Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Rozměr: px
Začít zobrazení ze stránky:

Download "Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno"

Transkript

1 Retinoblastom Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

2 Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních buněk sítnice incidence: 1/ až 1/ živě narozených dětí manifestace: do 5-ti let věku projevy: ztráta zrakové ostrosti, strabismus, leukokorie, slepota, zvětšování oka, zarudnutí, otok postižení: oko, mozek, mícha úspěšnost léčby: nádor uvnitř oka 95% mimo oblast oka 0-40%

3 Gen RB1 jediný známý gen asociovaný se vznikem retinoblastomu lokalizace - 13q exonů, >180kb genomické DNA kóduje retinoblastomový tumorsupresorový protein (prb,928 aa), významný negativní regulátor buněčného cyklu tumor-supresorová aktivita mutace RB1 gen inaktivace ztráta deregulace buněčného cyklu vznik retinoblastomu

4 prb protein brzda buněčného cyklu Kontrolní bod přestupu z G1 do S fáze: prb v aktivní formě váže transkripční faktor E2F cyklind- a cykline-dependentní kinázy fosforylují a tím inaktivují prb inaktivovaný prb uvolňuje E2F transkripční faktory, které stimulují expresi genů potřebných pro vstup do S fáze

5 RBL model dvoustupňového vzniku nádorů (TSG) Vznik RBL vysvětluje Knudsonova teorie dvou zásahů: Alfred G. Knudson ( 1922) Knudson s hypothesis (1971) nehereditární retinoblastom % pacientů -dvě somatické mutace - pozdější rozvoj RBL (24.měsíc věku) - unilaterální forma retinoblastomu hereditární retinoblastom % pacientů - první mutace germinální - druhý zásah - mutace somatická - časnější rozvoj RBL (8.měsíc věku) - bilaterální (multifokální) forma, ale i unilaterální - molekulární diagnostika!! - vyšší riziko vzniku sekundárních malignit (osteosarkom, SA měkkých tkání, )

6 Formy retinoblastomu familiární 6% x sporadický 94% bilaterální 25-30% x unilaterální 70-75% hereditární 40-50% x nehereditární 50-60%

7 Molekulárně genetická analýza genu RB1 v genu RB1 bylo popsáno více než 600 mutací rozmístěny po celé kódující oblasti genu a zahrnují všechny typy změn dále byla u retinoblastomu popsána hypermetylace cytosinu v CpG dinukleotidech promotoru různé formy inaktivace RB1 genu vedou k rozdílné penetranci a expresivitě, a tudíž rozdílným klinickým projevům onemocnění

8 Hlavní typy mutací zapřičiňující vznik RBL Typ mutace výskyt metoda detekce jednonukleotidové substituce 40-50% RBL sekvenační analýza malé delece a inzerce 25-30% RBL sekvenační analýza velké delece a přestavby 10% familiárních RBL MLPA kvantitativní multiplex PCR hypermetylace promotorové oblasti RB1 10% RBL metylační analýza cytogenetické aberace (delece a přestavby 13q14) 8% bilaterálních RBL 1-5% sporadických RBL FISH testy heterozygozity

9 Sekvenace cdna a DNA Sekvenace cdna izolace RNA reverzní transkripce do cdna sekvenace 6-ti úseků cdna: úsek 1 exon 1-4 úsek 2 exon 4-9 úsek 3 exon 9-15 úsek 4 exon úsek 5 exon úsek 6 exon Sekvenace DNA izolace DNA sekvenace příslušného exonu ověřění sekvenční změny na úrovni DNA

10 MLPA - Multiplex Ligation-dependent Probe Amplification - metoda umožňující detekci delecí či duplikací jednoho a více exonů hybridizace a ligace specifických sond k exonům RB1 (kromě 5,10,15,16) multiplex PCR - amplifikace hybridizovaných sond fragmentační analýza (Beckman CEQ-8000) Coffalyser (v 1.4) Source:www.eurogentest.org/web/info/public/unit5/MLPA_validation_study _NoE_Eurogentest.xhtml

