Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/

Rozměr: px
Začít zobrazení ze stránky:

Download "Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316"


1 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/

2 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace

3 Genetické markery Genetické markery jsou definovány jako morfologické, anatomické, fyziologické nebo biochemicko-genetické vlastnosti organismů těsně korelující s jinými, mnohdy složitějšími, vlastnostmi.

4 Rozdělení genetických markerů morfologicko-anatomické biochemicko-fyziologické markery zásobní a stavební proteiny biochemicko-genetické izoenzymy nukleové kyseliny

5 Základní rozdělení DNA markerů délkového polymorfismu fragmentů DNA vzniklých restrikčním štěpením (RFLP) detekce variability na základě amplifikace fragmentů DNA v in vitro podmínkách (PCR) různých typů propojení metod RFLP a PCR (AFLP) polymorfismu repetetivních sekvencí mini- a mikrosatelitů stanovení sekvencí neboli pořadí nukleotidových párů v molekule DNA

6 Oblasti využití genetických markerů humánní medicína veterinární medicína kriminalistika šlechtění a plemenářství evoluční biologie paleontologie detekce letálně působících genů detekce napadení člověka například viry určení paternity detekce napadení zvířat například viry detekce letálně působících genů jednoznačná identifikace osob selekce s využitím markerů identifikace odrůdové pravosti a čistoty určení paternity fytopatologie historie

7 Selekce s využitím markerů Selekce s využitím markerů neboli MAS (Marker Assisted Selection) je aktuální trend ve šlechtění rostlin i zvířat. MAS je založeno na tom, že šlechtitel selektuje potomstvo na základě genetické analýzy s využitím různých typů markerů. Tímto způsobem eliminuje chybu selekce u znaků, které jsou modifikovány vnějším prostředím. Použití metody MAS výrazně urychluje a zefektivňuje šlechtění. Řada genetických markerů vykazuje kodominanci a umožňují tak odlišit homozygoty od heterozygotů. U kvantitativních znaků jsou pomocí MAS identifikovány takzvané kandidátní geny, které vykazují majoritní efekt na úroveň kvantitativního znaku. DNA markers can be used to determine whether a seedling carries an allele of interest. Here, the marker for the red-flesh allele is detected as an additional DNA band on an agarose gel. Breeders use information like this to decide which seedlings to grow and which to discard.

8 Biochemicko-genetické markery - detekce variability organismů přímo na úrovni jejich genetické informace. - starší typy markerů (proteiny, izoenzymy) detekovaly variabilitu produktů transkripce a translace. - současnost: detekce variabilitu nositelů genetické informace DNA a RNA. - zpravidla je variabilita detekována a vyhodnocována na základě elektroforetické separace různě velkých molekul obvykle na gelovém nosiči.

9 Markery založené na polymorfismu DNA Základní vlastnosti DNA markerů: jsou aplikovatelné u všech organismů, kde je zvládnutá technika izolace DNA nejsou závislé na podmínkách prostředí jejich počet je téměř neomezený často lze DNA markery lze použít na minimálním množství DNA = nedestruktivní metody (části listů, semena) pomocí DNA markerů lze charakterizovat i velmi raná ontogenetická stádia organismů

10 Proteinové markery Jsou známy vztahy mezi přítomností určité bílkoviny, lokalizací jejího genu a dalšími vlastnostmi rostliny. Pomocí těchto markerů je možné predikovat například kvalitu složení obilky, odolnosti k některým chorobám nebo stanovit odrůdovou pravost vypracovány certifikované metodiky U skotu je obdobným způsobem provedeno hodnocení proteinů mléka. Příklad využití proteinových markerů při studiu linií pýru (Agropyron elongatum) (potenciální zdroj genů tolerance pšenice vůči salinitě a suchu). Přítomnost specifických bandů u linií s vlastnostmi, které by mohly ovlivňovat vlastnosti těsta.

11 Isozymy = allozymy U většiny enzymů existují takzvané izoformy neboli izoenzymy. Izoenzymy katalyzují stejnou biochemickou reakci, t.j. reagují s jedním substrátem a vytváří shodný produkt. Izoformy jednoho enzymu se vzájemně odlišují například velikostí molekuly. Levné, rychlé, dostupné? Omezená hodnota informací Exprese závislá na prostředí Jen čerstvý materiál

12 Isozymy = allozymy

13 Isozymy = allozymy

14 RFLP RFLP - Restriction Fragment Lenght Polymorphism Polymorfismus v délce restrikčních fragmentů gdna naštěpíme restriktázou fragmenty rozdělíme elektroforeticky z gelu je přesajeme na membránu membránu hybridizujeme se sondou navázanou sondu detekujeme U malých genomů nebo malých fragmentů DNA s malým počtem vznikajících fragmentů metoda využívá pouhé elektroforetické separace různě dlouhých fragmentů U větších genomů technika využívá DNA-DNA hybridizace na principu Southern blottingu.

15 Co jsou to restrikční fragmenty? Restrikční fragmenty jsou úseky molekul DNA, které vznikají enzymatickou aktivitou restrikčních endonukleáz, které rozpoznávají specifické sekvence, kde přestřihnou molekulu DNA.

