GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY"

Transkript

1 GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci bělochů bylo zjištěno, že osob s krevní skupinou A, 570 skup. B, 226 skup. AB a skup. 0. Jaké jsou alelové četnosti při Hardyho - Weinbergově rovnováze? p 1 = 0,2584 pro alelu I A, p 2 = 0,0634 pro I B, p 3 = 0,6782 pro i. PŘÍKLAD 5.2 Ve vzorku španělských Basků byl zjištěn výskyt krevních skupin systému AB0: 724 jedinců mělo krevní skupinu A, 110 skup. B, 763 skup. 0 a 20 skup. AB. Nejpřesnější odhady alelových četností činily: p 1 = 0,2661 pro I A, p 2 = 0,0411 pro I B a p 3 = 0,6928 pro i. Vypočtěte očekávané zastoupení čtyř fenotypů a testujte shodu s očekávanými četnostmi při Hardyho - Weinbergově rovnováze. Očekávané počty jedinců s krevními skupinami A, B, 0 a AB jsou: 710,7; 94,8; 776,1 a 35,4. χ 2 = 9,61 při jednom stupni volnosti: 4 (4 skupiny) (odhad p 1 z údajů) - 1 (odhad p 2 z údajů) = 1; neuvažuje se odhad p 3, poněvadž p 3 = 1 - p 1 - p 2. To odpovídá pravděpodobnosti 0,0025 což znamená, že populace nebyla v HW rovnováze. Důvod tohoto zjištění není znám, ale jednou z možností je migrace z jiné populace s odlišnými alelovými četnostmi ve sledovaném genu. PŘÍKLAD 5.3 U mnoha domorodých kmenů amerických indiánů je četnost alely I B neobvykle nízká. Například ze 600 indiánů Papago z Arizony mělo 37 krevní skupinu A a 563 skupinu 0. Jaké jsou alelové a genotypové četnosti pro tento gen v dané populaci? V daném vzorku populace se nevyskytují alely I B, tzn., že p 2 = 0. Jsou zde pouze tři genotypy I A I A, I A i (krevní skupina A) a ii (krevní skupina 0). Tyto genotypy se vyskytují v proporcích p 1 2, 2p 1 p 3 a p 3 2. Poněvadž p 2 = 0, p 1 + p 3 = 1. p 3 = (563/600) 1/2 = 0,9687 a p 1 = 1 - p 3 = 0,0313. Genotypové četnosti jsou: (0,0313) 2 = 0,0010 pro I A I A, 2(0,0313)(0,9687) = 0,0606 pro I A i a (0,9687) 2 = 0,9384 pro ii. PŘÍKLAD 5.4 V určité populaci se alely podmiňující krevní skupiny systému AB0 vyskytují s četností: I A = 0,2; I B = 0,1 a i = 0,7. Jaké budou rovnovážné četnosti čtyř krevních skupin v této populaci? Krevní skupina 0: 0,49; A: 0,04+ 0,28 = 0,32; B: 0,01+0,14 = 0,15; AB; 0,04. PŘÍKLAD 5.5

2 Na lokusu agouti u myší jsou známy tři alely podmiňující zbarvení srsti: A - agouti, a t - černožlutohnědá a a - neagouti. Jaké budou rovnovážné genotypové a fenotypové četnosti v potomstvu křížení (AxB) x C, jestliže kmen A tvoří genotypy AA, kmen B a t a t a kmen C aa. (Platí dominance v pořadí A>a t >a) V F 1 po křížení A x B budou všechny myši heterozygoti Aa t. Proto budou alelové četnosti po konečném křížení 0,25 A, 0,25 a t a 0,5 a. Fenotyp agouti budou tvořit tři různé genotypy s četnostmi: AA: 0,0625; Aa t 0,125 a Aa 0,25 tj. celková četnost fenotypu agouti 0,4375. Genotypy a t a t se budou vyskytovat s četností 0,0625 a a t a 0,25 tj. celková četnost černo-žlutohnědého fenotypu 0,3125. Fenotyp neagouti bude u 0,25 jedinců v populaci. PŘÍKLAD 5.6 V určité populaci Phlox cuspidata byly nalezeny čtyři alely genu pro alkoholdehydrogenázu označené Adh-1, Adh-2, Adh-3 a Adh-4 v četnostech 0,11; 0,84; 0,01 a 0,04. Jaké jsou očekávané Hardyho - Weinbergovy genotypové četnosti? Adh-1/Adh-1, zkráceně psáno jako 1/1: (0,11) 2 = 0,0121; 1/2: 2 (0,11) (0,84) = 0,1848; 2/2: (0,84) 2 = 0,7056; 1/3: 2 (0,11) (0,01) = 0,0022; 2/3: 2 (0,84) (0,01) = 0,0168; 3/3: (0,01) 2 = 0,0001; 1/4: 2 (0,11) (0,04) = 0,0088; 2/4: 2 (0,84) (0,04) = 0,0672; 3/4: 2 (0,01) (0,04) = 0,0008; 4/4: (0,04) 2 = 0,0016. (Pozn. U této rostliny, která se rozmnožuje převážně samooplozením se očekávané genotypové četnosti založené na náhodném oplození odchylují od skutečných.) PŘÍKLAD 5.7 Křížíme samce jedné populace se samicemi druhé populace. Genotypové distribuce jsou v populaci samců: 0,4 0,4 0,2 a v populaci samic 0,2 0,8 0. Jaké budou genotypové poměry v F 1, F 2 a F 3 z těchto křížení? Alelové četnosti v populaci samců jsou: p mt = 0,4+0,2 = 0,6; q mt = 0,4. V populaci samic: p ft = 0,2+0,4 = 0,6; q ft = 0,4. Obě rodičovské populace mají stejné alelové četnosti, i když se jejich genotypové četnosti liší. Rovnovážný poměr se ustaví v F 1 při p 2 : 2pq : q 2 = 0,36 : 0,48 : 0,16. Stejný poměr se bude opakovat v F 2 a F 3. PŘÍKLAD 5.8 Opakujte výpočet jako v předchozím příkladu za předpokladu výchozí distribuce genotypů u samců 0,09 0,10 0,81 a u samic 0,36 0,15 a 0,49. Jaké budou genotypové poměry v F 1, F 2 a F 3? Postup je stejný jako v Př p mt = 0,14; q mt = 0,86; p ft = 0,435; q ft = 0,565. Alelové četnosti nejsou stejné u obou pohlaví, proto v F 1 budou genotypy rozděleny v Bruceho poměru: (0,14)(0,435) : (0,14)(0,565) + (0,86)(0,435) : (0,86)(0,565) = 0,0609 : 0,4532 : 0,4859. V F 1 budou alelové četnosti a genotypová distribuce stejná u obou pohlaví, p F1 = (0,0609+0,2266) = 0,2875. Proto bude genotypový poměr v F 2 0,0827 : 0,4097 : 0,5076 a tento poměr se bude v F 3 opakovat. PŘÍKLAD 5.9

