HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) čistě genetická choroba?

Rozměr: px
Začít zobrazení ze stránky:

Download "HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?"


1 HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) čistě genetická choroba?

2 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100%

3 F8 - hemofilie A monogenní choroba alelová heterogenita F8 X fenotyp

4 b A - normální sekvence (štěpena enzymem Mst II) CCT GAG GAG AAG produkt PCR je štěpen na dva fragmenty (na gelu 2 proužky) Pro Glu Glu Lys CCTGAGG beta globin - srpkovitá anémie CCT GTG GAG AAG Pro Val Glu Lys b S - mutovaná sekvence (není štěpena Mst II) produkt PCR není štěpen (na gelu jeden proužek) CCTGTGG b S b A /b A b A /b S b S /b S přímá diagnostika přímá detekce kauzální mutace b A

5 gen pro faktor VIII (26 exonů) F8 - hemofilie A mutace typu missense a nonsense (60%) sestřihové mutace (5%) delece a inserce (5%) velké inverse (30%) inserce mobilní sekvence (vzácně)

6 X nebo

7 X nebo dědečkův X babiččin X

8 nebo X nebo dědečkův X babiččin X

9 F8 - hemofilie A nebo? nebo dědečkův X babiččin X nebo

10 polymorfismus typu SNP (Single Nucleotide Polymorphism) mění restrikční digest - RFLP (Restriction Fragment Length Polymorphism) CTGGCTGAACTCATTGCT CTGGCTGAATTCATTGCT alela 1 štěpné místo nepřítomno produkt PCR neštěpen (na gelu 1 proužek) alela 2 štěpné místo přítomno produkt PCR štěpen (na gelu 2 proužky) 1 2

11 F8 - hemofilie A 1 1 2? prenatální diagnostika hemofilie A u mužských plodů 1 1/2 2 1 alela 2 alela přenašečka je informativní, pokud je heterozygotní pro alely 1 a 2 RFLP 2 nepostižený plod 1 postižený plod DNA postiženého jedince slouží ke stanovení fáze vazby: chromozóm X s mutací nese alelu 1 tohoto RFLP nepřímá diagnostika nepřímé sledování přenosu mutované alely v rodině pomocí polymorfního DNA markeru

12 rodina A rodina B F8 - hemofilie A?? 1 1 1/ / heterozygozita heterozygozita fáze vazby předpověď fáze vazby předpověď

13 rodina C F8 - hemofilie A? všechny mužské plody 1 1/ homozygozita předpověď nemožná rodina není informativní pro tento polymorfismus, polymorfismus není informativní v této rodině

14 F8 - hemofilie A gen pro faktor VIII (26 exonů) DX13 ST14 Taq I Bcl I Xba I Hind III Bgl II Msp I Bgl II Taq I G > A CA rep CA rep atd. atd. polymorfní markery intragenové polymorfní markery extragenové (slabší genetická vazba, vyšší riziko rekombinace)

15 CFTR - cystická fibróza GIT tumour necrosis factor a monogenní choroba modifikující geny MUC1 1 TNFA CFTR 6 mucin 1 7 mannose-binding lectin 2 VNĚJŠÍ PROSTŘEDÍ plicní infekce MBL NOS1 plicní funkce x nitric oxide synthase 1 MI MI játra CF modifier 1 CFM1 19 glutathione-s transferase P1 GSTP1 játra ADIPOR2 (adiponectin receptor 2), 12p; CLCA1 (Cl channel, calcium activated, 1), 1p SERPINA1 (serine proteinase inhibitor, A1), 14q; ABCB4 (ATP-binding cassette, B4), 7q hranice mezi monogenní a multifaktoriální chorobou?

16 autismus multifaktoriální choroba P P P P P P heritabilita 90% P P

17 predisponující geny autismus celogenomové screeny X Y IMGSAC (1998) Philippe (1999) Risch (1999) Barrett-CLSA (1999) Buxbaum (2001) Liu (2001) IMGSAC (2001) Shao (2002) Auranen (2002) Yonan (2003) Weiss (2009) Weiss (2009) Wang (2009) Anney (2010) identifikace predisponujících alel je obtížná

18 pochopení multifaktoriálních chorob kardiovaskulární choroby nádorová onemocnění autoimunitní choroby psychiatrické poruchy výška postavy geny prostředí 80% 20% 2010: 201 SNP: 16% mnoho variant vzácné varianty malé studie CNV regulace epigenetika

19 gen pro Huntingtonovu choreu gen pro hemofilii A gen pro cystickou fibrózu gen pro syndrom fragilního X geny pro predispozici k nádorům geny pro predispozici k autismu (alela!) GENY ZDE NEJSOU OD TOHO, ABY ZPŮSOBOVALY CHOROBY nomenklatura genů odráží to, že většinou nechápeme normální fyziologickou funkci genu (proteinu)

20 genotyp z porodnice s genomem na DVD? A B A1 A2 B1 B2 zdraví choroba 0 dnes Sir William Osler ( The principles and practice of medicine, 1892)... if it were not for the great variability among individuals medicine might as well be a science and not an art.