16 Postup RFLP Rozpoznávací místo restriktázy EcoRI - 6bp dlouhou sekvence (GAATTC) ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC Sonda -Ze všech naštípaných fragmentů vybírám pouze určitou část DNA, kterou studujeme (gen)

17 Postup RFLP Rozpoznávací místo restriktázy EcoRI - 6bp dlouhou sekvence (GAATTC) ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC



20 Postup RFLP Mutovaná (popř. recesivní) alela ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGACTTCGCCCTTC ztráta restrikčního místa (nezabrání vazbě sondy)

21 Postup RFLP Mutovaná (popř. recesivní) alela po naštěpení ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGACTTCGCCCTTC ATCGTCCAG AATTCATGCCCTTCGCCCTTCCGTCCAGACTTCGCCCTTC ztráta restrikčního místa (nezabrání vazbě sondy)


23 RFLP Sondou se rozumí úsek jednořetězcové DNA, který má sekvenci jako detekovaný gen. Sonda je obvykle označena radioizotopem fosforu, který ji umožňuje detekovat. classes.midlandstech.edu

24 Genetická interpretace RFLP markerů RFLP markery představují kodominantní typ markerů. Umožňují vzájemně odlišit dominantní homozygoty, heterozygoty a recesivní homozygoty. Uplatňují se například: 1. Pro vyhledávání v genomových knihovnách 2. Pro detekce konkrétních genů 3. Pro detekce bodových mutací 4. Pro tvorbu RFLP map,.

25 Segregace RFLP markeru Letální recesivní alela vznikla mutací a liší se od dominantní alely ztrátou restrikčního místa.

26 Případ Colin Pitchfork (1983 a 1986) Dvě slečny znásilněny a zavražděny v hrabství Leicestershire v Anglii Mentálně zaostalý mladík Richard Buckland, který nahlásil nález druhého těla, se přiznal k zavraždění této dívky Na základě RFLP vyloučen místních mužů bylo požádáno o vzorek krve nebo bukální stěr Pekař exhibicionista Colin Pitchfork za sebe k odběru poslal (za 200 liber) kamaráda Iana Kellyho, který se tím pochlubil v hospodě První omilostnění a první obvinění pomocí DNA důkazů.

27 Nevýhody RFLP Požadavek velkého množství intaktní DNA (50 ng odpovídá ~ buněk) Metoda málo robustní (interpretační potíže)

28 Replikace in vivo

29 Amplifikace fragmentů DNA v in vitro podmínkách Tato metoda detekce genů je označována jako polymerázová řetězová reakce PCR (Polymerase Chain Reaction). Je založena na zmnožení hledaného úseku DNA. Který je ohraničen známými sekvencemi takzvanými primery. Metoda je tvořena opakováním těchto kroků: denaturace analyzované templátové DNA nasedání dvojice primerů annealing prodlužováním fragmentů DNA. Zmnožení fragmentu DNA je prováděno v termocykleru. tnrtb.wordpress.com


31 objev DNA polymerázy a první pokusy s umělou syntézou většího množství DNA (amplifikace DNA) PCR replikace in vitro PCR Polymerase Chain Reaction Polymerázová řetězová reakce 1983 Karry Mullis pracoval na projektu geneticky podmíněných chorob člověka v kalifornské firmě Cetus Corporation. Hledal novou metodu analýzy mutací DNA. Modifikoval Sangerovu metodu sekvenace DNA přidal zpětný primer pro syntézu krátkých úseků DNA. Uvědomil si, že opakováním amplifikace DNA pomocí DNA polymerázy může vést k řetězovému množení specifického segmentu genomu - PCR. Pomocí PCR můžete z jedné molekuly DNA vytvořit 100 biliónů kopií za jedno odpoledne. Potřebujete jenom zkumavku, několik jednoduchých reagencií a zdroj tepla 1984 rozpracování metody s matematikem Fredem Faloonou, patentování (Mullis et al. 1986; Mullis a Faloona 1987) 1993 Nobelova cena za chemii V devadesátých letech Cetus Corp. prodává patenty PCR a Taq firmě Hoffman La Roche za 330 miliónů $

32 Polymerázová řetězová reakce denaturace annealing prodlužování cit.vfu.cz

33 Zvyšování počtu kopií fragmentu DNA při PCR

34 PCR replikace in vitro DNA

35 PCR Polymerase Chain Reaction další rozvoj metody s použitím termostabilní polymerázy z termofilní bakterie Thermus aquaticus = zkratka Taq Pol" nebo "Taq")

36 Jak lze zjistit výsledek amplifikace Výsledek amplifikace se stanovuje gelovou elektroforézou. Elektroforeogram amplifikovaných fragmentů DNA, které umožní identifikovat odrůdy brambor.