3 Předpokládejme, že křížíme dvě populace X a Y, přičemž pro každé křížení bereme samce z X a samici z Y nebo naopak. Populace X má stejnou genotypovou distribuci (u obou pohlaví) jako samci rodičovské generace v příkladu 5.8 a populace Y stejnou jako samice v tomto příkladu. Jak to ovlivní genotypové poměry v generaci F 1, F 2 a F 3? Určitý podíl křížení nastane mezi samci z X a samicemi z Y a mezi potomky F 1 z tohoto křížení - poměr genotypů bude stejný jako pro potomstvo F 1 v příkladu 5.8. Zbylá část křížení nastane mezi samci z Y a samicemi z X - v potomstvu tohoto křížení bude Bruceho poměr genotypů (0,435)(0,14) : (0,435)(0,86) + (0,565)(0,14) : (0,565)(0,86) = 0,0609 : 0,4532 : 0,4859. Z toho vyplývá, že nastane-li jakékoli ze dvou reciprokých křížení, bude genotypový poměr F 1 stejný a identický s poměrem v příkladu 5.8, to je 0,0827 : 0,4097 : 0,5076 i v F 2 a F 3. PŘÍKLAD 5.10 Nyní předpokládejme, že páření mezi dvěma populacemi je zcela náhodné, takže může dojít i k oplození mezi dvěma jedinci populace X nebo populace Y; v dalších případech dochází k oplození mezi členy dvou různých populací. Genotypové četnosti v populacích X a Y jsou stejné jako v předchozím příkladu. Obě populace mají stejný počet členů. Přibližně polovina křížení nastane mezi členy z různých populací, to znamená, že genotypový poměr v potomstvu bude u této části shodný s poměrem v příkladu 5.9. Čtvrtina křížení nastane mezi členy populace X - u nich bude genotypový poměr (0,14) 2 : 2(0,14)(0,86) : (0,86) 2 = 0,0196 : 0,2408 : 0,7396. Další čtvrtina křížení bude mezi členy populace Y - zde bude genotypový poměr (0,453) 2 : 2(0,435)(0,565) : (0,565) 2 = 0,1892 : 0,4916 : 0,3192. Celkový poměr v F 1 pak bude P F1 : (0,0196)/4 + (0,1892)/4 + (0,0609)/2 = 0,0827; Q F1 : obdobně 0,4097 a R F1 : 0,5076. PŘÍKLAD 5.11 Krevní skupina Xg u člověka je determinována genem vázaným na pohlaví (v nehomologickém úseku chromozomu X) se dvěma alelami označovanými Xg a a Xg. Příslušnými biochemickými testy lze rozlišit dva fenotypy, Xg(a+) a Xg(a-). Xg a je dominantní nad Xg. Ve vzorku Britů bylo nalezeno 967 žen Xg(a+) a 667 mužů Xg(a+), 102 žen Xg(a-) a 346 mužů Xg(a-). Odhady alelových četností jsou: p = 0,675 pro Xg a a q = 0,325 pro Xg. Vypočtěte očekávané počty čtyř fenotypových tříd za předpokladu náhodného oplození a testujte shodu s nalezenými poměry. Očekávané počty Xg(a+) a Xg(a-) u mužů jsou (0,675)(1013) = 683,8 a (0,325)(1013) = 329,2. Očekávané počty Xg(a+) Xg(a-) u žen jsou [(0,675) 2 + 2(0,675)(0,325)] (1069) = 956,1 a (0,325) 2 (1069) = 112,9. χ 2 = 2,45 a má jeden stupeň volnosti (od původních čtyř stupňů volnosti musíme odečíst jeden z důvodu použití pozorovaného počtu mužů pro výpočet očekávaného počtu mužů, jeden stupeň volnosti odečteme z důvodu použití při odhadech z pozorovaného počtu žen a třetí odečteme pro odhady p z údajů). Příslušná pravděpodobnost je asi 0,12, tzn., že nezamítáme hypotézu fenotypových poměrů platných při náhodném oplození. PŘÍKLAD 5.12 U Drosophila persimilis se vyskytuje gen vázaný na pohlaví podmiňující tvorbu fosfoglukomutázy (Pgm-1). V určité populaci byly nalezeny dvě alely tohoto genu, Pgm-1 A a