21 FENOTYP NÁDOROVÉ BUŇKY nezávislost na vnějších růst stimulujících signálech necitlivost k vnějším růstově inhibičním signálům schopnost neomezené buněčné replikace schopnost vyhnout se apoptóze schopnost angiogeneze schopnost invaze (a tvorby metastáz) nádorová onemocnění: heterogenní skupina chorob podmíněná genetickými a environmentálními faktory vývoj nádoru je evoluční proces genetické změny zárodečné (germinální) x somatické driver + passenger mutace

22 signalizace 1 signalizace 2 buněčný cyklus 1 apoptóza 1 apoptóza 2 stabilita genomu 1 stabilita genomu angiogeneze n invazivita n GENOTYP NÁDOROVÉ BUŇKY náhodné změny

23 pacient 1 pacient 2 pacient 3 pacient 4

24 HETEROGENITA každý nádor je jedinečný evoluční experiment několik buněčných drah musí být aktivováno, několik inaktivováno na molekulární úrovni toho lze dosáhnout mnoha různými způsoby (kvalitativní nebo kvantitativní změny exprese genů; změny podmíněné geneticky, epigeneticky, prostředím) za vysokou heterogenitou na úrovni genů je několik klíčových drah, které mohou být pro různé nádory podobné

25 Brosnan & Iacobuzio-Donahue, Semin Cell Dev Biol 23 (2012)

26 GENY AKTIVNÍ V NÁDOROVÉM BUJENÍ tumor supresorové geny tumor supresorové geny v užším slova smyslu mutátorové geny - udržování stability genomu brzdí proliferaci vyřazení z funkce - dva zásahy (inaktivace obou alel, recesivní na buněčné úrovni) důležité u vrozené predispozice k nádorům (zárodečná mutace jedné alely, predispozice je dominantní na úrovni rodokmenu) (proto)onkogeny podporují proliferaci aktivace - jeden zásah

27 NĚKTERÉ (PROTO)ONKOGENY gen chrom. funkce proteinu somatické mutace mechanismus lokalizace aktivace (nejč.) K-RAS 12p12 signalizace (G-protein) rakovina střev, pankreatu, bodové mutace plic, endometria ERB-B2 17q21 signalizace (receptor) rakovina prsu, amplifikace ovarií, žaludku C-MYC 8q24 transkripční faktor Burkittův lymfom, amplifikace rakovina plic N-MYC 2p24 transkripční faktor neuroblastom amplifikace BCL2 18q21 protiapoptotický faktor lymfom B buněk ch. translokace ABL 9p34 signalizace (Tyr kináza) leukémie ch. translokace MDM2 12q13 vazba p53 sarkomy amplifikace

28 AKTIVACE (PROTO)ONKOGENŮ normální buňka mechanismy aktivace v nádorové buňce (somatické mutace) amplifikace inserční aktivace translokace - poziční efekt translokace - fúzní gen bodová mutace

29 NĚKTERÉ TUMOR SUPRESOROVÉ GENY gen chrom. funkce proteinu lokalizace RB1 13q14 regulace transkripce, buněčný cyklus APC 5q21 buněčná adheze, buněčná signalizace MSH2 2p16 reparace DNA BRCA1 17q21 reparace DNA TP53 17p13 regulace transkripce, odpověď na poškození DNA, apoptóza NF2 22q12 vazba membrány a cytoskeletu VHL 3p25 elongace transkripce CDKN2 9p21 buněčný cyklus PTCH 9q22 buněčná signalizace DCC 18q21 buněčná adheze

30 1. zásah 2. zásah INAKTIVACE TUMOR SUPRESOROVÝCH GENŮ normální buňka inaktivace jedné alely úplná inaktivace v nádorové buňce -dva zásahy (dvě somatické mutace) ztráta heterozygozity (LOH) ztráta chromozómu ztráta a duplikace chromozómu mitotický crossover delece bodová mutace metylace

