1) a 11p15 (WT2) Ztráta funkce genu rychlý vývoj tubulů ledvin, v ledvinách dítětě pak zůstávají shluky buněk, které se dělí stejně rychle jako během embryogeneze a z nich vzniká neoplasie Germline mutace 6,2 6,2 Dvě odlišné somatické mutace 7,5 5,3 7,5 3

4 Tumor-supresorový gen WT1 Genomický imprinting Imprinting u Wilmsova tumoru maternální chromosom Iniciální mutace je na chromosomu paternálním Tumor-supresorový gen TP53 Tumor-supresorový gen TP53 regulace průběhu interfáze stráţce genomu kontrolní bod mezi G1/S (velký repair), S/G2 (post-replikační kontrolní bod) protein p53 transkripční faktor mnoha genů pozastavení buněčného cyklu vyvolání a koordinace apoptózy mutovaný TP53 u více neţ 50% lidských nádorů (jak sporadických, tak familiárních) bodové mutace v kritických oblastech genu TRANSKRIPČNÍ FAKTOR bodové mutace v kritických oblastech genu (toxiny, záření, viry) mutace nalezeny jak u sporadických tak familiárních nádorových onemocnění Tumor-supresorový gen TP53 V buňkách s mutovaným genem TP53 se akumuluje vyšší počet mutací v dalších genech, mutace nejsou reparovány, v průběhu doby můţe nastat maligní transformace buňky. Tumor-supresorový gen APC (adenomatous polyposis coli) nádory tlustého střeva, kdy maligní transformaci předchází stadium adenomatosní polyposy (FAP) sporadický výskyt nebo dominantně děděné onemocnění 1 / lidí má prekancerosní polypy FAP začíná v časném mládí, během let nádor tlustého střeva několikastupňový proces, na kterém se účastní několik genů tumor-supresorový gen APC chromosom 5q21 Mutace v APC startují vznik nádoru tlustého střeva Např. bodová mutace záměna tyminu za adenin vede k posunu čtecího rámečku a k následnému zkrácení proteinu, coţ destabilizuje replikační enzymy Mutace v genu APC narušují integritu cytoskeletu a adhesi epiteliálních buněk Mutace narušuje vazbu aktinu a beta-kateninu a tím porušuje buněčnou adhezi Mutovaný APC ve spojení s dalšími proteiny zvyšuje migraci buněk, vyvolává navýšení mitotické aktivity (zvýšení hladiny betakateninu a následně zvýšená transkripce onkogenu c-myc) a neschopnost zániku buněk apoptózou 4

5 Tumor-supresorový gen APC Tumor-supresorový gen APC FAP geny asociované s progresí onemocnění APC (5q21) - hyperplastický střevní epitel Hypometylace DNA časné adenomy Mutace onkogenu K-ras (12p) střední adenomatozní stadium DCC gen (18q) pozdní stadium polypů Gen TP53 (17p) - karcinom Další změny - metastázování Tumor-supresorové geny BRCA1, BRCA2 Při familiárním výskytu nádoru prsu nebo prsu a ovarií jsou v současné době v genetickém poradenství vyuţívány dva tumor-supresorové geny BRCA1 (breast cancer 1) a BRCA2 (breast cancer 2) Produkty obou genů BRCA tvoří komplexy s produkty dalších genů a podílejí se tak na regulaci průběhu buněčného cyklu a při repairu DNA Děděná mutace BRCA1 se vyskytuje v rodinách s familiárním výskytem nádoru prsu, ovarií anebo prsu a ovarií Zárodečná mutace genu BRCA2 je asociována s výskytem nádoru prsu ţen i muţů, se vznikem nádoru prostaty, pankreatu a s Fanconiho anemií Mimo těchto dvou klíčových tumor-supresorových genů se na maligní transformaci podílejí mutace v dalších genech (polygenní model nádorového onemocnění): tumor-supresorový gen TP53 tumor-supresorový gen PTEN (phosphatase and tensin homolog on chromosome ten) kódující protein s fosfatázovou aktivitou - gen PTEN je mutovaný v pokročilých stadiích mnoha typů nádorů protoonkogen H-ras1 gen RAD51 Spolu s genotypem (genotyp se týká sekvence genů) se na maligní transformaci podílí i epigenotyp buňky (imprinting) Tumor-supresorové geny BRCA1, BRCA2 Tumor-supresorové geny BRCA1, BRCA2 Gen BRCA1 (17q21) reguluje buněčný cyklus, inhibuje růst buněk mléčných ţláz Protein se uplatňuje při reparaci poškozené DNA, interaguje s produktem genu RAD51 (15q15.1) oprava zlomů v DNA (zlomy indukované zářením nebo při výměně genetického materiálu mezi chromosomy při meióze) Gen BRCA2 (13q12.3) obdobná funkce jako gen BRCA1, i kdyţ oba geny jsou svou strukturou odlišné, téţ interakce s genem RAD51 Protein BRCA2 transportuje protein RAD51 do místa poškození DNA Gen RAD51 kóduje protein nezbytný pro opravu poškozené DNA Mutace BRCA1 / BRCA2 genů nefunkční, velmi krátký, protein Mutace v genu RAD51 5