4 Pgm-1 B s četnostmi 0,25 a 0,75. Jaké jsou očekávané genotypové četnosti pro tento gen u samečků a samiček D. persimilis za předpokladu náhodného oplození? U samečků Pgm-1 A = 0,25; Pgm-1 B = 0,75. U samiček Pgm-1 A /Pgm-1 A = (0,25) 2 = 0,0625; Pgm- 1 A /Pgm-1 B = 2(0,25)(0,75) = 0,3750; Pgm-1 B /Pgm-1 B = (0,75) 2 = 0,5625. PŘÍKLAD 5.13 Znak rané opeření u kura domácího je kontrolován párem alel vázaných na pohlaví, K, k. Normální opeření K je dominantní vůči ranému opeření k. Kohouti Leghorn s raným opeřením se kříží se slepicemi Rhode Island Red s normálním opeřením. Jaký bude rovnovážný poměr jedinců s raným a normálním opeřením u každého pohlaví? Ukažte očekávané přibližování se populace k rovnováze výpočtem hodnot p f - p m pro prvních deset generací. Kohouti Leghorn s raným opeřením jsou genotypu kk, slepice Rhode Islad Red s normálním opeřením jsou genotypu K. Proto p mt = 0, p ft = 1. Průměrná četnost alel K je p = (p ft +2p mt )/3 = 0,3333, tj. rovnovážná četnost K pro obě pohlaví. Genotypový poměr bude: P fe = 0,33; R fe = 0,67; P me = 0,11; Q me = 0,44; R me = 0,45. Rané opeření se bude vyskytovat u 67% slepic a 55% kohoutů. Hodnoty p f - p m pro prvních deset generací budou: 1; -0,5; 0,25; -0,125; 0,0625; -0,03125; 0,015625; - 0, ; 0, ; - 0, ; 0, PŘÍKLAD 5.14 Geny, které determinují u člověka krevní skupiny systému MN a Ss jsou lokalizovány na témže chromozomu velmi blízko sebe s četností rekombinace menší než r = 0,02 (přesná hodnota není známa). Budeme předpokládat, že hodnota r = 0,01. Jaké typy gamet a v jakých četnostech budou tvořit jedici M S/N s? Jaké budou tvořit jedinci M s/n S? Jedinci M S/N s budou tvořit gamety M S, N s, M s a N S s četnostmi (1-0,01)/2 = 0,495; (1-0,01)/2 = 0,495; 0,01/2 = 0,005 a 0,01/2 = 0,005. Jedinci M s/n S tvoří stejné typy gamet s četnostmi 0,005; 0,005; 0,495; a 0,495. PŘÍKLAD 5.15 Inbrední kmen myší BALB/c je homozygotní na lokusu pro srst typu agouti a pro bílé zbarvení AA cc. Inbrední kmen C57BL/6 je naopak homozygotní aa CC. Oba dva lokusy jsou v různých vazbových skupinách. Jaké jsou očekávané četnosti gamet jedinců F 1 po křížení těchto dvou kmenů? Jaké jsou očekávané genotypové četnosti v F 2? Poněvadž uvažované geny nejsou ve vazbě, budou jedinci F 1 tvořit čtyři typy gamet se stejnou četností a v F 2 bude 9 různých genotypů s typickou četností pro dihybridní štěpení, odvozené rozvojem (1:2:1) 2. PŘÍKLAD 5.16 Četnosti gamet v určité populaci jsou v generaci t: P ABt = 0,13; P Abt = 0,17; P abt = 0,17 a P abt = 0,53. Vypočtěte podíly gamet v dalších třech generacích, jestliže a) r =1/2, b) r =1/4.

