Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Rozměr: px
Začít zobrazení ze stránky:

Download "Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno"


1 Retinoblastom Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

2 Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních buněk sítnice incidence: 1/ až 1/ živě narozených dětí manifestace: do 5-ti let věku projevy: ztráta zrakové ostrosti, strabismus, leukokorie, slepota, zvětšování oka, zarudnutí, otok postižení: oko, mozek, mícha úspěšnost léčby: nádor uvnitř oka 95% mimo oblast oka 0-40%

3 Gen RB1 jediný známý gen asociovaný se vznikem retinoblastomu lokalizace - 13q exonů, >180kb genomické DNA kóduje retinoblastomový tumorsupresorový protein (prb,928 aa), významný negativní regulátor buněčného cyklu tumor-supresorová aktivita mutace RB1 gen inaktivace ztráta deregulace buněčného cyklu vznik retinoblastomu

4 prb protein brzda buněčného cyklu Kontrolní bod přestupu z G1 do S fáze: prb v aktivní formě váže transkripční faktor E2F cyklind- a cykline-dependentní kinázy fosforylují a tím inaktivují prb inaktivovaný prb uvolňuje E2F transkripční faktory, které stimulují expresi genů potřebných pro vstup do S fáze

5 RBL model dvoustupňového vzniku nádorů (TSG) Vznik RBL vysvětluje Knudsonova teorie dvou zásahů: Alfred G. Knudson ( 1922) Knudson s hypothesis (1971) nehereditární retinoblastom % pacientů -dvě somatické mutace - pozdější rozvoj RBL (24.měsíc věku) - unilaterální forma retinoblastomu hereditární retinoblastom % pacientů - první mutace germinální - druhý zásah - mutace somatická - časnější rozvoj RBL (8.měsíc věku) - bilaterální (multifokální) forma, ale i unilaterální - molekulární diagnostika!! - vyšší riziko vzniku sekundárních malignit (osteosarkom, SA měkkých tkání, )

6 Formy retinoblastomu familiární 6% x sporadický 94% bilaterální 25-30% x unilaterální 70-75% hereditární 40-50% x nehereditární 50-60%

7 Molekulárně genetická analýza genu RB1 v genu RB1 bylo popsáno více než 600 mutací rozmístěny po celé kódující oblasti genu a zahrnují všechny typy změn dále byla u retinoblastomu popsána hypermetylace cytosinu v CpG dinukleotidech promotoru různé formy inaktivace RB1 genu vedou k rozdílné penetranci a expresivitě, a tudíž rozdílným klinickým projevům onemocnění

8 Hlavní typy mutací zapřičiňující vznik RBL Typ mutace výskyt metoda detekce jednonukleotidové substituce 40-50% RBL sekvenační analýza malé delece a inzerce 25-30% RBL sekvenační analýza velké delece a přestavby 10% familiárních RBL MLPA kvantitativní multiplex PCR hypermetylace promotorové oblasti RB1 10% RBL metylační analýza cytogenetické aberace (delece a přestavby 13q14) 8% bilaterálních RBL 1-5% sporadických RBL FISH testy heterozygozity

9 Sekvenace cdna a DNA Sekvenace cdna izolace RNA reverzní transkripce do cdna sekvenace 6-ti úseků cdna: úsek 1 exon 1-4 úsek 2 exon 4-9 úsek 3 exon 9-15 úsek 4 exon úsek 5 exon úsek 6 exon Sekvenace DNA izolace DNA sekvenace příslušného exonu ověřění sekvenční změny na úrovni DNA

10 MLPA - Multiplex Ligation-dependent Probe Amplification - metoda umožňující detekci delecí či duplikací jednoho a více exonů hybridizace a ligace specifických sond k exonům RB1 (kromě 5,10,15,16) multiplex PCR - amplifikace hybridizovaných sond fragmentační analýza (Beckman CEQ-8000) Coffalyser (v 1.4) _NoE_Eurogentest.xhtml