6 Sporadický a familiární výskyt nádoru prsu - ţeny Familiární výskyt nádoru prsu 100 Kumulativní riziko (%) - ženy 80 Genetická dispozice (familiární) Populace (sporadický výskyt) I II. 60 L III Věk I II III IV 1 2 Ov 44 J G F H B D L E K F F G B E K E Ov J B G H A C E F L G E G B H C F G G 4 5 D H B C G H 5 6 J H A F L G 6 7 Familiární výskyt nádoru prsu a ovárií str. 144 (rodokmenová studie) 75 F F E E K I Ov 46 Ov 50 H G D E F E F G B E K E B H C C G H B H C C G H H F F E G K L K L K F F E E F K Celoţivotní riziko dcera IV/2: 80% ( nosička mutace) dcera IV/3: populační, cca 10% L K 30 L F 28 F F E E K F 9 3 Mutátorové geny (geny mismatch repairu) hmsh2, hmlh1, hpms1, hpms2, hmsh6, hmsh3 Kontrola stability buněčného genomu Opravy chybného párování bazí (při replikaci) Mutace MMR genů se ve fenotypu projevují nestabilitou délky mikrosatelitních lokusů (př. CA n ) Mutace MMR zvyšují frekvenci mutací v genomu x Mutace MMR mají recesivní charakter AD dědičnost nádorového onemocnění Lynchův syndrom I nádory tlustého střeva a rekta Lynchův syndrom II - kolorektální karcinomy, a u 30% pacientů nádory endometria, žaludku, slinivky, močového traktu MMR geny rozpoznají původní vlákno DNA, které má methylované některé báze oprava na novém vláknu Prevence Zdravá hmotnost Zdravá strava (vláknina, tepelná úprava) Rodinná anamnéza - rodinný výskyt nádorů stejného typu Rizikové návyky Fyzikální vyšetření - preventivní prohlídky (névy, krční a nadklíčkové uzliny, štítná žláza, břicho, zevní genitálie, anální oblast atd. Punkční cytologie 6

Nádorová onemocnění NÁDORY BENIGNÍ

Nádorová onemocnění NÁDORY BENIGNÍ Nádorová onemocnění NÁDORY BENIGNÍ rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazivní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu,


Nádorová onemocnění NÁDORY BENIGNÍ

Nádorová onemocnění NÁDORY BENIGNÍ NÁDORY BENIGNÍ Nádorová onemocnění rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazivní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu,


Nádorová onemocnění. rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly

Nádorová onemocnění. rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY BNIGNÍ Nádorová onemocnění rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazívní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu,


ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii ONKOGENETIKA Spojuje: - lékařskou genetiku - buněčnou biologii - molekulární biologii - cytogenetiku - virologii Důležitost spolupráce různých specialistů při detekci hereditárních forem nádorů - (onkologů,internistů,chirurgů,kožních



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného



UPOZORNĚNÍ PRO STUDENTY UPOZORNĚNÍ PRO STUDENTY Abychom vyhověli žádostem zřad studentů, předkládáme textovou část prezentací vybraných přednášek z patologie pro usnadnění orientace v přednášené látce. Nejedná se v žádném ohledu


Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013 Lékařská genetika a onkologie Renata Gaillyová OLG a LF MU Brno 2012/2013 *genetické souvislosti *onkogenetická vyšetření u onkologických onemocnění * genetické vyšetření u hereditárních nádorů *presymptomatické


Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních


genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace


Onkogeny a nádorové supresory

Onkogeny a nádorové supresory Onkogeny a nádorové supresory Historie Francis) Peyton Rous (October 5, 1879 February 16, 1970) He made his seminal observation, that a malignant tumor growing on a domestic chicken could be transferred


Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady


1.12.2009. Buněčné kultury. Kontinuální kultury

1.12.2009. Buněčné kultury. Kontinuální kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace ztrácejí diferenciační


Nádorová transformace buněk. Marie Kopecká, Biologický ústav LF MU Brno 2006

Nádorová transformace buněk. Marie Kopecká, Biologický ústav LF MU Brno 2006 Nádorová transformace buněk. Marie Kopecká, Biologický ústav LF MU Brno 2006 Nádorová transformace linie myších fibroblastů 3T3 pomocí lidské nádorové DNA (=transfekce transfekce) DNA isolovaná z lidských


Molekulární mechanismy kancerogeneze solidních nádorů

Molekulární mechanismy kancerogeneze solidních nádorů Molekulární mechanismy kancerogeneze solidních nádorů Z. Kolář Ústav klinické a molekulární patologie a Laboratoř molekulární patologie LF UP a FN Olomouc Molekulární mechanismy kancerogeneze solidních


Buněčné kultury. Kontinuální kultury

Buněčné kultury. Kontinuální kultury Buněčné kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace


Vypracování techniky kultivace buněk in vitro (tkáňové kultury) umožnilo definovat

Vypracování techniky kultivace buněk in vitro (tkáňové kultury) umožnilo definovat NÁDOROVÁ ONEMOCNĚNÍ Nádorová onemocnění jsou spolu s nemocemi kardiovaskulárního sytému nejběžnějmi chorobami v na populaci a nejčastěj příčinou úmrtí. Nádorové onemocnění znamená vznik tkáně, ve které


Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?


HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100% F8 - hemofilie A monogenní


MUDr. Iva Slaninová, Ph.D. Biologický ústav LF MU

MUDr. Iva Slaninová, Ph.D. Biologický ústav LF MU Onkogeny,, nádorové supresory, onkogenní viry MUDr. Iva Slaninová, Ph.D. Biologický ústav LF MU Rakovina je výsledkem porušení překážek buněčné proliferace. Jsou 2 základní skupiny genů, jejichž poruchy



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Buněčný cyklus, onkogeny a nádorové supresory

Buněčný cyklus, onkogeny a nádorové supresory Buněčný cyklus, onkogeny a nádorové supresory Barbora Fialová, Jan Bouchal a Jiří Ehrmann Laboratoř molekulární patologie LF UP Přehled 1) Rozdělení buněčného cyklu, jeho iniciace a


Leukémie. - onemocnění postihující hemopoetický systém. vznik hromaděním změn v genomu kmenových buněk progenitorů jednotlivých řad

Leukémie. - onemocnění postihující hemopoetický systém. vznik hromaděním změn v genomu kmenových buněk progenitorů jednotlivých řad Nádory dětskd tského věkuv 30-35% 35% leukémie 11% lymfomy 28% nádory n CNS Neuroblastom 6-8% nefroblastom 6% rabdomyosarkom 3% osteosarkom Retinoblastom 2% EWS Hepatoblastom Germináln lní nádory Leukémie


Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální


rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické


Buněčné kultury Primární kultury

Buněčné kultury Primární kultury Buněčné kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace


Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní


Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ



EPIDEMIOLOGIE NÁDOROVÝCH ONEMOCNĚNÍ. Vladimír Horák EPIDEMIOLOGIE NÁDOROVÝCH ONEMOCNĚNÍ Vladimír Horák ČESKÁ REPUBLIKA A HLAVNÍ PŘÍČINY ÚMRTÍ Struktura zemřelých podle příčin smrti, ČR,2005 Úmrtí v souvislosti s novotvary znázorněna


Etiopatogeneze nádorů

Etiopatogeneze nádorů Etiopatogeneze nádorů Kontrola buněčného cyklu Nádorová transformace buňky Interakce nádoru a organizmu Metastazování Nádory (tumory) - úvod Nádor je patologický stav (nemoc) v důsledku porušené kontroly


Zhoubné nádory druhá nejčastější příčina úmrtí v rozvinutých zemích. Imunologické a genetické metody: Zlepšování dg. Zlepšování prognostiky

Zhoubné nádory druhá nejčastější příčina úmrtí v rozvinutých zemích. Imunologické a genetické metody: Zlepšování dg. Zlepšování prognostiky NÁDOROVÁ IMUNOLOGIE Zhoubné nádory druhá nejčastější příčina úmrtí v rozvinutých zemích. Imunologické a genetické metody: Zlepšování dg. Zlepšování prognostiky NÁDOROVÁ IMUNOLOGIE Vztahy mezi imunitním


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


Modul obecné onkochirurgie

Modul obecné onkochirurgie Modul obecné onkochirurgie 1. Principy kancerogeneze, genetické a epigenetické faktory 2. Onkogeny, antionkogeny, reparační geny, instabilita nádorového genomu 3. Nádorová proliferace a apoptóza, důsledky



MUDr. Pavel CHRBOLKA MUDr. Pavel CHRBOLKA jde o novou abnormální tkáň v organismu nemá fyziologickou funkci roste neregulovaným způsobem k přeměně normální buňky v buňku maligní je nutný mnohastupňový proces transformace dle


Případ č. 66. Klinická historie a anamnéza

Případ č. 66. Klinická historie a anamnéza Klinická historie a anamnéza NO: 70letý muž, který se dostavil do gastroenterologické poradny k vyšetření pro opakované silné zvukové projevy ve střevech (uvádí jako škroukání v břiše). Jinak neudává vážnější





Elementy signálních drah. cíle protinádorové terapie

Elementy signálních drah. cíle protinádorové terapie Elementy signálních drah cíle protinádorové terapie Martin Pešta, Ondřej Topolčan Department of Internal Medicine II, Faculty of Medicine in Pilsen, Charles University in Prague, Czech Republic Cílená


Radiační patofyziologie. Zdroje záření. Typy ionizujícího záření: Jednotky pro měření radiace:

Radiační patofyziologie. Zdroje záření. Typy ionizujícího záření: Jednotky pro měření radiace: Radiační patofyziologie Radiační poškození vzniká účinkem ionizujícího záření. Co se týká jeho původu, ionizující záření vzniká: při radioaktivním rozpadu prvků, přichází z kosmického prostoru, je produkováno


7. Regulace genové exprese, diferenciace buněk a epigenetika

7. Regulace genové exprese, diferenciace buněk a epigenetika 7. Regulace genové exprese, diferenciace buněk a epigenetika Aby mohl mnohobuněčný organismus efektivně fungovat, je třeba, aby se jednotlivé buňky specializovaly na určité funkce. Nový jedinec přitom


Patofyziologie radiačního poškození Jednotky, měření, vznik záření Bezprostřední biologické účinky Účinky na organizmus: - nestochastické - stochastické Ionizující záření Radiační poškození vzniká účinkem


Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11.