5 Četnosti gamet v jednotlivých generacích budou: P AB, P Ab, P ab a P ab v t: 0,13; 0,17; 0,17 a 0,53 (d = 0,04); t+1: 0,11; 0,19; 0,19; 0,51 (d = 0,02); t+2: 0,10; 0,20; 0,20; 0,50; (d = 0,01); t+3: 0,095; 0,205; 0,205; 0,495. b) t: 0,13; 0,17; 0,17; 0,53 (d = 0,04); t+1: 0,12; 0,18; 0,18; 0,52 (d = 0,03); t+2: 0,1125; 0,1875; 0,1875; 0,5125 (d = 0,0225); t+3: 0,1069; 0,1931; 0,1931; 0,5069. PŘÍKLAD 5.17 Příklad 5.15 se týkal křížení inbredních kmenů myší BALB/c (AA cc) x C57BL/6 (aa CC). Jaké budou rovnovážné distribuce gamet a genotypů po tomto křížení? Četnosti všech čtyř typů gamet budou shodné, tj. 1/4 a rovnovážné genotypové četnosti budou odpovídat genotypovému štěpnému poměru v F 2 pro dihybrida, tj. (1:2:1) 2. Těchto rovnovážných četností bude dosaženo v F 1. PŘÍKLAD 5.18 Jaká je rovnovážná četnost gamet v populaci z příkladu 5.16? Vypočtěte nerovnováhu v generaci t a generaci t+3, jestliže r = 1/2 a r =1/4. Rovnovážné četnosti gamet můžeme vypočítat z alelových četností v generaci t. p At = P ABt + P Abt = 0,3; obdobně p at = 0,7; q Bt = 0,3 a q bt = 0,7. Rovnovážné četnosti budou P ABe = 0,09; P Abe = P abe = 0,21; P abe = 0,49. V generaci t bude nerovnováha P ABt - P ABe = 0,04. Stejný výsledek (bez ohledu na znaménko) dostaneme pro jakýkoli rozdíl P ijt - P ije ; tento rozdíl se rovná dt. Rozdíl mezi četností jakékoli gamety v generaci t+3 a rovnovážnou četností této gamety je P ijt+3 - P ije = 0,005 pro r =1/2 a 0,0169 pro r =1/4. Vypočteme-li d t+3 z rovnice, pak P ABt+3 P abt+3 - P Abt+3 P abt+3 = (0,095)(0,495) - (0,205) 2 = 0,005 pro r =1/2 a (0,1069)(0,5069) - (0,1931) 2 = 0,0169 pro r =1/4. PŘÍKLAD 5.19 U Drosophila melanogaster jsou na chromozomu 3 lokalizovány tři geny determinující různé alozymy: esterázu-6 (alely E6 F a E6 S ), esterázu-c (alely EC F a EC S ) a octanoldehydrogenázu (alely Odh F a Odh S ). Pořadí těchto genů na chromozomu je E6 - EC - Odh. Hodnota rekombinace mezi E6 a EC je 0,122, mezi EC a Odh 0,002. Zjistěte, zda mezi geny E6 a EC je vazbová nerovnováha. Je-li zde nerovnováha, zjistěte hodnotu d relativně k hodnotě teoretického maxima nebo minima. Použijte údaje z příkladu 2.3. Pozorované počty typů chromozomů z př. 2.3 byly: E6 F EC F 159, E6 F EC S 16, E6 S EC F 277 a E6 S EC S 37. Alelové četnosti jsou: E6 F 0,3579, E6 S 0,6421, EC F 0,8916 a EC S 0,1084. Očekávané počty čtyř typů chromozomů za předpokladu vazbové rovnováhy jsou: 156,0; 19,0; 280,0 a 34,0. Hodnota χ 2 s jedním stupněm volnosti je 0,828, což odpovídá pravděpodobnosti asi 0,4. Nezamítáme proto hypotézu, že E6 a EC jsou ve vazbové rovnováze. PŘÍKLAD 5.20 Proveďte analýzu vazbové nerovnováhy pro geny EC a Odh s použitím údajů v příkladu 2.3. (Pozn. Pro výpočet hodnoty χ 2 je nejjednodušší nejdříve vypočítat ρ = d / (p A p a q B q b ) 1/2, poněvadž χ 2 = ρ 2 N, kde N je celkový počet zkoumaných chromozomů; ρ je hodnota korelace mezi alelami přítomnými na témže chromozomu).

6 Pozorované počty typů chromozomů z př. 2.3 byly: EC F Odh F 416, EC F Odh S 20, EC S Odh F 44 a EC S Odh S 9. Alelové četnosti jsou: EC F 0,8916, EC S 0,1084, Odh F 0,9407 a Odh S 0,0593 a d = [(416)(9) - (20)(44)] / = 0,0120. ρ = 0,0120 / [(0,8916)(0,1084)(0,9407)(0,0593)] 1/2 = 0,1631 a χ 2 = 0, x 489 = 13,0, což odpovídá pravděpodobnosti 0,0004. Mezi geny je tedy významná vazbová nerovnováha. Hodnota d max je menší z hodnot 0,053 a 0,102, tedy d max = 0,053. Hodnota vazbové nerovnováhy je d / d max = 0,012 / 0,053 = 22,6 procent teoretického maxima. χ 2 můžeme také vypočítat z očekávaných počtů čtyř typů gamet, které jsou podle výše uvedeného pořadí: 410,1; 25,9; 49,9 a 3,1. PŘÍKLAD 5.21 Vypočtěte χ 2 jako u příkladu 5.6 pro odhad statistické významnosti vazbové nerovnováhy mezi alelami genu pro alkoholdehydrogenázu u Drosophila melanogaster a přítomností nebo nepřítomností restrikčního místa EcoRI lokalizovaného nukleotidů dále po směru čtení. Použijeme údaje z příkladu k tab. 3.5: Adh F EcoRI + 22, Adh F EcoRI - 3, Adh S EcoRI + 4, Adh S EcoRI - 5. d=0,085 a χ 2 = ρ 2 N = 0,453 2 x 34 = 7,0 s jedním stupněm volnosti, kterému odpovídá hodnota pravděpodobnosti přibližně 0,01. Vazbová nerovnováha je statisticky významná a činí 49 % možné hodnoty maxima.

Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci

Více

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že

Více

Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat

Více

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto

Více

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat

Více

Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u

Více

Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem

Více

Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)

Více

Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela

Více

Příbuznost a inbreeding

Příbuznost a inbreeding Příbuznost a inbreeding Příbuznost Přímá (z předka na potomka). Souběžná (mezi libovolnými jedinci). Inbreeding Inbrední koeficient je pravděpodobnost, že dva geny přítomné v lokuse daného jedince jsou

Více

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) Testování statistických hypotéz Testování statistických hypotéz Princip: Ověřování určitého předpokladu zjišťujeme, zda zkoumaný výběr pochází ze základního souboru, který má určité rozdělení zjišťujeme,

Více

Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability

Heritabilita. Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability Heritabilita Heritabilita = dědivost Podíl aditivního rozptylu na celkovém fenotypovém rozptylu Výpočet heritability h 2 = V A / V P Výpočet genetické determinance znaku h 2 = V G / V P Heritabilita závisí

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského

Více

PRAKTIKUM Z OBECNÉ GENETIKY

PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie lizal@sci.muni.cz 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Příklad 1. Řešení 1 ŘEŠENÉ PŘÍKLADY Z MV2 ČÁST 11

Příklad 1. Řešení 1 ŘEŠENÉ PŘÍKLADY Z MV2 ČÁST 11 Příklad 1 Vyhláška Ministerstva zdravotnictví předpokládala, že doba dojezdu k pacientovi od nahlášení požadavku nepřekročí 17 minut. Hodnoty deseti náhodně vybraných dob příjezdu sanitky k nemocnému byly:

Více

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické

Více

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních

Více

S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef

Více

Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u

Více

676 + 4 + 100 + 196 + 0 + 484 + 196 + 324 + 64 + 324 = = 2368

676 + 4 + 100 + 196 + 0 + 484 + 196 + 324 + 64 + 324 = = 2368 Příklad 1 Je třeba prověřit, zda lze na 5% hladině významnosti pokládat za prokázanou hypotézu, že střední doba výroby výlisku je 30 sekund. Přitom 10 náhodně vybraných výlisků bylo vyráběno celkem 540

Více

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový

Více

Úvod do analýzy rozptylu

Úvod do analýzy rozptylu Úvod do analýzy rozptylu Párovým t-testem se podařilo prokázat, že úprava režimu stravování a fyzické aktivity ve vybrané škole měla vliv na zlepšené hodnoty HDLcholesterolu u školáků. Pro otestování jsme

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

NEPARAMETRICKÉ TESTY

NEPARAMETRICKÉ TESTY NEPARAMETRICKÉ TESTY Neparametrický jednovýběrový Jeden výběr jehož medián srovnáváme s nějakou hodnotou Wilcoxonův jednovýběrový test 1) Máme data z družice Hipparcos pro deklinaci (obdoba zeměpisné šířky)

Více

SEMESTRÁLNÍ PRÁCE Z PŘEDMĚTU STATISTIKY

SEMESTRÁLNÍ PRÁCE Z PŘEDMĚTU STATISTIKY ČESKÉ VYSOKÉ UČENÍ TECHNICKÉ FAKULTA DOPRAVNÍ SEMESTRÁLNÍ PRÁCE Z PŘEDMĚTU STATISTIKY Facebook vs. studium Vypracovali: Martina Grivalská Nikola Karkošiaková Barbora Brůhová Obsah 1. Úvod 2. Dotazník 3.

Více

Genetika populací. Doposud genetika na úrovni buňky, organizmu

Genetika populací. Doposud genetika na úrovni buňky, organizmu Doposud genetika na úrovni buňky, organizmu - jedinec nás nezajímá - pouze jeho gamety a to jako jedny z mnoha = genofond = soubor všech gamet skupiny jedinců Populace mnoho různých definic - skupina organizmů

Více

Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická

Více

6. Testování statistických hypotéz. KGG/STG Zimní semestr 6. Testování statistických hypotéz

6. Testování statistických hypotéz. KGG/STG Zimní semestr 6. Testování statistických hypotéz 6. Testování statistických Testování statistických Princip: Ověř ěřování určit itého předpokladu p zjišťujeme, zda zkoumaný výběr r pochází ze základnz kladního souboru, který mám určit ité rozdělen lení

Více

Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého

Více

Hardy-Weinbergův princip

Hardy-Weinbergův princip 1) Modelová populace 2) Hardy-Weinbergův princip 3) Hardy-Weinbergův princip využití Testování HW poměru Stanovení četnosti heterozygotů při úplné dominanci Interpretace DNA profilů 4) Snyderovy podíly

Více

Testování hypotéz. Analýza dat z dotazníkových šetření. Kuranova Pavlina

Testování hypotéz. Analýza dat z dotazníkových šetření. Kuranova Pavlina Testování hypotéz Analýza dat z dotazníkových šetření Kuranova Pavlina Statistická hypotéza Možné cíle výzkumu Srovnání účinnosti různých metod Srovnání výsledků různých skupin Tzn. prokázání rozdílů mezi

Více

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil

Více

Testování statistických hypotéz. Ing. Michal Dorda, Ph.D.