11 Metylační analýza promotoru hypermetylace CpG ostrůvků promotorové oblasti vede k represi transkripce - umlčování genu u TSG (RB1, BRCA1, p15, p16..) představuje hypermetylace promotorů jeden z mechanismů onkogeneze hypermetylace promotorové oblasti popsána u sporadických i hereditárních retinoblastomů nemetylovaná DNA 5 -ACGT AUGT-3 metylovaná DNA 5 -AC*GT-3 modifikace bisulfidem sodným 5 -AC*GT-3 PCR s primery specifickými pro metylovanou a nemetylovanou DNA 5 -AUGT-3 1.cyklus PCR 5 -AC*GT-3 3 -TACA-5 3 -TG CA -5 PCR amplifikace 5 -ATGT-3 5 -ACGT TACA-5 3 -TGCA-5 detekce metylačního statusu pomocí PAG elektroforézy / sekvenování / HRM (high resolution melting)

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013 Lékařská genetika a onkologie Renata Gaillyová OLG a LF MU Brno 2012/2013 *genetické souvislosti *onkogenetická vyšetření u onkologických onemocnění * genetické vyšetření u hereditárních nádorů *presymptomatické





Ondřej Scheinost Nemocnice České Budějovice, a.s.

Ondřej Scheinost Nemocnice České Budějovice, a.s. Ondřej Scheinost Nemocnice České Budějovice, a.s. Nové technologie přelomové období principy technologií klinická použitelnost chips (arrays) sekvenační technologie Důležitost genetických informací i další


Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady


Molekulární diagnostika pletencové svalové dystrofie typu 2A

Molekulární diagnostika pletencové svalové dystrofie typu 2A Molekulární diagnostika pletencové svalové dystrofie typu 2A Lenka Fajkusová Centrum molekulární biologie a genové terapie Fakultní nemocnice Brno Pletencové svalové dystrofie (Limb Girdle Muscular Dystrophy


ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii ONKOGENETIKA Spojuje: - lékařskou genetiku - buněčnou biologii - molekulární biologii - cytogenetiku - virologii Důležitost spolupráce různých specialistů při detekci hereditárních forem nádorů - (onkologů,internistů,chirurgů,kožních


Nádorová onemocnění. rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly

Nádorová onemocnění. rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY BNIGNÍ Nádorová onemocnění rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazívní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu,


ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen

ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen Dědičný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 genů. Foretová L., Macháčková E. Oddělení epidemiologie a genetiky nádorů, Masarykův onkologický ústav, Brno


Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár



EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence


Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ





Akreditovaný subjekt podle ČSN EN ISO 15189:2007: CGB laboratoř a.s Kořenského 10, Ostrava, Vítkovice

Akreditovaný subjekt podle ČSN EN ISO 15189:2007: CGB laboratoř a.s Kořenského 10, Ostrava, Vítkovice List 1 z 6 Pracoviště zdravotnické laboratoře: 1., Laboratoř klinické patologie a cytologie Kořenského 10, 70300 Ostrava Vítkovice Postupy vyšetření: 1 Histologická vyšetření tkání 2 Peroperační histologická


Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Mgr. Klára Vilimovská Dědečková, Ph.D. Synlab genetics s.r.o. Molekulární


Duchenneova/Beckerova svalová dystrofie a Parent Project

Duchenneova/Beckerova svalová dystrofie a Parent Project Duchenneova/Beckerova svalová dystrofie a Parent Project Oddělení lékařské genetiky FN Brno Renata Gaillyová Vzácné nemoci V EU se nemoc považuje za vzácnou, jestliže postihuje méně než 5 osob z každých


Laboratorní příručka

Laboratorní příručka STRANA: 1/24 Laboratorní příručka Pro uživatele služeb Oddělení epidemiologie a genetiky nádorů - laboratoře, spadajících do odbornosti 816 Laboratoř lékařské genetiky Vypracovali: RNDr. Eva Macháčková,


Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní



VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita Všechny nádory mají genetický podtext, ale některé mají tento podtext


Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární



UPOZORNĚNÍ PRO STUDENTY UPOZORNĚNÍ PRO STUDENTY Abychom vyhověli žádostem zřad studentů, předkládáme textovou část prezentací vybraných přednášek z patologie pro usnadnění orientace v přednášené látce. Nejedná se v žádném ohledu


Nádorová transformace buněk. Marie Kopecká, Biologický ústav LF MU Brno 2006

Nádorová transformace buněk. Marie Kopecká, Biologický ústav LF MU Brno 2006 Nádorová transformace buněk. Marie Kopecká, Biologický ústav LF MU Brno 2006 Nádorová transformace linie myších fibroblastů 3T3 pomocí lidské nádorové DNA (=transfekce transfekce) DNA isolovaná z lidských





Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování



ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů


7. Regulace genové exprese, diferenciace buněk a epigenetika

7. Regulace genové exprese, diferenciace buněk a epigenetika 7. Regulace genové exprese, diferenciace buněk a epigenetika Aby mohl mnohobuněčný organismus efektivně fungovat, je třeba, aby se jednotlivé buňky specializovaly na určité funkce. Nový jedinec přitom


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Leukémie. - onemocnění postihující hemopoetický systém. vznik hromaděním změn v genomu kmenových buněk progenitorů jednotlivých řad

Leukémie. - onemocnění postihující hemopoetický systém. vznik hromaděním změn v genomu kmenových buněk progenitorů jednotlivých řad Nádory dětskd tského věkuv 30-35% 35% leukémie 11% lymfomy 28% nádory n CNS Neuroblastom 6-8% nefroblastom 6% rabdomyosarkom 3% osteosarkom Retinoblastom 2% EWS Hepatoblastom Germináln lní nádory Leukémie


Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka


CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.





Epigenetika mění paradigma současné medicíny i její budoucnost

Epigenetika mění paradigma současné medicíny i její budoucnost Epigenetika mění paradigma současné medicíny i její budoucnost pokračování z čísla 1 a 2 /2014 Epigenetika v onkologii MUDr. Jozef Čupka Společnost všeobecného lékařství ČLS JEP, Sekce preventivní onkologie


Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje


Onkogeny a nádorové supresory

Onkogeny a nádorové supresory Onkogeny a nádorové supresory Historie Francis) Peyton Rous (October 5, 1879 February 16, 1970) He made his seminal observation, that a malignant tumor growing on a domestic chicken could be transferred


Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc

Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie a myelodysplastický syndrom Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie (AL) Představují heterogenní skupinu chorob charakterizovaných kumulací klonu nevyzrálých, nádorově


Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky


Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň

Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň Laboratoř uplatňuje flexibilní přístup k rozsahu akreditace upřesněný v dodatku. Aktuální seznam činností prováděných v rámci požadovaného flexibilního rozsahu je k dispozici na webových stránkách laboratoře


Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE


ZÍSKANÉ CHROMOSOMOVÉ ABERACE. Vytvořilo Oddělení lékařské genetiky FN Brno

ZÍSKANÉ CHROMOSOMOVÉ ABERACE. Vytvořilo Oddělení lékařské genetiky FN Brno ZÍSKANÉ CHROMOSOMOVÉ ABERACE CHROMOSOMOVÉ ABERACE (CHA) Cílem cytogenetického vyšetření je zjištění přítomnosti / nepřítomnosti chromosomových aberací (patologických chromosomových změn) TYPY ZÍSKANÝCH


1.12.2009. Maligní nádory. Nádorová onemocnění. Protoonkogeny. Maligní nádorová onemocnění. Protoonkogeny - amplifikace sekvence DNA.

1.12.2009. Maligní nádory. Nádorová onemocnění. Protoonkogeny. Maligní nádorová onemocnění. Protoonkogeny - amplifikace sekvence DNA. NÁDORY BENIGNÍ Nádorová onemocnění rostou v původním loţisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazivní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu,



Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální





Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11.

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. Personalizovaná medicína Roche v oblasti onkologie Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. listopadu 2013 Personalizovaná vs standardní péče Cílená léčba Spojení diagnostiky


Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk


Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE

Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE BiochemNet vytvoření sítě pro podporu spolupráce biomedicínských pracovišť a zvýšení uplatnitelnosti absolventů biochemických oborů v praxi Laboratorní workshop s teoreticko praktickou ukázkou molekulárně


2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou


Nádorová onemocnění NÁDORY BENIGNÍ

Nádorová onemocnění NÁDORY BENIGNÍ Nádorová onemocnění NÁDORY BENIGNÍ rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazivní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu,


Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání


Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží


Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right


Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová

Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR Mgr. Silvie Dudová Centrum základního výzkumu pro monoklonální gamapatie a mnohočetný myelom, ILBIT LF MU Brno Laboratoř experimentální


Tekuté biopsie u mnohočetného myelomu

Tekuté biopsie u mnohočetného myelomu Tekuté biopsie u mnohočetného myelomu Mgr. Veronika Kubaczková Babákova myelomová skupina ÚPF LF MU Pacientský seminář 11. května 2016, Brno Co jsou tekuté biopsie? Představují méně zatěžující vyšetření