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii ONKOGENETIKA Spojuje: - lékařskou genetiku - buněčnou biologii - molekulární biologii - cytogenetiku - virologii Důležitost spolupráce různých specialistů při detekci hereditárních forem nádorů - (onkologů,internistů,chirurgů,kožních



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních



BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY 1 VÝZNAM BUNĚČNÉ TRANSFORMACE V MEDICÍNĚ Příklad: Buněčná transformace: postupná kumulace genetických změn Nádorové onemocnění: kolorektální karcinom 2 3 BUNĚČNÁ TRANSFORMACE



UPOZORNĚNÍ PRO STUDENTY UPOZORNĚNÍ PRO STUDENTY Abychom vyhověli žádostem zřad studentů, předkládáme textovou část prezentací vybraných přednášek z patologie pro usnadnění orientace v přednášené látce. Nejedná se v žádném ohledu


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,


Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady


Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,


Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.


Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní


EPIGENETIKA reverzibilních změn funkce genů, Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická

EPIGENETIKA reverzibilních změn funkce genů, Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická EPIGENETIKA Epigenetika se zabývá studiem reverzibilních změn funkce genů, aniž by při tom došlo ke změnám v sekvenci jaderné DNA. Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická


Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika


rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické



VÝZNAM REGULACE APOPTÓZY V MEDICÍNĚ REGULACE APOPTÓZY 1 VÝZNAM REGULACE APOPTÓZY V MEDICÍNĚ Příklad: Regulace apoptózy: protein p53 je klíčová molekula regulace buněčného cyklu a regulace apoptózy Onemocnění: více než polovina (70-75%) nádorů


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní


Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right





1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.


1.12.2009. Maligní nádory. Nádorová onemocnění. Protoonkogeny. Maligní nádorová onemocnění. Protoonkogeny - amplifikace sekvence DNA.

1.12.2009. Maligní nádory. Nádorová onemocnění. Protoonkogeny. Maligní nádorová onemocnění. Protoonkogeny - amplifikace sekvence DNA. NÁDORY BENIGNÍ Nádorová onemocnění rostou v původním loţisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazivní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu,



VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita Všechny nádory mají genetický podtext, ale některé mají tento podtext



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní


Nádorová onemocnění. rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly

Nádorová onemocnění. rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY BNIGNÍ Nádorová onemocnění rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazívní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu,


Leukémie. - onemocnění postihující hemopoetický systém. vznik hromaděním změn v genomu kmenových buněk progenitorů jednotlivých řad

Leukémie. - onemocnění postihující hemopoetický systém. vznik hromaděním změn v genomu kmenových buněk progenitorů jednotlivých řad Nádory dětskd tského věkuv 30-35% 35% leukémie 11% lymfomy 28% nádory n CNS Neuroblastom 6-8% nefroblastom 6% rabdomyosarkom 3% osteosarkom Retinoblastom 2% EWS Hepatoblastom Germináln lní nádory Leukémie


Onkogeny a nádorové supresory

Onkogeny a nádorové supresory Onkogeny a nádorové supresory Historie Francis) Peyton Rous (October 5, 1879 February 16, 1970) He made his seminal observation, that a malignant tumor growing on a domestic chicken could be transferred


AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení


Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013 Lékařská genetika a onkologie Renata Gaillyová OLG a LF MU Brno 2012/2013 *genetické souvislosti *onkogenetická vyšetření u onkologických onemocnění * genetické vyšetření u hereditárních nádorů *presymptomatické


Nádorová onemocnění NÁDORY BENIGNÍ

Nádorová onemocnění NÁDORY BENIGNÍ Nádorová onemocnění NÁDORY BENIGNÍ rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazivní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu,


Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová

Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR Mgr. Silvie Dudová Centrum základního výzkumu pro monoklonální gamapatie a mnohočetný myelom, ILBIT LF MU Brno Laboratoř experimentální


Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk. Aleš Hampl

Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk. Aleš Hampl Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk Aleš Hampl Tkáně Orgány Živé buňky, které plní různé funkce (podpora struktury, přijímání živin, lokomoce,


Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ


6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


Mutační změny genotypu

Mutační změny genotypu Mutační změny genotypu - změny genotypu: segregace, kombinace + MUTACE - náhodné změny Mutace - genové - spontánní - chromozómové - indukované (uměle vyvolané) - genomové A) Genové mutace - změna (ztráta)


Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky


DNA - dvojšroubovice. Chromatin chromozom. Karyotyp člověka. Dělení buněk

DNA - dvojšroubovice. Chromatin chromozom. Karyotyp člověka. Dělení buněk Genetika genetická podmíněnost nemocí Genetika, genomika genetika specializovaný biologický obor zabývající se variabilitou a dědičností klinická genetika zabývá se diagnostikou, léčením a prevencí genetických


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie


Buněčné kultury. Kontinuální kultury

Buněčné kultury. Kontinuální kultury Buněčné kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace



Buněčné dělení ŘÍZENÍ BUNĚČNÉHO CYKLU BUNĚČNÝ CYKLUS Buněčné dělení Cykliny a na cyklinech závislé proteinkinázy (Cyclin- Dependent Protein Kinases; Cdk-proteinkinázy) - proteiny, které jsou součástí řídícího systému buněčného cyklu 8 cyklinů



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí,

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí, Využití molekulárních markerů v systematice a populační biologii rostlin 12. Shrnutí, Přehled molekulárních markerů 1. proteiny isozymy 2. DNA markery RFLP (Restriction Fragment Length Polymorphism) založené


Molekulární diagnostika pletencové svalové dystrofie typu 2A

Molekulární diagnostika pletencové svalové dystrofie typu 2A Molekulární diagnostika pletencové svalové dystrofie typu 2A Lenka Fajkusová Centrum molekulární biologie a genové terapie Fakultní nemocnice Brno Pletencové svalové dystrofie (Limb Girdle Muscular Dystrophy


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Nádorová onemocnění NÁDORY BENIGNÍ

Nádorová onemocnění NÁDORY BENIGNÍ NÁDORY BENIGNÍ Nádorová onemocnění rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazivní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu,


8 cyklinů (A, B, C, D, E, F, G a H) - v jednotlivých fázích buněčného cyklu jsou přítomny určité typy cyklinů

8 cyklinů (A, B, C, D, E, F, G a H) - v jednotlivých fázích buněčného cyklu jsou přítomny určité typy cyklinů Buněč ěčné dělení BUNĚČ ĚČNÝ CYKLUS ŘÍZENÍ BUNĚČ ĚČNÉHO CYKLU cykliny a na cyklinech závislé proteinkinázy (Cyclin-Dependent Protein Kinases; Cdk-proteinkinázy) - proteiny, které jsou součástí řídícího


Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající


Prognostické a prediktivní markery - část II. prof. MUDr. Ondřej Topolčan, CSc. Centrální laboratoř pro imunoanalýzu, FN a LF UK Plzeň

Prognostické a prediktivní markery - část II. prof. MUDr. Ondřej Topolčan, CSc. Centrální laboratoř pro imunoanalýzu, FN a LF UK Plzeň Prognostické a prediktivní markery - část II prof. MUDr. Ondřej Topolčan, CSc. Centrální laboratoř pro imunoanalýzu, FN a LF UK Plzeň Témata přednášky Molekulární biologie DNA a nádory Parametry molekulární


Zhoubné nádory druhá nejčastější příčina úmrtí v rozvinutých zemích. Imunologické a genetické metody: Zlepšování dg. Zlepšování prognostiky

Zhoubné nádory druhá nejčastější příčina úmrtí v rozvinutých zemích. Imunologické a genetické metody: Zlepšování dg. Zlepšování prognostiky NÁDOROVÁ IMUNOLOGIE Zhoubné nádory druhá nejčastější příčina úmrtí v rozvinutých zemích. Imunologické a genetické metody: Zlepšování dg. Zlepšování prognostiky NÁDOROVÁ IMUNOLOGIE Vztahy mezi imunitním


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


Genetický screening predispozice k celiakii

Genetický screening predispozice k celiakii VETERINÁRN RNÍ A FARMACEUTICKÁ UNIVERZITA BRNO Farmaceutická fakulta Ústav humánn nní farmakologie a toxikologie Genetický screening predispozice k celiakii RNDr. Ladislava Bartošov ová,ph.d. 1, PharmDr.