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. Personalizovaná medicína Roche v oblasti onkologie Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. listopadu 2013 Personalizovaná vs standardní péče Cílená léčba Spojení diagnostiky


Buněčné jádro a viry

Buněčné jádro a viry Buněčné jádro a viry Struktura virionu Obal kapsida strukturni proteiny povrchove glykoproteiny interakce s receptorem na povrchu buňky uvnitř nukleocore (ribo )nukleova kyselina, virove proteiny Lokalizace

Více Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům Karlova univerzita, Lékařská fakulta Hradec Králové Obor: všeobecné lékařství - test z biologie Vyberte tu z nabídnutých odpovědí (1-5), která je nejúplnější. Otázka Odpověď 1. Mezi organely membránového


ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen

ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen Dědičný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 genů. Foretová L., Macháčková E. Oddělení epidemiologie a genetiky nádorů, Masarykův onkologický ústav, Brno


Mutační změny genotypu

Mutační změny genotypu Mutační změny genotypu - změny genotypu: segregace, kombinace + MUTACE - náhodné změny Mutace - genové - spontánní - chromozómové - indukované (uměle vyvolané) - genomové A) Genové mutace - změna (ztráta)


Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová

Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR Mgr. Silvie Dudová Centrum základního výzkumu pro monoklonální gamapatie a mnohočetný myelom, ILBIT LF MU Brno Laboratoř experimentální



VLIV DĚDIČNOSTI NA VZNIK NÁDORŮ VLIV DĚDIČNOSTI NA VZNIK NÁDORŮ Prevence nádorových onemocnění v 21. století Národní program zdraví DĚDIČNOST JAKO RIZIKOVÝ FAKTOR PRO VZNIK NÁDORŮ Masarykův onkologický ústav Brno 2006 DĚDIČNOST JAKO


Buňky, tkáně, orgány, soustavy

Buňky, tkáně, orgány, soustavy Lidská buňka buněčné organely a struktury: Jádro Endoplazmatické retikulum Goldiho aparát Mitochondrie Lysozomy Centrioly Cytoskelet Cytoplazma Cytoplazmatická membrána Buněčné jádro Jadérko Karyoplazma


ONKOLOGIE. Laboratorní příručka Příloha č. 3 Seznam vyšetření imunochemie Verze: 05 Strana 23 (celkem 63)

ONKOLOGIE. Laboratorní příručka Příloha č. 3 Seznam vyšetření imunochemie Verze: 05 Strana 23 (celkem 63) ONKOLOGIE NÁZEV : PSA POUŽITÍ : kvantitativní stanovení celkového PSA (volného PSA i PSA v komplexu s alfa-1-antichymotrypsinem) v lidském séru. Společně s digitálním rektálním vyšetřením (DRE) se u mužů


Řízení dějů v buňce. Buněčná signalizace - soubor dějů - mají podíl na vzájemné komunikaci buněk

Řízení dějů v buňce. Buněčná signalizace - soubor dějů - mají podíl na vzájemné komunikaci buněk Řízení dějů v buňce Buněčná signalizace - soubor dějů - mají podíl na vzájemné komunikaci buněk Endogenní signalizace - signální molekuly (ligandy) jsou vylučovány buňkou (např. růstový faktor, cytokin


Kolorektální karcinom vedoucí pozice v incidenci na svûtû, v znamn zdravotní problém âeské republiky

Kolorektální karcinom vedoucí pozice v incidenci na svûtû, v znamn zdravotní problém âeské republiky Kolorektální karcinom vedoucí pozice v incidenci na svûtû, v znamn zdravotní problém âeské republiky Prof. MUDr. Rostislav Vyzula, CSc. / Klinika komplexní onkologické péãe MOÚ, Brno Navzdory tomu, že