Testování statistických hypotéz. Ing. Michal Dorda, Ph.D. Testování statistických hypotéz Ing. Michal Dorda, Ph.D. Testování normality Př. : Při simulaci provozu na křižovatce byla získána data o mezerách mezi přijíždějícími vozidly v [s]. Otestujte na hladině

Více

- Definice inbreedingu a jeho teorie

- Definice inbreedingu a jeho teorie Negativní důsledky inbrední deprese v chovu skotu Ing. Jiří Bezdíček, Ph.D. Výzkumný ústav pro chov skotu, s.r.o., Rapotín 26. listopadu 2009 - Definice inbreedingu a jeho teorie - Proč je inbreeding v

Více

Testování statistických hypotéz. Ing. Michal Dorda, Ph.D. 1

Testování statistických hypotéz. Ing. Michal Dorda, Ph.D. 1 Testování statistických hypotéz Ing. Michal Dorda, Ph.D. 1 Úvodní poznámky Statistickou hypotézou rozumíme hypotézu o populaci (základním souboru) např.: Střední hodnota základního souboru je rovna 100.

Více

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch

Více

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that

Více

Inferenční statistika - úvod. z-skóry normální rozdělení pravděpodobnost rozdělení výběrových průměrů

Inferenční statistika - úvod. z-skóry normální rozdělení pravděpodobnost rozdělení výběrových průměrů Inferenční statistika - úvod z-skóry normální rozdělení pravděpodobnost rozdělení výběrových průměrů Pravděpodobnost postupy induktivní statistiky vycházejí z teorie pravděpodobnosti pravděpodobnost, že

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus

Více

Pravděpodobnost a statistika, Biostatistika pro kombinované studium. Tutoriál č. 5: Bodové a intervalové odhady, testování hypotéz.

Pravděpodobnost a statistika, Biostatistika pro kombinované studium. Tutoriál č. 5: Bodové a intervalové odhady, testování hypotéz. Pravděpodobnost a statistika, Biostatistika pro kombinované studium Letní semestr 2015/2016 Tutoriál č. 5: Bodové a intervalové odhady, testování hypotéz Jan Kracík jan.kracik@vsb.cz Obsah: Výběrová rozdělení

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

KGG/STG Statistika pro geografy

KGG/STG Statistika pro geografy KGG/STG Statistika pro geografy 4. Teoretická rozdělení Mgr. David Fiedor 9. března 2015 Osnova Úvod 1 Úvod 2 3 4 5 Vybraná rozdělení náhodných proměnných normální rozdělení normované normální rozdělení

Více

Jana Vránová, 3. lékařská fakulta UK

Jana Vránová, 3. lékařská fakulta UK Jana Vránová, 3. lékařská fakulta UK Vznikají při zkoumání vztahů kvalitativních resp. diskrétních znaků Jedná se o analogii s korelační analýzou spojitých znaků Přitom předpokládáme, že každý prvek populace

Více

Cvičení 12: Binární logistická regrese

Cvičení 12: Binární logistická regrese Cvičení 12: Binární logistická regrese Příklad: V roce 2014 konalo státní závěrečné zkoušky bakalářského studia na jisté fakultě 167 studentů. U každého studenta bylo zaznamenáno jeho pohlaví (0 žena,

Více

Příklady na testy hypotéz o parametrech normálního rozdělení

Příklady na testy hypotéz o parametrech normálního rozdělení Příklady na testy hypotéz o parametrech normálního rozdělení. O životnosti 75W žárovky (v hodinách) je známo, že má normální rozdělení s = 5h. Pro náhodný výběr 0 žárovek byla stanovena průměrná životnost

Více

PARAMETRICKÉ TESTY. 1) Měření Etalonu. Dataset - mereni_etalonu.sta - 9 měření etalonu srovnáváme s PŘEDPOKLÁDANOU HODNOTOU 10.

PARAMETRICKÉ TESTY. 1) Měření Etalonu. Dataset - mereni_etalonu.sta - 9 měření etalonu srovnáváme s PŘEDPOKLÁDANOU HODNOTOU 10. PARAMETRICKÉ TESTY Testujeme rovnost průměru - předpokladem normální rozdělení I) Jednovýběrový t-test 1) Měření Etalonu. Dataset - mereni_etalonu.sta - 9 měření etalonu srovnáváme s PŘEDPOKLÁDANOU HODNOTOU

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Frekvence alel 40... C C... H 10... CC... Q. frekvence p alely C... (2 x 150 + 40)/400 =0.85. frekvence q alely C... (2 x 10 + 40)/400 =0.