11 Metylační analýza promotoru hypermetylace CpG ostrůvků promotorové oblasti vede k represi transkripce - umlčování genu u TSG (RB1, BRCA1, p15, p16..) představuje hypermetylace promotorů jeden z mechanismů onkogeneze hypermetylace promotorové oblasti popsána u sporadických i hereditárních retinoblastomů nemetylovaná DNA 5 -ACGT AUGT-3 metylovaná DNA 5 -AC*GT-3 modifikace bisulfidem sodným 5 -AC*GT-3 PCR s primery specifickými pro metylovanou a nemetylovanou DNA 5 -AUGT-3 1.cyklus PCR 5 -AC*GT-3 3 -TACA-5 3 -TG CA -5 PCR amplifikace 5 -ATGT-3 5 -ACGT TACA-5 3 -TGCA-5 detekce metylačního statusu pomocí PAG elektroforézy / sekvenování / HRM (high resolution melting)

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013 Lékařská genetika a onkologie Renata Gaillyová OLG a LF MU Brno 2012/2013 *genetické souvislosti *onkogenetická vyšetření u onkologických onemocnění * genetické vyšetření u hereditárních nádorů *presymptomatické

Více

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE POHLED Z LABORATOŘE Petra Hedvičákov ková ÚBLG FN Motol Odd. lékal kařské molekulárn rní genetiky MZO 00064203 23.-24.5.2008

Více

Ondřej Scheinost Nemocnice České Budějovice, a.s.

Ondřej Scheinost Nemocnice České Budějovice, a.s. Ondřej Scheinost Nemocnice České Budějovice, a.s. Nové technologie přelomové období principy technologií klinická použitelnost chips (arrays) sekvenační technologie Důležitost genetických informací i další

Více

Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

EPIGENETIKA reverzibilních změn funkce genů, Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická

EPIGENETIKA reverzibilních změn funkce genů, Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická EPIGENETIKA Epigenetika se zabývá studiem reverzibilních změn funkce genů, aniž by při tom došlo ke změnám v sekvenci jaderné DNA. Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická

Více

Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady

Více

Molekulární diagnostika pletencové svalové dystrofie typu 2A

Molekulární diagnostika pletencové svalové dystrofie typu 2A Molekulární diagnostika pletencové svalové dystrofie typu 2A Lenka Fajkusová Centrum molekulární biologie a genové terapie Fakultní nemocnice Brno Pletencové svalové dystrofie (Limb Girdle Muscular Dystrophy

Více

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii ONKOGENETIKA Spojuje: - lékařskou genetiku - buněčnou biologii - molekulární biologii - cytogenetiku - virologii Důležitost spolupráce různých specialistů při detekci hereditárních forem nádorů - (onkologů,internistů,chirurgů,kožních

Více

ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen

ný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 gen Prohlášení Informace k onemocn BRCA1 gen Dědičný syndrom nádoru prsu a/nebo ovaria Molekulární analýza BRCA1 a BRCA2 genů. Foretová L., Macháčková E. Oddělení epidemiologie a genetiky nádorů, Masarykův onkologický ústav, Brno foretova@mou.cz

Více

Nádorová onemocnění. rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly

Nádorová onemocnění. rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY BNIGNÍ Nádorová onemocnění rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazívní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu,

Více

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár

Více

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

Laboratorní příručka

Laboratorní příručka STRANA: 1/24 Laboratorní příručka Pro uživatele služeb Oddělení epidemiologie a genetiky nádorů - laboratoře, spadajících do odbornosti 816 Laboratoř lékařské genetiky Vypracovali: RNDr. Eva Macháčková,

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

Akreditovaný subjekt podle ČSN EN ISO 15189:2007: CGB laboratoř a.s Kořenského 10, Ostrava, Vítkovice

Akreditovaný subjekt podle ČSN EN ISO 15189:2007: CGB laboratoř a.s Kořenského 10, Ostrava, Vítkovice List 1 z 6 Pracoviště zdravotnické laboratoře: 1., Laboratoř klinické patologie a cytologie Kořenského 10, 70300 Ostrava Vítkovice Postupy vyšetření: 1 Histologická vyšetření tkání 2 Peroperační histologická