Benigní endometriální polyp

Benigní endometriální polyp Nádory dělohy POLYPY přisedlé nebo polokůlovité útvary, které vyklenují sliznici zdroj krvácení etiologicky funkční, hyperplastické, nádorové (riziko maligní transformace hyperplastického polypu je však


Geneticky podmíněná nádorová onemocnění

Geneticky podmíněná nádorová onemocnění Geneticky podmíněná nádorová onemocnění Antonín Šípek kruh 3007 ak.r. 2006/2007 Geneticky podmíněná nádorová onemocnění Základní pojmy Způsob dědičnosti Nejčastější gpno Zajímavosti & Novinky Kde hledat


AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení


Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;

Více 3. cvičení Buněčný cyklus Mitóza Modifikace mitózy 1 DNA, chromosom genetická informace organismu chromosom = strukturní podoba DNA během dělení (mitózy) řetězec DNA (chromonema) histony další enzymatické



21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka


Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE


Výskyt MHC molekul. RNDr. Ivana Fellnerová, Ph.D. ajor istocompatibility omplex. Funkce MHC glykoproteinů

Výskyt MHC molekul. RNDr. Ivana Fellnerová, Ph.D. ajor istocompatibility omplex. Funkce MHC glykoproteinů RNDr. Ivana Fellnerová, Ph.D. Katedra zoologie, PřF UP Olomouc = ajor istocompatibility omplex Skupina genů na 6. chromozomu (u člověka) Kódují membránové glykoproteiny, tzv. MHC molekuly, MHC molekuly


Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace Mutace Klasifikace mutací Z hlediska lokalizace mutací v genotypu Genové mutace Chromozomální mutace Genomové mutace Vznik genových mutací Tranzice pyrim. za pyrim. C na T T na C purin za purin A na G



NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ Doc. MUDr. A. Šantavá, CSc. Ústav lékařské genetiky a fetální medicíny LF a UP Olomouc Význam genetiky v diagnostice neuromuskulárních onemocnění Podílí


Intraduktální proliferující léze mléčné žlázy. Dušan Žiak

Intraduktální proliferující léze mléčné žlázy. Dušan Žiak Intraduktální proliferující léze mléčné žlázy Dušan Žiak Bioptický seminář FN a CGB Ostrava 5.2.2014 2013 Definice Intraduktální proliferujíce léze jsou skupinou cytologicky a architektonicky rozmanitých



NÁDOROVÁ RIZIKA. poznejme OBSAH poznejme NÁDOROVÁ RIZIKA OBSAH Úvod... 3 Proč bychom se měli dozvědět o svých vlastních rizicích?... 4 Jaké jsou naše služby?... 4 Kdo by měl být vyšetřen?... 5 Jaký je postup při vyšetřování?... 6 Informace



TERATOGENEZA ONTOGENEZA TERATOGENEZA ONTOGENEZA Vrozené vývojové vady (VVV) Jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo 3-5 % novorozenců.



VÝZNAM REGULACE APOPTÓZY V MEDICÍNĚ REGULACE APOPTÓZY 1 VÝZNAM REGULACE APOPTÓZY V MEDICÍNĚ Příklad: Regulace apoptózy: protein p53 je klíčová molekula regulace buněčného cyklu a regulace apoptózy Onemocnění: více než polovina (70-75%) nádorů



ÚVOD CO JSOU TO GENY? 1 2 OBSAH Úvod / 4 Co jsou to geny? / 4 Jak geny fungují? / 5 Jaký je rozdíl mezi vrozenou a získanou mutací? / 5 Ovlivňují geny vznik nádorů? / 6 Jsou nádory dědičné? / 6 Jak probíhá genetická konzultace?



VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita Všechny nádory mají genetický podtext, ale některé mají tento podtext



VÝZNAM FUNKCE PROTEINŮ V MEDICÍNĚ FUNKCE PROTEINŮ 1 VÝZNAM FUNKCE PROTEINŮ V MEDICÍNĚ Příklad: protein: dystrofin onemocnění: Duchenneova svalová dystrofie 2 3 4 FUNKCE PROTEINŮ: 1. Vztah struktury a funkce proteinů 2. Rodiny proteinů


Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Gymnázium a Střední odborná škola, Rokycany, Mládežníků 1115

Gymnázium a Střední odborná škola, Rokycany, Mládežníků 1115 Gymnázium a Střední odborná škola, Rokycany, Mládežníků 1115 Číslo projektu: CZ.1.07/1.5.00/34.0410 Číslo šablony: V/2 - inovace směřující k rozvoji odborných kompetencí Název materiálu: Buněčný cyklus


Karcinom vaječníků. Představení nemoci

Karcinom vaječníků. Představení nemoci Karcinom vaječníků Představení nemoci Anatomie pánve a břicha Ženský reprodukční systém Vaječníky jsou párový orgán o velikosti 2 4 cm v průměru Vejcovod Řasinky Vaječník Ligamentum Kůra vaječníku Děloha


Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí Stárnutí organismu Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí poklesy funkcí se liší mezi orgánovými systémy Některé projevy stárnutí ovlivňuje výživa Diagnostické metody odlišují


Molekulární mechanismy vzniku a vývoje mesenchymových a neuroektodermových nádorů. Zdeněk Kolář

Molekulární mechanismy vzniku a vývoje mesenchymových a neuroektodermových nádorů. Zdeněk Kolář Molekulární mechanismy vzniku a vývoje mesenchymových a neuroektodermových nádorů Zdeněk Kolář Vývoj hematologických malignit Četné chromosomální alterace a translokace, které byla zjištěny u hematologických



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,


Signalizace a rakovina

Signalizace a rakovina Přednáška kurzu Základy molekulární biologie 2013/2014, PřF MU Signalizace a rakovina Jan Šmarda Ústav experimentální biologie PřF MU Šmarda_2011 1 Signalizace povrchovými receptory signální kaskády 1.



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00



BUNĚČNÝ CYKLUS SOMATICKÝCH BUNĚK A JEHO REGULACE BUNĚČNÝ CYKLUS SOMATICKÝCH BUNĚK A JEHO REGULACE Somatické buňky (jakékoliv buňky organismu kromě pohlavních buněk) během své existence procházejí sérií buněčných cyklů. Výjimkou jsou např. neurony, jsou



PREZENTACE ANTIGENU A REGULACE NA ÚROVNI Th (A DALŠÍCH) LYMFOCYTŮ PREZENTACE ANTIGENU PREZENTACE ANTIGENU A REGULACE NA ÚROVNI Th (A DALŠÍCH) LYMFOCYTŮ PREZENTACE ANTIGENU Podstata prezentace antigenu (MHC restrikce) byla objevena v roce 1974 V současnosti je zřejmé, že to je jeden z klíčových


Co je to genová terapie?

Co je to genová terapie? Obsah přednášky 1. Definice genové terapie 2. Typy a strategie genové terapie 3. Principy genového přenosu 4. Základní technologie genové terapie 5. Způsoby přenosu genů 6. Příklady využití genové terapie


Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). Orphanet - Volně přístupné webové stránky s informacemi


1 Buněčný cyklus a apoptóza (z. Kleibi)..

1 Buněčný cyklus a apoptóza (z. Kleibi).. 1 Buněčný cyklus a apoptóza (z. Kleibi).. 1.1 Buněčný cyklus 1.1.1 Mitogenní signalizace a zahájení buněčného cyklu 1.1.2 G1 fáze buněčného cyklu a její reštrikční bod 1.1.3 S fáze: replikace DNA 1.1.4


Cyklická neutropenie a její původ

Cyklická neutropenie a její původ Cyklická neutropenie a její původ Vlastimil Severa Masarykova univerzita v Brně Podlesí, 3.-6.9.2013 1 Úvod 2 Modely krvetvorby pro CN 3 Strukturovaný model krvetvorby pro CN 4 Simulace Cyclická neutropenie