Epigenetika mění paradigma současné medicíny i její budoucnost

Epigenetika mění paradigma současné medicíny i její budoucnost Epigenetika mění paradigma současné medicíny i její budoucnost pokračování z čísla 1 a 2 /2014 Epigenetika v onkologii MUDr. Jozef Čupka Společnost všeobecného lékařství ČLS JEP, Sekce preventivní onkologie


Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální


Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální


Buněčný cyklus, spojení se signálními cestami a molekulární mechanismy onkogeneze

Buněčný cyklus, spojení se signálními cestami a molekulární mechanismy onkogeneze Buněčný cyklus, spojení se signálními cestami a molekulární mechanismy onkogeneze MUDr. Jiří Vachtenheim, CSc. Přehled regulace buněčného cyklu Základní terminologie: Cycliny evolučně konzervované proteiny


Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE


Buněčný cyklus, onkogeny a nádorové supresory

Buněčný cyklus, onkogeny a nádorové supresory Buněčný cyklus, onkogeny a nádorové supresory Barbora Fialová, Jan Bouchal a Jiří Ehrmann Laboratoř molekulární patologie LF UP http://lmp.upol.cz Přehled 1) Rozdělení buněčného cyklu, jeho iniciace a


1.12.2009. Buněčné kultury. Kontinuální kultury

1.12.2009. Buněčné kultury. Kontinuální kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace ztrácejí diferenciační


CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti


Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11.

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. Personalizovaná medicína Roche v oblasti onkologie Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. listopadu 2013 Personalizovaná vs standardní péče Cílená léčba Spojení diagnostiky


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649





(odbornost 816; aktualizovaná verze, schválená výborem SLG.cz - per rollam) Praha 16. listopadu 2015

(odbornost 816; aktualizovaná verze, schválená výborem SLG.cz - per rollam) Praha 16. listopadu 2015 Informace pro revizní pracovníky VZP ČR ke kontrole indikací, správnosti a oprávněnosti provádění (a vykazování k úhradě) laboratorních genetických vyšetření a vedení zdravotnické dokumentace u těchto


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00


Modul obecné onkochirurgie

Modul obecné onkochirurgie Modul obecné onkochirurgie 1. Principy kancerogeneze, genetické a epigenetické faktory 2. Onkogeny, antionkogeny, reparační geny, instabilita nádorového genomu 3. Nádorová proliferace a apoptóza, důsledky





Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Hemofilie Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Definice hemofilie Nevyléčitelná vrozená krvácivá choroba s nedostatkem plazmatických faktorů FVIII hemofile A FIX hemofile


http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k


velké fragmenty střední fragmenty malé fragmenty

velké fragmenty střední fragmenty malé fragmenty velké fragmenty střední fragmenty malé fragmenty Southern 1975 Northern Western denaturace DNA hybridizace primerů (annealing) (mají délku kolem 20 bází) syntéza nové DNA termostabilní polymerázou vstup


Akreditovaný subjekt podle ČSN EN ISO 15189:2007: CGB laboratoř a.s Kořenského 10, Ostrava, Vítkovice

Akreditovaný subjekt podle ČSN EN ISO 15189:2007: CGB laboratoř a.s Kořenského 10, Ostrava, Vítkovice List 1 z 6 Pracoviště zdravotnické laboratoře: 1., Laboratoř klinické patologie a cytologie Kořenského 10, 70300 Ostrava Vítkovice Postupy vyšetření: 1 Histologická vyšetření tkání 2 Peroperační histologická


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho


1 Buněčný cyklus a apoptóza (z. Kleibi)..

1 Buněčný cyklus a apoptóza (z. Kleibi).. 1 Buněčný cyklus a apoptóza (z. Kleibi).. 1.1 Buněčný cyklus 1.1.1 Mitogenní signalizace a zahájení buněčného cyklu 1.1.2 G1 fáze buněčného cyklu a její reštrikční bod 1.1.3 S fáze: replikace DNA 1.1.4


Apoptóza. Veronika Žižková. Ústav klinické a molekulární patologie a Laboratoř molekulární patologie

Apoptóza. Veronika Žižková. Ústav klinické a molekulární patologie a Laboratoř molekulární patologie Apoptóza Veronika Žižková Ústav klinické a molekulární patologie a Laboratoř molekulární patologie Apoptóza Úvod Apoptóza vs nekróza Role apoptózy v organismu Mechanismus apoptózy Metody detekce Úvod -


MUDr. Iva Slaninová, Ph.D. Biologický ústav LF MU

MUDr. Iva Slaninová, Ph.D. Biologický ústav LF MU Onkogeny,, nádorové supresory, onkogenní viry MUDr. Iva Slaninová, Ph.D. Biologický ústav LF MU Rakovina je výsledkem porušení překážek buněčné proliferace. Jsou 2 základní skupiny genů, jejichž poruchy


Patologie. PATOLOGIE, Všeobecné lékařství, 3. ročník. Publikováno z 2. lékařská fakulta Univerzity Karlovy v Praze ( https://www.lf2.cuni.