37 PCR hlavní faktory ovlivňující průběh reakce Koncentrace dntps - stock solution 100mM - ředění na 20 a 200 mol (pro každý dntp) vyšší specifičnost a nižší frekvence zařazení nesprávného nukleotidu Koncentrace MgCl2 - optimum je 1,5-2mM, - nad 6mM klesá aktivita Taq Polymerázy - nízká koncentrace nízké výtěžky PCR - příliš vysoké koncentrace rozmazané proužky na gelu nebo zmnožení nespecifických produktů Teplota annealingu nasednutí primerů - vyšší teplota = vyšší specifičnost ke komplementární sekvenci = primer nasedá na komplementární místo s vyšší přesností = přesnější výsledek PCR - nižší teplota vhodné pro studie, kdy se používají primery odvozené od příbuzných druhů; nebezpečí vzniku nespecifických produktů (jiné úseky DNA, než které jsme chtěli získat) - zvýšení specifičnosti např. tzv. Touch down PCR v prvních cyklech vyšší teplota = specifické produkty, ale v s nižším výtěžkem = v dalších cyklech vyšší teplota annealingu = zvýší se výtěžek PCR - Koncentrace templátové DNA příliš vysoká konc. DNA může bránit PCR, zároveň se naředí inhibitory PCR ve směsi (např. chemikálie použité při izolaci)

38 PCR hlavní faktory ovlivňující průběh reakce Volba polymerázy odlišné výsledky PCR od Taq P. od různých firem - např. pro sekvenace proofreading polymerase nižší procento vložení chybného nukleotidu Aditiva - pro zvýšení efektivity PCR, stabilizaci enzymu - v pufru dodávaném s polymerázou: - detergenty (TRITON X-100, TWEEN, NP-40) - zpravidla 2 ze tří uvedených - dimetylsulfoxin nebo glycerol lepší průběh denaturace a chlazení - BSA (bovinní sérový albumin) nebo želatina - Finální koncentrace aditiv se pohybuje mezi 0,1 a 1,0% celkové reakční směsi, avšak konkrétní koncentrace je většinou nutno empiricky vyzkoušet. Kontaminace nebezpečí zejména u málo koncentrovaných nebo problematických templátů - sterilní špičky, vysoce čistá voda pro PCR, pufry, PCR zkumavky, rukavice (nikdy nesterilizovat dntps, primery, polymerázu ) - příprava PCR směsí ve flow boxu v oddělené místnosti od prostor, kde se pracuje s produkty - při přecházení z místností měnit rukavice..

39 Optimalizace reakčních podmínek PCR - Změny v protokolu vedoucí k odstranění nežádoucích nespecificit a ke zvýšení množství PCR produktu. - počet cyklů - annealingová teplota - koncentrace Mg 2+, polymerázy, templátové DNA - aditiv (např. DMSO, formamid) Marker 1 - produkt 240bp Příklad optimalizace PCR Podmínky podle literatury B PCR po optimalizaci Ta = 62 C, 30 cyklů 20uM primery Ta = 67 C, 25 cyklů 10uM primery B Marker 2 - produkt 460bp Ta = 66 C, 30 cyklů 20uM primery Ta = 66 C, 25 cyklů 10uM primery

40 RAPD - Random Amplified Polymorphic DNA Variabilita délek náhodně amplifikované DNA

41 RAPD Random Amplified Polymorphic DNA Variabilita délek náhodně amplifikované DNA PCR s jedním primerem Primer dosedne na různých místech a v různých směrech amplifikuje DNA fragmenty Identifikace např. kmenů bakterií popř. ověřování homogenity linií

42 RAPD Výhody - Velmi levné - Rychlé a snadné = není třeba znát sekvenci primeru, stačí velmi málo DNA, poměrně dost fragmentů Nevýhody převažují: - Omezena hodnota informace (dominantní marker) - Nereproducibilní DNES TREND NEUŽÍVAT RAPD MARKERY

43 AFLP - Amplified Fragment Length Polymorphism Polymorfismus délky amplifikovaných fragmentů

44 AFLP Princip metoda založená na restrikci DNA dvěma enzymy selektivní namnožení jen některých proužků vizualizace proužků na gelu Postup relativně složitý (4 fáze) 1. RESTRIKCE specifické rozštěpení DNA restrikčními endonukleázami MseI - rozpoznává 4bp dlouhou sekvenci (TTAA) EcoRI - rozpoznává 6bp dlouhou sekvenci (GAATTC) (Variabilita je dána mutací v restrikčním místě insercí - delecí mezi restrikčními místy) získáme množství fragmentů s lepivými konci = sticky ends

45 AFLP 2. ligace pomocí T4 ligázy k fragmentům přidány adaptory = oligonukleotid, jeho sekvenci známe známe sekvence konců všech fragmentů můžeme je amplifikovat PCR

46 AFLP 3. preselektivní amplifikace klasická PCR s primery komplementárními k sekvenci adaptorů, navíc 1 nukleotid směrem dovnitř amplifikovaného úseku = selekce jen ca. 1/4 fragmentů (fragmenty komplementární k primerům + fragmenty EcoRI- MseI)

47 AFLP 3. preselektivní amplifikace restrikce + ligace

48 AFLP 3. preselektivní amplifikace restrikce + ligace preamplifikace

49 AFLP 4. selektivní amplifikace -fragmentů je stále mnoho pro objektivní vyhodnocení -další redukce jejich počtu použitím primerů se 3mi selektivní nukelotidy (s přesahem "dovnitř" amplifikovaných fragmentů) - tento krok se provádí opakovaně s různými primerovými kombinacemi (primery se liší zařazenými nukleotidy na koncích -redukce na 1/256 všech fragmentů (1/16 x 1/16)