Papillomaviry. Eva Hamšíková. ÚHKT, oddělení experimentální virologie

Papillomaviry. Eva Hamšíková. ÚHKT, oddělení experimentální virologie Papillomaviry Eva Hamšíková ÚHKT, oddělení experimentální virologie Viry nitrobuněční parazité, životní cyklus závislý na buněčném aparátu, v současnosti známo asi 5 000 typů virů Papillomaviry malé viry


Patologie zažívacího ústrojí II. část: střevo, žlučové cesty, pankreas a peritoneum. VI. histologické praktikum 3. ročník všeobecného směru

Patologie zažívacího ústrojí II. část: střevo, žlučové cesty, pankreas a peritoneum. VI. histologické praktikum 3. ročník všeobecného směru Patologie zažívacího ústrojí II. část: střevo, žlučové cesty, pankreas a peritoneum VI. histologické praktikum 3. ročník všeobecného směru Hemoragická infarzace střeva Hemoragická infarzace střeva Infarzace


Rakovina tlustého stfieva a koneãníku. Doc. MUDr. Jitka Abrahámová, DrSc. MUDr. Ludmila Boublíková MUDr. Drahomíra Kordíková

Rakovina tlustého stfieva a koneãníku. Doc. MUDr. Jitka Abrahámová, DrSc. MUDr. Ludmila Boublíková MUDr. Drahomíra Kordíková TRITON Rakovina tlustého stfieva a koneãníku Doc. MUDr. Jitka Abrahámová, DrSc. MUDr. Ludmila Boublíková MUDr. Drahomíra Kordíková Jitka Abrahámová, Ludmila Boublíková, Drahomíra Kordíková Rakovina tlustého


Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění


Mikromorfologická diagnostika bronchogenního karcinomu z pohledu pneumologické cytodiagnostiky

Mikromorfologická diagnostika bronchogenního karcinomu z pohledu pneumologické cytodiagnostiky Mikromorfologická diagnostika bronchogenního karcinomu z pohledu pneumologické cytodiagnostiky P. Žáčková Pneumologická klinika 1. LFUK Thomayerova nemocnice Úvod a definice Každá buňka obsahuje informace


EBV. RNDr. K.Roubalová, CSc.

EBV. RNDr. K.Roubalová, CSc. EBV RNDr. K.Roubalová, CSc. Biologie EBV: zařazení základní biologické charakteristiky interakce viru s hostitelem Epidemiologie a patogeneze: Infekční mononukleoza EBV


Apoptóza. Veronika Žižková. Ústav klinické a molekulární patologie a Laboratoř molekulární patologie

Apoptóza. Veronika Žižková. Ústav klinické a molekulární patologie a Laboratoř molekulární patologie Apoptóza Veronika Žižková Ústav klinické a molekulární patologie a Laboratoř molekulární patologie Apoptóza Úvod Apoptóza vs nekróza Role apoptózy v organismu Mechanismus apoptózy Metody detekce Úvod -


Nádor = genetické onemocnění

Nádor = genetické onemocnění Nádor = genetické onemocnění Změny vedoucí k fenotypu nádorové buňky jsou dedičné geneticky podmíněné Sporadické x familiární (x hereditární) Somatické x zárodečné (5-10%) Genetika nádorů Na buněčné úrovni


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Základní učební text: Elektronické zpracování Biologie člověka; přednášky Učebnice B. Otová, R. Mihalová Základy biologie a genetiky člověka,

Základní učební text: Elektronické zpracování Biologie člověka; přednášky Učebnice B. Otová, R. Mihalová Základy biologie a genetiky člověka, Základní učební text: Elektronické zpracování Biologie člověka; přednášky Učebnice B. Otová, R. Mihalová Základy biologie a genetiky člověka, Karolinum 2012 Doporučená literatura: Kočárek E. - Genetika.