Frekvence alel 40... C C... H 10... CC... Q. frekvence p alely C... (2 x 150 + 40)/400 =0.85. frekvence q alely C... (2 x 10 + 40)/400 =0. Frekvence alel Př.1 U nocenky podmiňuje neúplně dominantní alela C tmavožluté zbarvení květu, alela C bílé; heterozygoti jsou světle žlutí. V populaci bylo celkem u vyšetřených 200 rostlin pozorováno:

Více

NÁHODNÁ ČÍSLA. F(x) = 1 pro x 1. Náhodná čísla lze generovat některým z následujících generátorů náhodných čísel:

NÁHODNÁ ČÍSLA. F(x) = 1 pro x 1. Náhodná čísla lze generovat některým z následujících generátorů náhodných čísel: NÁHODNÁ ČÍSLA TYPY GENERÁTORŮ, LINEÁRNÍ KONGRUENČNÍ GENERÁTORY, TESTY NÁHODNOSTI, VYUŽITÍ HODNOT NÁHODNÝCH VELIČIN V SIMULACI CO JE TO NÁHODNÉ ČÍSLO? Náhodné číslo definujeme jako nezávislé hodnoty z rovnoměrného

Více

Druhová a mezidruhová hybridizace

Druhová a mezidruhová hybridizace Druhová a mezidruhová hybridizace Obsah Druhová a mezidruhová hybridizace... 1 Obsah... 1 Monohybridní křížení... 1 Dihybridní křížení... 2 Polyhybridní křížení... 3 Souhrn Mendelismus v dědičnosti kvalitativních

Více

Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů

Více

HODNOCENÍ VÝKONNOSTI ATRIBUTIVNÍCH ZNAKŮ JAKOSTI. Josef Křepela, Jiří Michálek. OSSM při ČSJ

HODNOCENÍ VÝKONNOSTI ATRIBUTIVNÍCH ZNAKŮ JAKOSTI. Josef Křepela, Jiří Michálek. OSSM při ČSJ HODNOCENÍ VÝKONNOSTI ATRIBUTIVNÍCH ZNAKŮ JAKOSTI Josef Křepela, Jiří Michálek OSSM při ČSJ Červen 009 Hodnocení způsobilosti atributivních znaků jakosti (počet neshodných jednotek) Nechť p je pravděpodobnost

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Jednofaktorová analýza rozptylu

Jednofaktorová analýza rozptylu I I.I Jednofaktorová analýza rozptylu Úvod Jednofaktorová analýza rozptylu (ANOVA) se využívá při porovnání několika středních hodnot. Často se využívá ve vědeckých a lékařských experimentech, při kterých

Více

Příklad 1. Korelační pole. Řešení 1 ŘEŠENÉ PŘÍKLADY Z MV2 ČÁST 13

Příklad 1. Korelační pole. Řešení 1 ŘEŠENÉ PŘÍKLADY Z MV2 ČÁST 13 Příklad 1 Máme k dispozici výsledky prvního a druhého testu deseti sportovců. Na hladině významnosti 0,05 prověřte, zda jsou výsledky testů kladně korelované. 1.test : 7, 8, 10, 4, 14, 9, 6, 2, 13, 5 2.test

Více

Statistické metody uţívané při ověřování platnosti hypotéz

Statistické metody uţívané při ověřování platnosti hypotéz Statistické metody uţívané při ověřování platnosti hypotéz Hypotéza Domněnka, předpoklad Nejčastěji o rozdělení, středních hodnotách, závislostech, Hypotézy ve vědeckém výzkumu pracovní, věcné hypotézy

Více

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním

Více

Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových

Více

GENETIKA A JEJÍ ZÁKLADY

GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky

Více

4ST201 STATISTIKA CVIČENÍ Č. 7

4ST201 STATISTIKA CVIČENÍ Č. 7 4ST201 STATISTIKA CVIČENÍ Č. 7 testování hypotéz parametrické testy test hypotézy o střední hodnotě test hypotézy o relativní četnosti test o shodě středních hodnot testování hypotéz v MS Excel neparametrické

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Informační a znalostní systémy

Informační a znalostní systémy Informační a znalostní systémy Teorie pravděpodobnosti není v podstatě nic jiného než vyjádření obecného povědomí počítáním. P. S. de Laplace Pravděpodobnost a relativní četnost Pokusy, výsledky nejsou

Více

Název testu Předpoklady testu Testová statistika Nulové rozdělení. ( ) (p počet odhadovaných parametrů)

Název testu Předpoklady testu Testová statistika Nulové rozdělení. ( ) (p počet odhadovaných parametrů) VYBRANÉ TESTY NEPARAMETRICKÝCH HYPOTÉZ TESTY DOBRÉ SHODY Název testu Předpoklady testu Testová statistika Nulové rozdělení test dobré shody Očekávané četnosti, alespoň 80% očekávaných četností >5 ( ) (p

Více

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické Gonozomáln lní dědičnost Mgr. Aleš RUDA Chromozomové určení pohlaví autozomy gonozomy člověk má 22 párůp autozomů a 1 pár p gonozomů označen ení pohlavních chromozomů: : X a Y. jsou možné celkem 3 kombinace:

Více

Rozdělení přenosové rychlosti disku

Rozdělení přenosové rychlosti disku Rozdělení přenosové rychlosti disku Vladimír Třebický 10. května 2006 Pevné disky osobního počítače nepracují vždy stejně rychle. Rozdíly v rychlosti sekvenčního přístupu mají několik důvodů, důležitá

Více

Regresní analýza 1. Regresní analýza

Regresní analýza 1. Regresní analýza Regresní analýza 1 1 Regresní funkce Regresní analýza Důležitou statistickou úlohou je hledání a zkoumání závislostí proměnných, jejichž hodnoty získáme při realizaci experimentů Vzhledem k jejich náhodnému

Více

13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Jednovýběrový Wilcoxonův test a jeho asymptotická varianta (neparametrická obdoba jednovýběrového t-testu)

Jednovýběrový Wilcoxonův test a jeho asymptotická varianta (neparametrická obdoba jednovýběrového t-testu) Jednovýběrový Wilcoxonův test a jeho asymptotická varianta (neparametrická obdoba jednovýběrového t-testu) Frank Wilcoxon (1892 1965): Americký statistik a chemik Nechť X 1,..., X n je náhodný výběr ze

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

Základy biostatistiky II. Veřejné zdravotnictví 3.LF UK - II

Základy biostatistiky II. Veřejné zdravotnictví 3.LF UK - II Základy biostatistiky II Veřejné zdravotnictví 3.LF UK - II Teoretické rozložení-matematické modely rozložení Naměřená data Výběrové rozložení Teoretické rozložení 1 e 2 x 2 Teoretické rozložení-matematické

Více

Test dobré shody v KONTINGENČNÍCH TABULKÁCH

Test dobré shody v KONTINGENČNÍCH TABULKÁCH Test dobré shody v KONTINGENČNÍCH TABULKÁCH Opakování: Mějme náhodné veličiny X a Y uspořádané do kontingenční tabulky. Řekli jsme, že nulovou hypotézu H 0 : veličiny X, Y jsou nezávislé zamítneme, když

Více

Přednáška X. Testování hypotéz o kvantitativních proměnných

Přednáška X. Testování hypotéz o kvantitativních proměnných Přednáška X. Testování hypotéz o kvantitativních proměnných Testování hypotéz o podílech Kontingenční tabulka, čtyřpolní tabulka Testy nezávislosti, Fisherůvexaktní test, McNemarůvtest Testy dobré shody

Více

Závislost obsahu lipoproteinu v krevním séru na třech faktorech ( Lineární regresní modely )

Závislost obsahu lipoproteinu v krevním séru na třech faktorech ( Lineární regresní modely ) Úloha M608 Závislost obsahu lipoproteinu v krevním séru na třech faktorech ( Lineární regresní modely ) Zadání : Při kvantitativní analýze lidského krevního séra ovlivňují hodnotu obsahu vysokohustotního

Více

Populační genetika Radka Reifová

Populační genetika Radka Reifová Populační genetika Radka Reifová Prezentace ke stažení: http://web.natur.cuni.cz/~radkas v záložce Courses Literatura An Introduction to Population Genetics. Rasmus Nielsen and Montgomery Slatkin. 2013.

Více

Rozhodnutí / Skutečnost platí neplatí Nezamítáme správně chyba 2. druhu Zamítáme chyba 1. druhu správně

Rozhodnutí / Skutečnost platí neplatí Nezamítáme správně chyba 2. druhu Zamítáme chyba 1. druhu správně Testování hypotéz Nechť,, je náhodný výběr z nějakého rozdělení s neznámými parametry. Máme dvě navzájem si odporující hypotézy o parametrech daného rozdělení: Nulová hypotéza parametry (případně jediný

Více

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno urban@mendelu.cz htt://www.mendelu.cz/af/genetika/ Seminář doktorského grantu 53/03/H076 : Molekulárn

Více

Statistické metody v ekonomii. Ing. Michael Rost, Ph.D.

Statistické metody v ekonomii. Ing. Michael Rost, Ph.D. Statistické metody v ekonomii Ing. Michael Rost, Ph.D. Jihočeská univerzita v Českých Budějovicích Test χ 2 v kontingenční tabulce typu 2 2 Jde vlastně o speciální případ χ 2 testu pro čtyřpolní tabulku.

Více

analýza kategoriáln lních dat Prof. RNDr. Jana Zvárová, DrSc. Záznam epidemiologických dat Epidemiologické ukazatele

analýza kategoriáln lních dat Prof. RNDr. Jana Zvárová, DrSc. Záznam epidemiologických dat Epidemiologické ukazatele Testování statistických hypotéz z a analýza kategoriáln lních dat Prof. RNDr. Jana Zvárová, DrSc. 1 Záznam epidemiologických dat Rizikový faktor Populace Přítomen Nepřítomen Celkem Nemocní a b a+b Kontroly

Více

Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák

Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák KVANTITATIVNÍ GENETIKA dědičnost kvantitativních znaků ZNAKY KVALITATIVNÍ: gen znak barva hrachu: žlutá zelená (i komplikovaněji penetrace, epresivita,

Více