50 AFLP 5. vyhodnocení -primery jsou fluorescenčně značeny sekvenátor - Primery bez značení PAGE elektroforéza

51 AFLP realizace AFLP - realizace 1: Restrikce - příprava restrikčního mixu (EcoI, MseI, buffer, voda) - přidat k DNA - inkubovat 2 hod při 37 C 2: Ligace - příprava ligačního mixu (LIGAZA, BUFF, ADAPTORY, VODA) - přidat k roztoku z předchozího kroku - inkubovat 2,5 hod při 37 C 3: Preamplifikace - klasická PCR - ligační roztok jako matrice Kroky 1-3 se provedou pouze 1x, dál pracujeme s preamplifikátem 4: Amplifikace - klasická PCR - matrice = preamplifikát - měníme kombinace primerů = detekujeme jiné fragmenty


53 MIKROSATELITY krátké tandemové repetice, STR (short tandem repeats) repetice jednoduchých sekvencí, SSR (simple sequence repeats) krátké, tandemově se opakující jednoduché sekvenční motivy zpravidla o délce 2-6bp prokaryota a eukaryota kódující i nekódující oblasti Vysoká mutační rychlost (u savců 10-3 až 10-4/lokus/generaci) hlavní zdroj vysoké proměnlivosti - sklouznutí nukleotidového řetězce během replikace (replication slippage). GTTCTGTCATATATATATATAT CGTACTT GTTCTGTCATATATATATATATATATATCGTACTT Alely se liší svou délkou Snadná separace pomocí elektroforézy

54 MIKROSATELITY Dokonalé = perfect repeats (jeden nepřerušený motiv): Jednonukleotidové: AAAAAAAAAAAAAAAAAA Dinukleotidové: CACACACACACACACACACA = (CA)n Trinukleotidové: CGTCGTCGTCGTCGTCGTCGT = (CGT)n Tetranukleotidové: CAGACAGACAGACAGACAGA =(CAGA)n Pentanukleotidové: AAATTAAATTAAATTAAATT =(AAATT)n Hexanukleotidové: CTTTAACTTTAACTTTAACTTTAA =(CTTTAA)n Pr: (AG)32 ; (TAT)25 ; (CAA)7 Cicer Nedokonalé = imperfect repeats (motiv je přerusen jedním nebo několika bazemi): (TC)6A(TC)13 ; (AG)12GG(AG)3 Cicer Složené = compound: (směs dokonalých nebo nedokonalých vzorů několika motivů) (AT)6(GT)42AT(GT)5(GT)10 (AT)14(AG)8 (GAA)21 (TA)23 Nejčastější motivy: mono a dinukleotidové; 3, 4 a 5ti méně


56 ELFO separace

57 MIKROSATELITY Výhody - vysoká variabilita - velká početnost a rozmístění po celém genomu - jednoduchost analýzy (mikrosatelity lze poměrně snadno studovat pomocí PCR) - robustní a reproducibilní markery - KODOMINANTNÍ MARKER, IDENTIFIKACE ALEL Nevýhody - Musíme znát sekvence primerů - Pokud neznáme, tak testovat SSR z příbuzných druhů - Optimalicace PCR - Popřípadě vyvíjet nové: EST-SSR

58 MIKROSATELITY - využití jaderné mikrosatelity (SSRs) nejlepší marker pro zhodnocení variability na populační úrovni jsou potřeba druhově specifické primery, tj. metoda použitelná pouze v případě, že pro studovaný druh byly primery již publikovány chloroplastové mikrosatelity (cpdna SSRs) vhodné pro hodnocení variability na úrovni příbuzných druhů, někdy i na vnitrodruhové úrovni dostupné jsou univerzální primery Obecně: Forenzní genetika: kriminalistika, identifikace jedinců, příbuzenské vztahy analýza rodičovství (parentage analysis) určení rodičů semen (semenáčků) v populacích identifikace klonů populačně-genetické studie genový tok, migrace historie populací

59 MIKROSATELITY - využití

60 MIKROSATELITY - využití


62 SEKVENOVÁNÍ DNA - princip zjištění pořadí nukleotidů v řetězci DNA ATATATAGGCAAGGAATCTCTATTATTAAATCATT Zjištění rozdílů mezi jedincemi, geny Základní informace pro konstrukci primerů využití informace ke zjištění průběhu a rychlosti evoluce zjištění podobnosti a příbuznosti taxonů

63 SEKVENOVÁNÍ DNA - princip 1) Předstupeň: PCR s použitím dvojice primerů namnožení studovaného úseku DNA 2) sekvenační reakce použití pouze jednoho primeru kromě dntp jsou ve směsi přítomny i ddntp produkce fragmentů lišících se přesně o 1 bázi Elektroforetická separace fragmentů na gelu automatický sekvenátor