Více

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Mgr. Klára Vilimovská Dědečková, Ph.D. Synlab genetics s.r.o. Molekulární

Více

Duchenneova/Beckerova svalová dystrofie a Parent Project

Duchenneova/Beckerova svalová dystrofie a Parent Project Duchenneova/Beckerova svalová dystrofie a Parent Project Oddělení lékařské genetiky FN Brno Renata Gaillyová Vzácné nemoci V EU se nemoc považuje za vzácnou, jestliže postihuje méně než 5 osob z každých

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní

Více

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita

VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita Všechny nádory mají genetický podtext, ale některé mají tento podtext

Více

Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární

Více

UPOZORNĚNÍ PRO STUDENTY

UPOZORNĚNÍ PRO STUDENTY UPOZORNĚNÍ PRO STUDENTY Abychom vyhověli žádostem zřad studentů, předkládáme textovou část prezentací vybraných přednášek z patologie pro usnadnění orientace v přednášené látce. Nejedná se v žádném ohledu

Více

VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII

VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII VÝZNAM NĚKTERÝCH FAKTORŮ PREANALYTICKÉ FÁZE V MOLEKULÁRNÍ BIOLOGII Plíšková L., Hrochová K., Kutová R. Ústav klinické biochemie a diagnostiky FN Hradec Králové PREANALYTICKÁ FÁZE V MOLEKULÁRNÍ BIOLOGII

Více

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

7. Regulace genové exprese, diferenciace buněk a epigenetika

7. Regulace genové exprese, diferenciace buněk a epigenetika 7. Regulace genové exprese, diferenciace buněk a epigenetika Aby mohl mnohobuněčný organismus efektivně fungovat, je třeba, aby se jednotlivé buňky specializovaly na určité funkce. Nový jedinec přitom

Více

Nádorová transformace buněk. Marie Kopecká, Biologický ústav LF MU Brno 2006

Nádorová transformace buněk. Marie Kopecká, Biologický ústav LF MU Brno 2006 Nádorová transformace buněk. Marie Kopecká, Biologický ústav LF MU Brno 2006 Nádorová transformace linie myších fibroblastů 3T3 pomocí lidské nádorové DNA (=transfekce transfekce) DNA isolovaná z lidských

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

Epigenetika mění paradigma současné medicíny i její budoucnost

Epigenetika mění paradigma současné medicíny i její budoucnost Epigenetika mění paradigma současné medicíny i její budoucnost pokračování z čísla 1 a 2 /2014 Epigenetika v onkologii MUDr. Jozef Čupka Společnost všeobecného lékařství ČLS JEP, Sekce preventivní onkologie

Více

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.

Více

Spinální svalová atrofie. Vypracovali: Kateřina Teplá Monika Madrová Anna Dobrovolná Mária Čižmárová Dominika Štrbová Juraj Štipka

Spinální svalová atrofie. Vypracovali: Kateřina Teplá Monika Madrová Anna Dobrovolná Mária Čižmárová Dominika Štrbová Juraj Štipka Spinální svalová atrofie Vypracovali: Kateřina Teplá Monika Madrová Anna Dobrovolná Mária Čižmárová Dominika Štrbová Juraj Štipka Klinický popis - relativně vzácná nemoc, nicméně se jedná o nejčastější

Více

Leukémie. - onemocnění postihující hemopoetický systém. vznik hromaděním změn v genomu kmenových buněk progenitorů jednotlivých řad

Leukémie. - onemocnění postihující hemopoetický systém. vznik hromaděním změn v genomu kmenových buněk progenitorů jednotlivých řad Nádory dětskd tského věkuv 30-35% 35% leukémie 11% lymfomy 28% nádory n CNS Neuroblastom 6-8% nefroblastom 6% rabdomyosarkom 3% osteosarkom Retinoblastom 2% EWS Hepatoblastom Germináln lní nádory Leukémie

Více

Buněčný cyklus, spojení se signálními cestami a molekulární mechanismy onkogeneze

Buněčný cyklus, spojení se signálními cestami a molekulární mechanismy onkogeneze Buněčný cyklus, spojení se signálními cestami a molekulární mechanismy onkogeneze MUDr. Jiří Vachtenheim, CSc. Přehled regulace buněčného cyklu Základní terminologie: Cycliny evolučně konzervované proteiny

Více

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční

Více

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.