Patologie. PATOLOGIE, Všeobecné lékařství, 3. ročník. Publikováno z 2. lékařská fakulta Univerzity Karlovy v Praze ( https://www.lf2.cuni. Publikováno z 2. lékařská fakulta Univerzity Karlovy v Praze ( https://www.lf2.cuni.cz) Patologie Napsal uživatel Marie Havlová dne 12. Leden 2010-0:00. PATOLOGIE, Všeobecné lékařství, 3. ročník Obecná


Elementy signálních drah. cíle protinádorové terapie

Elementy signálních drah. cíle protinádorové terapie Elementy signálních drah cíle protinádorové terapie Martin Pešta, Ondřej Topolčan Department of Internal Medicine II, Faculty of Medicine in Pilsen, Charles University in Prague, Czech Republic Cílená


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření

Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření Název sondy / vyšetřovaného syndromu vyšetřovaný gen / oblast použití Fast FISH souprava prenatálních sond DiGeorge


Buněčné kultury Primární kultury

Buněčné kultury Primární kultury Buněčné kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace


Virus Epsteina a Barrové

Virus Epsteina a Barrové Virus Epsteina a Barrové EBV RNDr K.Roubalová NRL pro herpetické viry EBV - hostitelské buňky RECEPTOR: CD21 CR2 Receptor pro C3d složku komplementu Přítomen na B-lymfocytech některých T-lymfocytech Latentní


Molekulární a buněčná biologie, genetika a virologie

Molekulární a buněčná biologie, genetika a virologie Publikováno z 2. lékařská fakulta Univerzity Karlovy v Praze ( https://www.lf2.cuni.cz) Molekulární a buněčná biologie, genetika a virologie Okruhy otázek ke státní doktorské zkoušce Část molekulární biologie


Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi


Význam genetického vyšetření u pacientů s mentální retardací

Význam genetického vyšetření u pacientů s mentální retardací Význam genetického vyšetření u pacientů s mentální retardací Šantavá, A., Hyjánek, J., Čapková, P., Adamová, K., Vrtěl, R. Ústav lékařské genetiky a fetální medicíny FN a LF UP Olomouc Mentální retardace


Nádorová transformace buněk. Marie Kopecká, Biologický ústav LF MU Brno 2006

Nádorová transformace buněk. Marie Kopecká, Biologický ústav LF MU Brno 2006 Nádorová transformace buněk. Marie Kopecká, Biologický ústav LF MU Brno 2006 Nádorová transformace linie myších fibroblastů 3T3 pomocí lidské nádorové DNA (=transfekce transfekce) DNA isolovaná z lidských


Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin Část Molekulární biologie a imunologie 6. Základy dědičnosti Mendelovská dědičnost (autozomálně recesivní, autozomálně dominantní a X-vázaný přenos mutací). Nemendelovská dědičnost (uniparentální disomie,


Genetické příčiny sterility a infertility v ambulantní gynekologické praxi. Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R.

Genetické příčiny sterility a infertility v ambulantní gynekologické praxi. Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R. Genetické příčiny sterility a infertility v ambulantní gynekologické praxi Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R. Infertilita Definice: Neschopnost otěhotnět v průběhu jednoho



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


Chromozomální aberace nalezené u párů s poruchou reprodukce v letech

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech Chromozomální aberace nalezené u párů s poruchou reprodukce v letech 2000-2005 Jak přistupovat k nálezům minoritních gonozomálních mozaik? Šantavá A., Adamová, K.,Čapková P., Hyjánek J. Ústav lékařské


Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí Stárnutí organismu Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí poklesy funkcí se liší mezi orgánovými systémy Některé projevy stárnutí ovlivňuje výživa Diagnostické metody odlišují


Úvod do nonhla-dq genetiky celiakie

Úvod do nonhla-dq genetiky celiakie Úvod do nonhla-dq genetiky celiakie František Mrázek HLA laboratoř, Ústav Imunologie LF UP a FN Olomouc Celiakie - časté chronické zánětlivé onemocnění tenkého střeva s autoimunitní a systémovou složkou


Pohled genetika na racionální vyšetřování v preventivní kardiologii

Pohled genetika na racionální vyšetřování v preventivní kardiologii Pohled genetika na racionální vyšetřování v preventivní kardiologii Tomáš Freiberger Genetická laboratoř, Centrum kardiovaskulární a transplantační chirurgie Brno, ČR Osnova Genetické faktory vzniku KV


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.