64 SEKVENOVÁNÍ DNA Aplikace - Aplikační možnosti: 1. evoluce genů (vznik alel, lokusů,redukce polymorfismu v důsledku selekce atd.) 2. vnitrodruhové (populační) studie (geografická proměnlivost, tok genů, hybridizace, fylogeografie (př. mitochondriální geny, Y chromozom) 3. mezidruhové studie (studium speciace, biogeografie) - volba správné sekvence 4. Detekce SNP = identifikace jedinců, taxonů, populací sekvenace pomáhá nalézt drobné populačně- i taxonově-specifické rozdíly Výhoda - Možnost srovnání sekvenčních dat o vašem organismu s údaji v internetových databázích Př:

65 SEKVENOVÁNÍ DNA 1977: dvě metody zjištění pořadí nukleotidů v DNA Maxamova-Gilbertova (chemická) metoda je založena na bázově-specifické chemické modifikaci a následném štěpení fragmentů DNA - dnes se neužívá Krátká sekvencedna (ds nebo ss) * na 5' konci radioaktivně označena 32 P. * vzorek se rozdělí na pět částí a) Přídavek chemikálí modifikují vždy jeden nebo dva typy nukleotidů: 1. dimethylsulfát: G 2. kys. mravenčí: A+G 3. hydrazin: C + T 4. 1,5M NaCl: C b) Přídavkem piperidinu: štěpení DNA v místě modifikace c) Elfo separace Výsledek ELFO: sekvence DNA: 5 -GTCTGCA-3 (čte se zespodu) - narazila na technické problémy s vývojem standartních molekulárních kitů - technicky příliš komplexní a příliš mnoho toxických látek

66 SEKVENOVÁNÍ DNA Sangerova metoda terminace řetězce Sangerova metoda založena na terminaci replikace nového řetězce podle matrice zkoumané sekvence dideoxynukleozidtrifosfátem (ddntp) na 3 -uhlíku deoxyribózy chybí OH-skupina a proto k nim DNA polymeráza nemůže navázat další nukleotid pokud během replikace dojde k náhodné inkorporaci dideoxynukelotidu (dda, ddc, ddg, ddt), replikace se zde zastaví

67 SEKVENOVÁNÍ DNA Sangerova metoda založená na terminace řetězce Sangerova (enzymatická) metoda Vzorek DNA se rozdělí do čtyř zkumavek a do každé se přidá specifický primer, směs všech čtyř standartních nukleotidů a DNA polymeráza Do každého ze vzorků je přidán vždy jen jeden značený dideoxynukleotid - v určitém poměru s deoxinukleotidy Př: dda + da, dg, dc, dt ddt + da, dg, dc, dt. Po ukončení amplifikace separace pomocí denaturující PAGE v dlouhém (sekvenačním) gelu + detekce autoradiograficky výsledné pořadí nukleotidů se odečte

68 SEKVENOVÁNÍ DNA - zefektivnění Sangerovy metody vývoj kapilárních sekvenátorů Syntéza DNA je v principu totožná s asymetrickou PCR (tj. s jedním primerem) v normálním termocykleru, s extenzí řetězce Taq polymerázou. k detekci produktů jsou užívány fluorescenčně značené ddntp = každý dideoxynukleotid má jinou značku tzv. Dye-terminator sequencing Př. ABI PRISM Big Dye Terminator v 3.1. Ready Reaction Cycle Sequencing Kit Polymerizační reakce probíhá v jednom vzorku během PCR dochází k produkci fragmentů lišících se o jednu bázi detekce produktů probíhá během elektroforetické migrace v kapiláře pomocí laserového detektoru sekvence je zaznamenána přímo do paměti počítače bp/run

69 SEKVENOVÁNÍ DNA - zefektivnění Sangerovy metody vývoj kapilárních sekvenátorů Vzorek s fluorescenčně značenými fragmenty po PCR


71 SEKVENOVÁNÍ DNA - zefektivnění metody vývoj kapilárních sekvenátorů Kapiláry - vnitřní průměr 50μm - naplněny gelem s nízkou viskozitou, který nahradil polyakrylamid (dříve kapiláry nešlo opakovaně používat) - kratší časy analýz - plně automatizované systémy


73 Automatické sekvenátory

74 Nature Reviews Microbiology 7,

75 NGS = Next Generation Sequencing Celogenomové sekvenování - paralelně probíhající sekvenační reakce - produkují tisíce miliony sekvencí v jednom běhu - čtení kratších úseků (30-300bp) - Obecný postup 1. Izolace DNA 2. Příprava DNA knihovny PCR, klonování 3. Vlastní sekvenace 4. Vyhodnocení surových dat 5. Sestavení konsenzuální sekvence


77 Nature Reviews Microbiology 7,

78 454 - Pyrosekvenace - první nová sekvenační metoda (1998) - princip: detekce aktivity DNA-polymerázy během syntézy DNA - Výhody: - délka čtených úseků 700bp - rychlost sekv. cyklus 10 hodin - sekvenace PCR produktů - Nevýhody - překryvy homopolymerních oblastí - cena

79 454 sekvenování úseky 300 bp - čteno 400 tisíc fragmentů najednou Fragmentace DNA bp Ligace adaptorů - B adaptor má biotinovou značku pro přichycení na streptavidinem obalenou magnetickou kuličku Pico-titer plate (sekvenační čip - obsahuje 1,6 mil jamek širokých 44μm - průměr DNA kuličky je 26 μm -přídavek menších kuliček dvou typů jeden obsahuje chemikálie pro pyrosekvenaci, druhý typ fixuje kuličky s DNA Emulzní PCR - DNA kuličky do roztoku oleje a vody - Protřepání = vznik mikroreaktoru okolo kuličky Sekvenační reakce - Na destičku se cyklicky nanáší roztok polymerázy a vždy jednoho nukleotidu viz. pyrosekvenace Záznam a zpracování dat