Více

NÁVAZNOST METOD KLASICKÉ A MOLEKULÁRNÍ CYTOGENETIKY. Vytvořilo Oddělení lékařské genetiky FN Brno

NÁVAZNOST METOD KLASICKÉ A MOLEKULÁRNÍ CYTOGENETIKY. Vytvořilo Oddělení lékařské genetiky FN Brno NÁVAZNOST METOD KLASICKÉ A MOLEKULÁRNÍ CYTOGENETIKY TYPY CHROMOSOMOVÝCH ABERACÍ, kterých se týká vyšetření metodami klasické i molekulární cytogenetiky - VYŠETŘENÍ VROZENÝCH CHROMOSOMOVÝCH ABERACÍ prenatální

Více

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc

Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie a myelodysplastický syndrom Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie (AL) Představují heterogenní skupinu chorob charakterizovaných kumulací klonu nevyzrálých, nádorově

Více

Onkogeny a nádorové supresory

Onkogeny a nádorové supresory Onkogeny a nádorové supresory Historie Francis) Peyton Rous (October 5, 1879 February 16, 1970) He made his seminal observation, that a malignant tumor growing on a domestic chicken could be transferred

Více

Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň

Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň Laboratoř uplatňuje flexibilní přístup k rozsahu akreditace upřesněný v dodatku. Aktuální seznam činností prováděných v rámci požadovaného flexibilního rozsahu je k dispozici na webových stránkách laboratoře

Více

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky

Více

Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE

Více

ZÍSKANÉ CHROMOSOMOVÉ ABERACE. Vytvořilo Oddělení lékařské genetiky FN Brno

ZÍSKANÉ CHROMOSOMOVÉ ABERACE. Vytvořilo Oddělení lékařské genetiky FN Brno ZÍSKANÉ CHROMOSOMOVÉ ABERACE CHROMOSOMOVÉ ABERACE (CHA) Cílem cytogenetického vyšetření je zjištění přítomnosti / nepřítomnosti chromosomových aberací (patologických chromosomových změn) TYPY ZÍSKANÝCH

Více

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky.

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální

Více

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11.

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. Personalizovaná medicína Roche v oblasti onkologie Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. listopadu 2013 Personalizovaná vs standardní péče Cílená léčba Spojení diagnostiky

Více

1.12.2009. Maligní nádory. Nádorová onemocnění. Protoonkogeny. Maligní nádorová onemocnění. Protoonkogeny - amplifikace sekvence DNA.

1.12.2009. Maligní nádory. Nádorová onemocnění. Protoonkogeny. Maligní nádorová onemocnění. Protoonkogeny - amplifikace sekvence DNA. NÁDORY BENIGNÍ Nádorová onemocnění rostou v původním loţisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazivní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu,

Více

VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CMG CZECH GROUP M Y E L O M A Č ESKÁ MYELOMOVÁ SKUPINA

VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CMG CZECH GROUP M Y E L O M A Č ESKÁ MYELOMOVÁ SKUPINA VÝSLEDKY FISH ANALÝZY U NEMOCNÝCH S MM ZAŘAZENÝCH VE STUDII CMG 2002 VÝZKUMNÝ GRANT NR/8183-4 CZECH CMG M Y E L O M A GROUP Č ESKÁ MYELOMOVÁ SKUPINA Zhodnocení spolupráce Přehled molekulárně cytogenetických

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE

Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE BiochemNet vytvoření sítě pro podporu spolupráce biomedicínských pracovišť a zvýšení uplatnitelnosti absolventů biochemických oborů v praxi Laboratorní workshop s teoreticko praktickou ukázkou molekulárně

Více

DIAGNOSTIKA A MONITOROVÁNÍ INFEKCÍ ZPŮSOBENÉ LIDSKÝMI PAPILLOMAVIRY VYSOCE RIZIKOVÉHO TYPU POMOCÍ REAL TIME PCR

DIAGNOSTIKA A MONITOROVÁNÍ INFEKCÍ ZPŮSOBENÉ LIDSKÝMI PAPILLOMAVIRY VYSOCE RIZIKOVÉHO TYPU POMOCÍ REAL TIME PCR DIAGNOSTIKA A MONITOROVÁNÍ INFEKCÍ ZPŮSOBENÉ LIDSKÝMI PAPILLOMAVIRY VYSOCE RIZIKOVÉHO TYPU POMOCÍ REAL TIME PCR Michaela Kavanová, DiS. tel.: +420 221 985 476 mobil: +420 725 004 523 e-mail: michaela.kavanova@synlab.cz

Více

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou

Více

Nádorová onemocnění NÁDORY BENIGNÍ

Nádorová onemocnění NÁDORY BENIGNÍ Nádorová onemocnění NÁDORY BENIGNÍ rostou v původním ložisku, zachovávají charakter tkáně, ze které vznikly NÁDORY MALIGNÍ invazivní růst, poškozují strukturu a funkci tkáně, indukují vlastní angiogenezu,

Více

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

Tekuté biopsie u mnohočetného myelomu

Tekuté biopsie u mnohočetného myelomu Tekuté biopsie u mnohočetného myelomu Mgr. Veronika Kubaczková Babákova myelomová skupina ÚPF LF MU Pacientský seminář 11. května 2016, Brno Co jsou tekuté biopsie? Představují méně zatěžující vyšetření

Více

Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová

Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR. Mgr. Silvie Dudová Lekce z analýz genových expresních profilů u MM a návrh panelu genů pro ČR Mgr. Silvie Dudová Centrum základního výzkumu pro monoklonální gamapatie a mnohočetný myelom, ILBIT LF MU Brno Laboratoř experimentální

Více

DMPK (ZNF9) V DIFERENCOVANÝCH. Z, Kroupová I, Falk M* M

DMPK (ZNF9) V DIFERENCOVANÝCH. Z, Kroupová I, Falk M* M FISH ANALÝZA m-rna DMPK (ZNF9) V DIFERENCOVANÝCH TKÁNÍCH PACIENT IENTŮ S MYOTONICKOU DYSTROFI FIÍ Lukáš Z, Kroupová I, Falk M* M Ústav patologie FN Brno *Biofyzikáln lní ústav AVČR R Brno Definice MD Myotonická

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace

Více

Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu

Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Možnosti využití technologie DNA microarrays v predikci odpovědi na neoadjuvantní terapii u pacientů s karcinomem jícnu Srovnal J. 1, Cincibuch J. 2, Cwierkta K. 2, Melichar B. 2, Aujeský R. 3, Vrba R.

Více

Odborná směrnice. Thomayerova nemocnice Oddělení lékařské genetiky Vídeňská 800, 140 59 Praha 4 - Krč

Odborná směrnice. Thomayerova nemocnice Oddělení lékařské genetiky Vídeňská 800, 140 59 Praha 4 - Krč Strana 1 z 23 Název: LABORATORNÍ PŘÍRUČKA Platnost od: 16.3.2016 Platnost do: odvolání Nahrazuje: SMO-370-01 verzi č. 8 Distribuce a uložení dokumentu: Platné jsou autorizované výtisky a elektronická verze

Více

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech Chromozomální aberace nalezené u párů s poruchou reprodukce v letech 2000-2005 Jak přistupovat k nálezům minoritních gonozomálních mozaik? Šantavá A., Adamová, K.,Čapková P., Hyjánek J. Ústav lékařské

Více

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

,, Cesta ke zdraví mužů

,, Cesta ke zdraví mužů PREZENTACE VÝSLEDKŮ ŘEŠENÍ PILOTNÍHO PROJEKTU PREVENTIVNÍ PÉČE PRO MUŢE,, Cesta ke zdraví mužů prim. MUDr. Monika Koudová GHC GENETICS, s.r.o.- NZZ, Praha Projekt byl realizován ve dvou etapách: I. etapa

Více

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty J.Berkovcová, M.Dziechciarková, M.Staňková, A.Janošťáková, D.Dvořáková, M.Hajdúch Laboratoř

Více

UNIVERZITA KARLOVA V PRAZE FARMACEUTICKÁ FAKULTA V HRADCI KRÁLOVÉ KATEDRA BIOLOGICKÝCH A LÉKAŘSKÝCH VĚD

UNIVERZITA KARLOVA V PRAZE FARMACEUTICKÁ FAKULTA V HRADCI KRÁLOVÉ KATEDRA BIOLOGICKÝCH A LÉKAŘSKÝCH VĚD UNIVERZITA KARLOVA V PRAZE FARMACEUTICKÁ FAKULTA V HRADCI KRÁLOVÉ KATEDRA BIOLOGICKÝCH A LÉKAŘSKÝCH VĚD Dědičné a získané změny estrogenových a progesteronových receptorů ve vztahu k nádorům prsu Bakalářská

Více

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Centrum nádorové cytogenetiky Ústav klinické biochemie a laboratorní diagnostiky VFN a 1. LF UK v Praze Klinický význam cytogenetických

Více

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka

Více

Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI

Více

Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření

Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření Název sondy / vyšetřovaného syndromu vyšetřovaný gen / oblast použití Fast FISH souprava prenatálních sond DiGeorge

Více

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza Exprese genetického kódu Centrální dogma molekulární biologie - genetická informace v DNA -> RNA -> primárního řetězce proteinu 1) transkripce - přepis z DNA do mrna 2) translace - přeložení z kódu nukleových

Více

Zaměření bakalářské práce (témata BP)

Zaměření bakalářské práce (témata BP) Zaměření bakalářské práce (témata BP) Obor: Buněčná a molekulární diagnostika - zadává katedra - studenti si témata losují Obor: molekulární biologie a genetika - témata BP vychází z vybraného tématu DP

Více

Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika

Více

NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ

NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ NEUROGENETICKÁ DIAGNOSTIKA NERVOSVALOVÝCH ONEMOCNĚNÍ Doc. MUDr. A. Šantavá, CSc. Ústav lékařské genetiky a fetální medicíny LF a UP Olomouc Význam genetiky v diagnostice neuromuskulárních onemocnění Podílí

Více

Genetika dědičných neuropatií

Genetika dědičných neuropatií Genetika dědičných neuropatií P. Seeman Klinika dětské neurologie, DNA laboratoř, UK 2. LF a FN Motol Praha a CMT tým UK 2. LF a FNM CMT - dědičná choroba Známo již od Charcota, Marie a Tootha téměř 130

Více

Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA

Více

Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie

Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie 1) Zadávání témat dle studovaného oboru 2) Přehled řešených témat v minulosti 3) 4) Přehled externích školících pracovišť Zaměření

Více

Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

Na rozdíl od genomiky se funkční genomika zaměřuje na dynamické procesy, jako je transkripce, translace, interakce protein - protein.

Na rozdíl od genomiky se funkční genomika zaměřuje na dynamické procesy, jako je transkripce, translace, interakce protein - protein. FUNKČNÍ GENOMIKA Co to je: Oblast molekulární biologie která se snaží o zpřístupnění a využití ohromného množství dat z genomových projektů. Snaží se popsat geny, a proteiny, jejich funkce a interakce.

Více

Změny genomu a jeho exprese u chronické lymfocytární leukémie

Změny genomu a jeho exprese u chronické lymfocytární leukémie Změny genomu a jeho exprese u chronické lymfocytární leukémie Šárka Pospíšilová Centrum molekulární biologie a genové terapie Interní hematoonkologická klinika LF MU a FN Brno Konference DNA Analýza V,

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny

Více

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů

Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů Ústav úspěšně dokončil realizaci dvou investičních projektů s využitím prostředků z Operačního

Více

Modul obecné onkochirurgie

Modul obecné onkochirurgie Modul obecné onkochirurgie 1. Principy kancerogeneze, genetické a epigenetické faktory 2. Onkogeny, antionkogeny, reparační geny, instabilita nádorového genomu 3. Nádorová proliferace a apoptóza, důsledky

Více

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská

Více

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100% F8 - hemofilie A monogenní

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,

Více

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více