DMPK (ZNF9) V DIFERENCOVANÝCH. Z, Kroupová I, Falk M* M FISH ANALÝZA m-rna DMPK (ZNF9) V DIFERENCOVANÝCH TKÁNÍCH PACIENT IENTŮ S MYOTONICKOU DYSTROFI FIÍ Lukáš Z, Kroupová I, Falk M* M Ústav patologie FN Brno *Biofyzikáln lní ústav AVČR R Brno Definice MD Myotonická


Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace


Odborná směrnice. Thomayerova nemocnice Oddělení lékařské genetiky Vídeňská 800, 140 59 Praha 4 - Krč

Odborná směrnice. Thomayerova nemocnice Oddělení lékařské genetiky Vídeňská 800, 140 59 Praha 4 - Krč Strana 1 z 23 Název: LABORATORNÍ PŘÍRUČKA Platnost od: 16.3.2016 Platnost do: odvolání Nahrazuje: SMO-370-01 verzi č. 8 Distribuce a uložení dokumentu: Platné jsou autorizované výtisky a elektronická verze


Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu

Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Srovnal J. 1, Cincibuch J. 2, Cwierkta K. 2, Melichar B. 2, Aujeský R. 3, Vrba R.


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován





AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení


Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty J.Berkovcová, M.Dziechciarková, M.Staňková, A.Janošťáková, D.Dvořáková, M.Hajdúch Laboratoř


,, Cesta ke zdraví mužů

,, Cesta ke zdraví mužů PREZENTACE VÝSLEDKŮ ŘEŠENÍ PILOTNÍHO PROJEKTU PREVENTIVNÍ PÉČE PRO MUŢE,, Cesta ke zdraví mužů prim. MUDr. Monika Koudová GHC GENETICS, s.r.o.- NZZ, Praha Projekt byl realizován ve dvou etapách: I. etapa


Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Centrum nádorové cytogenetiky Ústav klinické biochemie a laboratorní diagnostiky VFN a 1. LF UK v Praze Klinický význam cytogenetických


Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka


Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření

Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření Název sondy / vyšetřovaného syndromu vyšetřovaný gen / oblast použití Fast FISH souprava prenatálních sond DiGeorge


Zaměření bakalářské práce (témata BP)

Zaměření bakalářské práce (témata BP) Zaměření bakalářské práce (témata BP) Obor: Buněčná a molekulární diagnostika - zadává katedra - studenti si témata losují Obor: molekulární biologie a genetika - témata BP vychází z vybraného tématu DP



NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ Doc. MUDr. A. Šantavá, CSc. Ústav lékařské genetiky a fetální medicíny LF a UP Olomouc Význam genetiky v diagnostice neuromuskulárních onemocnění Podílí


Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA


Genetika dědičných neuropatií

Genetika dědičných neuropatií Genetika dědičných neuropatií P. Seeman Klinika dětské neurologie, DNA laboratoř, UK 2. LF a FN Motol Praha a CMT tým UK 2. LF a FNM CMT - dědičná choroba Známo již od Charcota, Marie a Tootha téměř 130


Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie

Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie 1) Zadávání témat dle studovaného oboru 2) Přehled řešených témat v minulosti 3) 4) Přehled externích školících pracovišť Zaměření


Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip


Na rozdíl od genomiky se funkční genomika zaměřuje na dynamické procesy, jako je transkripce, translace, interakce protein - protein.

Na rozdíl od genomiky se funkční genomika zaměřuje na dynamické procesy, jako je transkripce, translace, interakce protein - protein. FUNKČNÍ GENOMIKA Co to je: Oblast molekulární biologie která se snaží o zpřístupnění a využití ohromného množství dat z genomových projektů. Snaží se popsat geny, a proteiny, jejich funkce a interakce.


Změny genomu a jeho exprese u chronické lymfocytární leukémie

Změny genomu a jeho exprese u chronické lymfocytární leukémie Změny genomu a jeho exprese u chronické lymfocytární leukémie Šárka Pospíšilová Centrum molekulární biologie a genové terapie Interní hematoonkologická klinika LF MU a FN Brno Konference DNA Analýza V,


Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny





Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?