80 Pyrosekvenování 1. začlenění nukleotidu (konkrétní typ, ne směs) 2. uvolnění pyrofosfátu (PPi) 3. Vznik ATP Enzym ATP sulfuryláza katalyzuje vznik ATP reakcí PPi s adenosinfosfosulfátem (APS) 4. Emise záření: enzym luciferáza spotřebuje vzniklý ATP na oxidaci luciferinu záblesk 5. Detekce záblesku 6. Enzym apyráza odstraní nespotřebované nukleotidy a ATP 7. Promytí systému 8. Změna typu nukleotidu ve směsi krok č 1.

81 pico-titer plate from Roche's FLX

82 Roche 454 sequencing

83 Illumina Genome Analyzer -metoda sekvenace syntézou (SBS-sequencing by synthesis) - r. 2006; úseky 35-50bp - 1) Příprava knihovny - fragmentace - na konce dva adaptéry - ELFO: vyříznou se fragmenty bp - přečištění - 2) Amplifikace fragmentů (bridge amplification) - na sklíčku jsou oligonukleotidy komplementární k oběma adaptorům - jednovláknové fragmenty se navážou na sklíčko vytvoří můstek - dosyntetizování komplementárního vlákna - denaturace dva identické fragmenty navázané na sklíčko blízko sebe - opakování = vznik tisíců kopií těsně vedle sebe v tzv. clusterech

84 Illumina Genome Analyzer - 3) sekvenační reakce - v každém cyklu NARÁZ všechny nukleotidy - mají fluorescenční značku a modifikovaný 3 konec (brání zařazení více nukleotidů v jednom kroku) - zařazení nukleotidu provázené emisí světla, charakteristického pro daný nukleotid - detekce - odstranění fluoresc. značky a odblokování 3 konce - opakování postupu - x cyklů - zpracování dat


86 Illumina sequencing


88 SOLiD sequencing Sekvenace pomocí LIGACE krátkých oligo sond, které jsou fluorescenčně značeny + cena + vysoká přesnost metody (99,95%) + malé množství vzorku - čtené úseky: 100 bp - náročnost zpracování dat a rychlost analýzy (týden)

89 SOLiD sequencing 1. Příprava DNA knihovny Štěpení templátové DNA na kratší fragmenty Připojení adaptorů P1 a P2 empcr amplifikace fragmentů na magn. kuličkách modifikace 5 konce připojení na sekvenační destičku 2. Vlastní sekvenace

90 SOLiD sequencing - Sekvenační reakce Navázání univ. primeru, ligace sondy Připojení univ. primeru k adaptoru P1 Přidání oktamerních sond s fluoro. značkami 4 barvy, 16 kombinací koncových nukleotidů na 1. a 2. pozici Pokud je sonda na 1. a 2. pozici komplementární k 1. a 2. pozici templátu prodloužení řetězce DNA ligázou 2. Emise a detekce fluoresc. signálu 3. Odštěpení fluoresc. značky (štěpení sondy mezi 5. a 6. nukeotidem) 4. Opakování kroků x-krát po konec sekvence 5. Reset primeru odštěpení nově nasynt. Vlákna 6. Napojení nového univ. primeru k adaptoru P1 - primer je o jeden nukleotid kratší 7. Opakování kroku s primery (n-2) až (n-6) 8. Vyhodnocení dat dešifrování barevného kódu

91 8. Vyhodnocení dat dešifrování barevného kódu - každá báze je určena na základě dvou nezávislých sekvenačních cyklů


93 SOLiD sequencing







100 Odvozené metody využívající NGS sekvenace při hledání SNP polymorfismů

101 RRL sequencing Trends in Genetics April 2013, Vol. 29, No. 4

102 RAD-Taq sequencing - restrikce: DNA je naštípána restriktázami, - ligace: na vzniklé fragmenty je navázán adaptor, - vysokokapacitní NGS sekvenování (tagged fragment amplification) - analýza dat. - Hledání SNP a) anotace k referenčnímu genomu b) pooling vzorků a hledání SNP lokusů (putative RADtaq locus) - Kombinace snížení komplexnosti genomu restrikčním štěpením s NGS sekvenováním.

103 That s all folks!

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,


Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Molekulární markery II. mikrosatelity, sekvenace, NGS, metody odvozené od NGS


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit


Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci





Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje



POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi



MOLEKULÁRNÍ TAXONOMIE - 4 MOLEKULÁRNÍ TAXONOMIE - 4 V této přednášce si představíme metody, které získávají molekulární znaky bez použití sekvenace. Všechny tyto metody je teoreticky možné sekvenací nahradit. Oproti sekvenaci celých





6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního


Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika


Sekvenování nové generace. Radka Reifová

Sekvenování nové generace. Radka Reifová Sekvenování nové generace Radka Reifová Prezentace ke stažení www.natur.cuni.cz/zoologie/biodiversity v záložce Přednášky 1. Přehled sekvenačních metod nové generace 2. Využití sekvenačních metod nové


velké fragmenty střední fragmenty malé fragmenty

velké fragmenty střední fragmenty malé fragmenty velké fragmenty střední fragmenty malé fragmenty Southern 1975 Northern Western denaturace DNA hybridizace primerů (annealing) (mají délku kolem 20 bází) syntéza nové DNA termostabilní polymerázou vstup


Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin


Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin









RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání


Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů CZ.1.07/1.1.00/14.

Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů CZ.1.07/1.1.00/14. Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů CZ.1.07/1.1.00/14.0016 Molekulární markery využívané při studiu variability


Elektroforéza Sekvenování

Elektroforéza Sekvenování Elektroforéza Sekvenování Výsledek PCR Elektroforéza V molekulární biologii se používá k separaci nukleových kyselin a bílkovin Principem je pohyb nabitých molekul v elektrickém poli Gelová, polyakrylamidová


V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)


Molekulární metody ve studiích kořenových systémů. Jiří Košnar, 2016

Molekulární metody ve studiích kořenových systémů. Jiří Košnar, 2016 Molekulární metody ve studiích kořenových systémů Jiří Košnar, 2016 Úvod Řešení otázek: identifikace (barcoding) a kvantifikace rostlinných druhů ve společenstvu identifikace (barcoding) a kvantifikace



DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby


Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání


Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění


Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich


Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray


variabilita genomu bottleneck Nature Science

variabilita genomu bottleneck Nature Science variabilita genomu Nature Science genetická diverzita člověka na úrovni SNP je nízká: asi 0.1% cca. 90% variace je uvnitř populací cca. 10% mezi populacemi (kontinenty) bottleneck personal genomes James


Metody molekulární biologie v rostlinné ekologii a systematice

Metody molekulární biologie v rostlinné ekologii a systematice Protokoly a návody pro praktikum Metody molekulární biologie v rostlinné ekologii a systematice Laboratoř molekulární biologie rostlin, PřF JCU, Branišovská 31, České Budějovice 2008, Miroslava Herbstová,


Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská


Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace


Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip


Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky

Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky Biotechnologický kurz Biotechnologický kurz III. letní škola metod molekulární biologie nukleových kyselin a genomiky 18. - 22. 6. 2012 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně


Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:


Genotypování markerů užitkovosti a zdraví u skotu

Genotypování markerů užitkovosti a zdraví u skotu Mezinárodní odborný seminář Využití chovatelských dat onemocnění skotu pro management stád, šlechtění a pro racionální užívání antimikrobik. Genotypování markerů užitkovosti a zdraví u skotu Jitka Kyseľová


Využití metagenomiky při hodnocení sanace chlorovaných ethylenů in situ Výsledky pilotních testů

Využití metagenomiky při hodnocení sanace chlorovaných ethylenů in situ Výsledky pilotních testů Využití metagenomiky při hodnocení sanace chlorovaných ethylenů in situ Výsledky pilotních testů Stavělová M.,* Macháčková J.*, Rídl J.,** Pačes J.** * Earth Tech CZ, s.r.o ** ÚMG AV ČR PROČ METAGENOMIKA?


Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right


Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Modifikace PCR, sekvenování Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Multiplex PCR Reakční směs obsahuje ne jeden, ale několik párů primerů rozpoznávajících různé cílové sekvence


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání



ODLIŠENÍ ODRŮD PŠENICE OBECNÉ TRITICUM AESTIVUM L. METODOU RAPD ODLIŠENÍ ODRŮD PŠENICE OBECNÉ TRITICUM AESTIVUM L. METODOU RAPD Distinguishing of Wheat Varieties (Tritium aestivum L.) by Method RAPD Zuzana Kohutová, Zuzana Kocourková, Hana Vlastníková, Petr Sedlák


Vícefunkční chemické a biochemické mikrosystémy Strana 1. Mikrofluidní bioaplikace

Vícefunkční chemické a biochemické mikrosystémy Strana 1. Mikrofluidní bioaplikace Vícefunkční chemické a biochemické mikrosystémy Strana 1 Mikrofluidní bioaplikace Vícefunkční chemické a biochemické mikrosystémy Strana 2 Mikrofluidní aplikace pro bioanalýzu Transport, dávkování, promíchávání


Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,


Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava


Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace


Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.:

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.: Yi TPMT Diagnostická souprava Návod k použití Výrobce: YBUX s.r.o. Haasova 27 Brno 616 00 Česká republika IČ 63487951 tel.: +420 541 423 710 e-mail: ybux@ybux.eu Název: Yi TPMT Popis: Diagnostická souprava


4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902


ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Fyzické mapování Fyzické kontigové mapy Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s konstrukcí


Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace


Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp.

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp. BIOLOGICKÉ LISTY 68 (3): 207-211, 2003 Způsoby detekce polymorfismu homologních DNA a jejich využití při studiu změn ve struktuře rodičovských genomů u modelových allotetraploidních druhů rodu Nicotiana


Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE


Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti ELEKTROMIGRAČNÍ METODY ELEKTROFORÉZA K čemu to je? kritérium čistoty preparátu stanovení molekulové hmotnosti makromolekul stanovení izoelektrického



CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION AFLP ANALÝZA *** Technika AFLP (Amplification Fragment Lenght Polymorphism - polymorfismus délky amplifikovaných fragmentů) je modifikací RFLP,



EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence


OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases


Struktura a funkce nukleových kyselin

Struktura a funkce nukleových kyselin Struktura a funkce nukleových kyselin ukleové kyseliny Deoxyribonukleová kyselina - DA - uchovává genetickou informaci Ribonukleová kyselina RA - genová exprese a biosyntéza proteinů Složení A stavební



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického


Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk


Klonování gen a genové inženýrství

Klonování gen a genové inženýrství Klonování gen a genové inženýrství Genové inženýrství užite né termíny Rekombinantní DNA = DNA, ve které se nachází geny nejmén ze dvou zdroj, asto ze dvou zných druh organism Biotechnologie = manipulace


2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou



MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Určování a ověřování paternity u koní. Bakalářská práce Brno 2006 Vedoucí bakalářské


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction






PO STOPÁCH BAKTERIÍ V/KOLEM NÁS PO STOPÁCH BAKTERIÍ V/KOLEM NÁS Jana Spáčilová, UK v Praze, PřF, Katedra buněčné biologie Svět bakterií je nesmírně druhově bohatý a máme ho blíž než před očima. Mikroskopickými metodami můžeme obdivovat


Ondřej Scheinost Nemocnice České Budějovice, a.s.

Ondřej Scheinost Nemocnice České Budějovice, a.s. Ondřej Scheinost Nemocnice České Budějovice, a.s. Nové technologie přelomové období principy technologií klinická použitelnost chips (arrays) sekvenační technologie Důležitost genetických informací i další


Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae).

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). Populační studie Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). American Journal of Botany 87(8): 1128


Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace praktických cvičení molekulárně-biologických předmětů o sekvenční úlohy PRACOVNÍ PROTOKOL PRO PŘEDMĚT GENETCKÁ DIVERZITA Vypracováno


GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu



ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN Fragmenty nukleových kyselin lze dle jejich velikosti rozdělit elektroforézou. Elektroforéza využívá rozdílné pohyblivosti jednotlivých fragmentů, danou právě



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


První testový úkol aminokyseliny a jejich vlastnosti

První testový úkol aminokyseliny a jejich vlastnosti První testový úkol aminokyseliny a jejich vlastnosti Vysvětlete co znamená pojem α-aminokyselina Jaký je rozdíl mezi D a L řadou aminokyselin Kolik je základních stavebních aminokyselin a z čeho jsou odvozeny



ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce


Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová

Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová Enterotoxiny Staphylococcus aureus Jana Kotschwarová Andrea Koťová Obsah Charakteristika Staphylococcus aureus Vlastnosti Faktory virulence Enterotoxiny Patogeneze Výskyt Metody stanovení Prevence výskytu



Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální



PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ 10 SEZNAM PŘÍLOH PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ PŘÍLOHA č. 2 MAPY Mapa 1 Lokalizace zájmového území (zdroj: Mapy.cz) Mapa 2 Místa odlovených nebo uhynulých kusů (zdroj:


Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů

Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů Registrační číslo: CZ.1.07/1.1.00/14.0016 Proces forenzní identifikace pomocí


Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry


Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený





5. Sekvenování, přečtení genetické informace, éra genomiky.

5. Sekvenování, přečtení genetické informace, éra genomiky. 5. Sekvenování, přečtení genetické informace, éra genomiky. Minulá přednáška nastínila zrod molekulární biologie a představila některé možnosti, jak pracovat s DNA - jak ji analyzovat na základě velikosti


Imunochemické metody. na principu vazby antigenu a protilátky

Imunochemické metody. na principu vazby antigenu a protilátky Imunochemické metody na principu vazby antigenu a protilátky ANTIGEN (Ag) specifická látka (struktura) vyvolávající imunitní reakci a schopná vazby na protilátku PROTILÁTKA (Ab antibody) molekula bílkoviny


cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)





Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký

Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký Kapitola 3 Biomolecular Design and Biotechnology Překlad: Jaroslav Krucký Problémy chemie a biologie mohou být velmi nápomocné, jestliže se naše schopnost vidět to, co děláme, a dělat věci na atomární


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Izolace nukleových kyselin

Izolace nukleových kyselin Izolace nukleových kyselin Požadavky na izolaci nukleových kyselin V nativním stavu z přirozeného materiálu v dostatečném množství požadované čistotě. Nukleové kyseliny je třeba zbavit všech látek, které





Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


Vizualizace DNA ETHIDIUM BROMID. fluorescenční barva interkalační činidlo. do gelu do pufru barvení po elfu SYBR GREEN

Vizualizace DNA ETHIDIUM BROMID. fluorescenční barva interkalační činidlo. do gelu do pufru barvení po elfu SYBR GREEN ETHIDIUM BROMID fluorescenční barva interkalační činidlo do gelu do pufru barvení po elfu Vizualizace DNA SYBR GREEN Barvení proteinů Coommassie Brilliant Blue Coomassie Blue x barvení stříbrem Porovnání