V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)


Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů

Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů Ústav úspěšně dokončil realizaci dvou investičních projektů s využitím prostředků z Operačního


Modul obecné onkochirurgie

Modul obecné onkochirurgie Modul obecné onkochirurgie 1. Principy kancerogeneze, genetické a epigenetické faktory 2. Onkogeny, antionkogeny, reparační geny, instabilita nádorového genomu 3. Nádorová proliferace a apoptóza, důsledky


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,


Vyšetřování molekulárních markerů v prognóze onemocnění a predikci účinku protinádorové léčby u solidních tumorů: Kde jsme a kam se ubíráme?

Vyšetřování molekulárních markerů v prognóze onemocnění a predikci účinku protinádorové léčby u solidních tumorů: Kde jsme a kam se ubíráme? Vyšetřování molekulárních markerů v prognóze onemocnění a predikci účinku protinádorové léčby u solidních tumorů: Kde jsme a kam se ubíráme? Marek Minárik Laboratoř molekulární genetiky a onkologie Genomac


Změny sazebníku výkonů pro mikrobiologické obory

Změny sazebníku výkonů pro mikrobiologické obory Změny sazebníku výkonů pro mikrobiologické obory Ing. Hana Hrbáčková LTK CEM SZÚ 2011 - Původní návrh MZ Grant Evropského fondu pro regionální rozvoj Vítěznou nabídku na řešení Kultivace Seznamu zdravotních





Metody studia genové exprese

Metody studia genové exprese Metody studia genové exprese Ing. Lucie Němcová, Ph.D. Laboratoř vývojové biologie Transkriptom Genová exprese: Geny jsou exprimovány tehdy, jsou-li přepsány do RNA (mrna). Rozdílná


Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky

Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky Biotechnologický kurz Biotechnologický kurz III. letní škola metod molekulární biologie nukleových kyselin a genomiky 18. - 22. 6. 2012 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně


Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách

Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách Molekulární biotechnologie č.8 Produkce heterologního proteinu v eukaryontních buňkách Eukaryontní buňky se využívají v případě, když Eukaryontní proteiny syntetizované v baktériích postrádají biologickou


Proteinové znaky dětské leukémie identifikované pomocí genových expresních profilů

Proteinové znaky dětské leukémie identifikované pomocí genových expresních profilů Proteinové znaky dětské leukémie identifikované pomocí genových expresních profilů M.Vášková a spol. Klinika dětské hematologie a onkologie 2.LF UK a FN Motol Childhood Leukemia Investigation Prague Průtoková


Klinická genetika, genetické poradenství, cytogenetika, DNA diagnostika (od pacienta k DNA a zpět)

Klinická genetika, genetické poradenství, cytogenetika, DNA diagnostika (od pacienta k DNA a zpět) Klinická genetika, genetické poradenství, cytogenetika, DNA diagnostika (od pacienta k DNA a zpět) OLG FN Brno LF a PřF MU 2014 Renata Gaillyová Lékařská genetika Charakteristika, historie a současný stav



STRUKTURA REGISTRU TULUNG STRUKTURA REGISTRU TULUNG Vstupní parametry a diagnostika primárního onemocnění 1. Vstupní parametry 1. Kouření (výběr) 1. Kuřák 2. Bývalý kuřák (rok před stanovením DG dle WHO) 3. Nekuřák 2. Výška [cm]


1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická


Laboratorní přístrojová technika

Laboratorní přístrojová technika Laboratorní přístrojová technika Co najdeme v laboratoři? Přístroje pro obecné použití centrifugy, třepačky, pipety, biohazard boxy Trocha teorie o DNA a PCR Analytické přístroje a příprava vzorků elektroforézy


Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi


Mgr. Zuzana Kufová , Mikulov. Genomické analýzy u Waldenströmovy makroglobulinémie

Mgr. Zuzana Kufová , Mikulov. Genomické analýzy u Waldenströmovy makroglobulinémie Mgr. Zuzana Kufová 10.4.2015, Mikulov Genomické analýzy u Waldenströmovy makroglobulinémie Obsah přednášky Genomický profil u WM Mutace v genu MYD88 Mutace v genu CXCR4 Diagnostika Výsledky


Využití DNA sekvencování v

Využití DNA sekvencování v Využití DNA sekvencování v taxonomii prokaryot Mgr. Pavla Holochová, doc. RNDr. Ivo Sedláček, CSc. Česká sbírka mikroorganismů Ústav experimentální biologie Přírodovědecká fakulta Masarykova univerzita,


Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská
