Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316"

Transkript

1 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/

2 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace

3 Genetické markery Genetické markery jsou definovány jako morfologické, anatomické, fyziologické nebo biochemicko-genetické vlastnosti organismů těsně korelující s jinými, mnohdy složitějšími, vlastnostmi.

4 Rozdělení genetických markerů morfologicko-anatomické biochemicko-fyziologické markery zásobní a stavební proteiny biochemicko-genetické izoenzymy nukleové kyseliny

5 Základní rozdělení DNA markerů délkového polymorfismu fragmentů DNA vzniklých restrikčním štěpením (RFLP) detekce variability na základě amplifikace fragmentů DNA v in vitro podmínkách (PCR) různých typů propojení metod RFLP a PCR (AFLP) polymorfismu repetetivních sekvencí mini- a mikrosatelitů stanovení sekvencí neboli pořadí nukleotidových párů v molekule DNA

6 Oblasti využití genetických markerů humánní medicína veterinární medicína kriminalistika šlechtění a plemenářství evoluční biologie paleontologie detekce letálně působících genů detekce napadení člověka například viry určení paternity detekce napadení zvířat například viry detekce letálně působících genů jednoznačná identifikace osob selekce s využitím markerů identifikace odrůdové pravosti a čistoty určení paternity fytopatologie historie

7 Selekce s využitím markerů Selekce s využitím markerů neboli MAS (Marker Assisted Selection) je aktuální trend ve šlechtění rostlin i zvířat. MAS je založeno na tom, že šlechtitel selektuje potomstvo na základě genetické analýzy s využitím různých typů markerů. Tímto způsobem eliminuje chybu selekce u znaků, které jsou modifikovány vnějším prostředím. Použití metody MAS výrazně urychluje a zefektivňuje šlechtění. Řada genetických markerů vykazuje kodominanci a umožňují tak odlišit homozygoty od heterozygotů. U kvantitativních znaků jsou pomocí MAS identifikovány takzvané kandidátní geny, které vykazují majoritní efekt na úroveň kvantitativního znaku. DNA markers can be used to determine whether a seedling carries an allele of interest. Here, the marker for the red-flesh allele is detected as an additional DNA band on an agarose gel. Breeders use information like this to decide which seedlings to grow and which to discard.

8 Biochemicko-genetické markery - detekce variability organismů přímo na úrovni jejich genetické informace. - starší typy markerů (proteiny, izoenzymy) detekovaly variabilitu produktů transkripce a translace. - současnost: detekce variabilitu nositelů genetické informace DNA a RNA. - zpravidla je variabilita detekována a vyhodnocována na základě elektroforetické separace různě velkých molekul obvykle na gelovém nosiči.

9 Markery založené na polymorfismu DNA Základní vlastnosti DNA markerů: jsou aplikovatelné u všech organismů, kde je zvládnutá technika izolace DNA nejsou závislé na podmínkách prostředí jejich počet je téměř neomezený často lze DNA markery lze použít na minimálním množství DNA = nedestruktivní metody (části listů, semena) pomocí DNA markerů lze charakterizovat i velmi raná ontogenetická stádia organismů

10 Proteinové markery Jsou známy vztahy mezi přítomností určité bílkoviny, lokalizací jejího genu a dalšími vlastnostmi rostliny. Pomocí těchto markerů je možné predikovat například kvalitu složení obilky, odolnosti k některým chorobám nebo stanovit odrůdovou pravost vypracovány certifikované metodiky U skotu je obdobným způsobem provedeno hodnocení proteinů mléka. Příklad využití proteinových markerů při studiu linií pýru (Agropyron elongatum) (potenciální zdroj genů tolerance pšenice vůči salinitě a suchu). Přítomnost specifických bandů u linií s vlastnostmi, které by mohly ovlivňovat vlastnosti těsta.

11 Isozymy = allozymy U většiny enzymů existují takzvané izoformy neboli izoenzymy. Izoenzymy katalyzují stejnou biochemickou reakci, t.j. reagují s jedním substrátem a vytváří shodný produkt. Izoformy jednoho enzymu se vzájemně odlišují například velikostí molekuly. Levné, rychlé, dostupné? Omezená hodnota informací Exprese závislá na prostředí Jen čerstvý materiál

12 Isozymy = allozymy

13 Isozymy = allozymy

14 RFLP RFLP - Restriction Fragment Lenght Polymorphism Polymorfismus v délce restrikčních fragmentů gdna naštěpíme restriktázou fragmenty rozdělíme elektroforeticky z gelu je přesajeme na membránu membránu hybridizujeme se sondou navázanou sondu detekujeme U malých genomů nebo malých fragmentů DNA s malým počtem vznikajících fragmentů metoda využívá pouhé elektroforetické separace různě dlouhých fragmentů U větších genomů technika využívá DNA-DNA hybridizace na principu Southern blottingu.

15 Co jsou to restrikční fragmenty? Restrikční fragmenty jsou úseky molekul DNA, které vznikají enzymatickou aktivitou restrikčních endonukleáz, které rozpoznávají specifické sekvence, kde přestřihnou molekulu DNA.

16 Postup RFLP Rozpoznávací místo restriktázy EcoRI - 6bp dlouhou sekvence (GAATTC) ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC Sonda -Ze všech naštípaných fragmentů vybírám pouze určitou část DNA, kterou studujeme (gen)

17 Postup RFLP Rozpoznávací místo restriktázy EcoRI - 6bp dlouhou sekvence (GAATTC) ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC

18 Postup RFLP Standartní (popř. dominantní) alela po naštěpení ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC ATCGTCCAG AATTCATGCCCTTCGCCCTTCCGTCCAG AATTCGCCCTTC

19 Postup RFLP Standartní (popř. dominantní) alela po naštěpení ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC ATCGTCCAG AATTCATGCCCTTCGCCCTTCCGTCCAG AATTCGCCCTTC Sonda

20 Postup RFLP Mutovaná (popř. recesivní) alela ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGACTTCGCCCTTC ztráta restrikčního místa (nezabrání vazbě sondy)

21 Postup RFLP Mutovaná (popř. recesivní) alela po naštěpení ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGACTTCGCCCTTC ATCGTCCAG AATTCATGCCCTTCGCCCTTCCGTCCAGACTTCGCCCTTC ztráta restrikčního místa (nezabrání vazbě sondy)

22 Postup RFLP Standartní alela Mutovaná alela ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC Štěpení a elfo AATTCATGCCCTTCGCCCTTCCGTCCAG AATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC AATTCGCCCTTC ATCGTCCAG ATCGTCCAG Po provedení elektroforézy, přesátí a hybridizace (Southern blotting) AATTCATGCCCTTCGCCCTTCCGTCCAG AATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC AATTCGCCCTTC ATCGTCCAG ATCGTCCAG

23 RFLP Sondou se rozumí úsek jednořetězcové DNA, který má sekvenci jako detekovaný gen. Sonda je obvykle označena radioizotopem fosforu, který ji umožňuje detekovat. classes.midlandstech.edu

24 Genetická interpretace RFLP markerů RFLP markery představují kodominantní typ markerů. Umožňují vzájemně odlišit dominantní homozygoty, heterozygoty a recesivní homozygoty. Uplatňují se například: 1. Pro vyhledávání v genomových knihovnách 2. Pro detekce konkrétních genů 3. Pro detekce bodových mutací 4. Pro tvorbu RFLP map,.

25 Segregace RFLP markeru Letální recesivní alela vznikla mutací a liší se od dominantní alely ztrátou restrikčního místa.

26 Případ Colin Pitchfork (1983 a 1986) Dvě slečny znásilněny a zavražděny v hrabství Leicestershire v Anglii Mentálně zaostalý mladík Richard Buckland, který nahlásil nález druhého těla, se přiznal k zavraždění této dívky Na základě RFLP vyloučen místních mužů bylo požádáno o vzorek krve nebo bukální stěr Pekař exhibicionista Colin Pitchfork za sebe k odběru poslal (za 200 liber) kamaráda Iana Kellyho, který se tím pochlubil v hospodě První omilostnění a první obvinění pomocí DNA důkazů.

27 Nevýhody RFLP Požadavek velkého množství intaktní DNA (50 ng odpovídá ~ buněk) Metoda málo robustní (interpretační potíže)

28 Replikace in vivo

29 Amplifikace fragmentů DNA v in vitro podmínkách Tato metoda detekce genů je označována jako polymerázová řetězová reakce PCR (Polymerase Chain Reaction). Je založena na zmnožení hledaného úseku DNA. Který je ohraničen známými sekvencemi takzvanými primery. Metoda je tvořena opakováním těchto kroků: denaturace analyzované templátové DNA nasedání dvojice primerů annealing prodlužováním fragmentů DNA. Zmnožení fragmentu DNA je prováděno v termocykleru. tnrtb.wordpress.com

30

31 objev DNA polymerázy a první pokusy s umělou syntézou většího množství DNA (amplifikace DNA) PCR replikace in vitro PCR Polymerase Chain Reaction Polymerázová řetězová reakce 1983 Karry Mullis pracoval na projektu geneticky podmíněných chorob člověka v kalifornské firmě Cetus Corporation. Hledal novou metodu analýzy mutací DNA. Modifikoval Sangerovu metodu sekvenace DNA přidal zpětný primer pro syntézu krátkých úseků DNA. Uvědomil si, že opakováním amplifikace DNA pomocí DNA polymerázy může vést k řetězovému množení specifického segmentu genomu - PCR. Pomocí PCR můžete z jedné molekuly DNA vytvořit 100 biliónů kopií za jedno odpoledne. Potřebujete jenom zkumavku, několik jednoduchých reagencií a zdroj tepla 1984 rozpracování metody s matematikem Fredem Faloonou, patentování (Mullis et al. 1986; Mullis a Faloona 1987) 1993 Nobelova cena za chemii V devadesátých letech Cetus Corp. prodává patenty PCR a Taq firmě Hoffman La Roche za 330 miliónů $

32 Polymerázová řetězová reakce denaturace annealing prodlužování cit.vfu.cz

33 Zvyšování počtu kopií fragmentu DNA při PCR

34 PCR replikace in vitro DNA

35 PCR Polymerase Chain Reaction další rozvoj metody s použitím termostabilní polymerázy z termofilní bakterie Thermus aquaticus = zkratka Taq Pol" nebo "Taq")

36 Jak lze zjistit výsledek amplifikace Výsledek amplifikace se stanovuje gelovou elektroforézou. Elektroforeogram amplifikovaných fragmentů DNA, které umožní identifikovat odrůdy brambor.

37 PCR hlavní faktory ovlivňující průběh reakce Koncentrace dntps - stock solution 100mM - ředění na 20 a 200 mol (pro každý dntp) vyšší specifičnost a nižší frekvence zařazení nesprávného nukleotidu Koncentrace MgCl2 - optimum je 1,5-2mM, - nad 6mM klesá aktivita Taq Polymerázy - nízká koncentrace nízké výtěžky PCR - příliš vysoké koncentrace rozmazané proužky na gelu nebo zmnožení nespecifických produktů Teplota annealingu nasednutí primerů - vyšší teplota = vyšší specifičnost ke komplementární sekvenci = primer nasedá na komplementární místo s vyšší přesností = přesnější výsledek PCR - nižší teplota vhodné pro studie, kdy se používají primery odvozené od příbuzných druhů; nebezpečí vzniku nespecifických produktů (jiné úseky DNA, než které jsme chtěli získat) - zvýšení specifičnosti např. tzv. Touch down PCR v prvních cyklech vyšší teplota = specifické produkty, ale v s nižším výtěžkem = v dalších cyklech vyšší teplota annealingu = zvýší se výtěžek PCR - Koncentrace templátové DNA příliš vysoká konc. DNA může bránit PCR, zároveň se naředí inhibitory PCR ve směsi (např. chemikálie použité při izolaci)

38 PCR hlavní faktory ovlivňující průběh reakce Volba polymerázy odlišné výsledky PCR od Taq P. od různých firem - např. pro sekvenace proofreading polymerase nižší procento vložení chybného nukleotidu Aditiva - pro zvýšení efektivity PCR, stabilizaci enzymu - v pufru dodávaném s polymerázou: - detergenty (TRITON X-100, TWEEN, NP-40) - zpravidla 2 ze tří uvedených - dimetylsulfoxin nebo glycerol lepší průběh denaturace a chlazení - BSA (bovinní sérový albumin) nebo želatina - Finální koncentrace aditiv se pohybuje mezi 0,1 a 1,0% celkové reakční směsi, avšak konkrétní koncentrace je většinou nutno empiricky vyzkoušet. Kontaminace nebezpečí zejména u málo koncentrovaných nebo problematických templátů - sterilní špičky, vysoce čistá voda pro PCR, pufry, PCR zkumavky, rukavice (nikdy nesterilizovat dntps, primery, polymerázu ) - příprava PCR směsí ve flow boxu v oddělené místnosti od prostor, kde se pracuje s produkty - při přecházení z místností měnit rukavice..

39 Optimalizace reakčních podmínek PCR - Změny v protokolu vedoucí k odstranění nežádoucích nespecificit a ke zvýšení množství PCR produktu. - počet cyklů - annealingová teplota - koncentrace Mg 2+, polymerázy, templátové DNA - aditiv (např. DMSO, formamid) Marker 1 - produkt 240bp Příklad optimalizace PCR Podmínky podle literatury B PCR po optimalizaci Ta = 62 C, 30 cyklů 20uM primery Ta = 67 C, 25 cyklů 10uM primery B Marker 2 - produkt 460bp Ta = 66 C, 30 cyklů 20uM primery Ta = 66 C, 25 cyklů 10uM primery

40 RAPD - Random Amplified Polymorphic DNA Variabilita délek náhodně amplifikované DNA

41 RAPD Random Amplified Polymorphic DNA Variabilita délek náhodně amplifikované DNA PCR s jedním primerem Primer dosedne na různých místech a v různých směrech amplifikuje DNA fragmenty Identifikace např. kmenů bakterií popř. ověřování homogenity linií

42 RAPD Výhody - Velmi levné - Rychlé a snadné = není třeba znát sekvenci primeru, stačí velmi málo DNA, poměrně dost fragmentů Nevýhody převažují: - Omezena hodnota informace (dominantní marker) - Nereproducibilní DNES TREND NEUŽÍVAT RAPD MARKERY

43 AFLP - Amplified Fragment Length Polymorphism Polymorfismus délky amplifikovaných fragmentů

44 AFLP Princip metoda založená na restrikci DNA dvěma enzymy selektivní namnožení jen některých proužků vizualizace proužků na gelu Postup relativně složitý (4 fáze) 1. RESTRIKCE specifické rozštěpení DNA restrikčními endonukleázami MseI - rozpoznává 4bp dlouhou sekvenci (TTAA) EcoRI - rozpoznává 6bp dlouhou sekvenci (GAATTC) (Variabilita je dána mutací v restrikčním místě insercí - delecí mezi restrikčními místy) získáme množství fragmentů s lepivými konci = sticky ends

45 AFLP 2. ligace pomocí T4 ligázy k fragmentům přidány adaptory = oligonukleotid, jeho sekvenci známe známe sekvence konců všech fragmentů můžeme je amplifikovat PCR

46 AFLP 3. preselektivní amplifikace klasická PCR s primery komplementárními k sekvenci adaptorů, navíc 1 nukleotid směrem dovnitř amplifikovaného úseku = selekce jen ca. 1/4 fragmentů (fragmenty komplementární k primerům + fragmenty EcoRI- MseI)

47 AFLP 3. preselektivní amplifikace restrikce + ligace

48 AFLP 3. preselektivní amplifikace restrikce + ligace preamplifikace

49 AFLP 4. selektivní amplifikace -fragmentů je stále mnoho pro objektivní vyhodnocení -další redukce jejich počtu použitím primerů se 3mi selektivní nukelotidy (s přesahem "dovnitř" amplifikovaných fragmentů) - tento krok se provádí opakovaně s různými primerovými kombinacemi (primery se liší zařazenými nukleotidy na koncích -redukce na 1/256 všech fragmentů (1/16 x 1/16)

50 AFLP 5. vyhodnocení -primery jsou fluorescenčně značeny sekvenátor - Primery bez značení PAGE elektroforéza

51 AFLP realizace AFLP - realizace 1: Restrikce - příprava restrikčního mixu (EcoI, MseI, buffer, voda) - přidat k DNA - inkubovat 2 hod při 37 C 2: Ligace - příprava ligačního mixu (LIGAZA, BUFF, ADAPTORY, VODA) - přidat k roztoku z předchozího kroku - inkubovat 2,5 hod při 37 C 3: Preamplifikace - klasická PCR - ligační roztok jako matrice Kroky 1-3 se provedou pouze 1x, dál pracujeme s preamplifikátem 4: Amplifikace - klasická PCR - matrice = preamplifikát - měníme kombinace primerů = detekujeme jiné fragmenty

52 MIKROSATELITY

53 MIKROSATELITY krátké tandemové repetice, STR (short tandem repeats) repetice jednoduchých sekvencí, SSR (simple sequence repeats) krátké, tandemově se opakující jednoduché sekvenční motivy zpravidla o délce 2-6bp prokaryota a eukaryota kódující i nekódující oblasti Vysoká mutační rychlost (u savců 10-3 až 10-4/lokus/generaci) hlavní zdroj vysoké proměnlivosti - sklouznutí nukleotidového řetězce během replikace (replication slippage). GTTCTGTCATATATATATATAT CGTACTT GTTCTGTCATATATATATATATATATATCGTACTT Alely se liší svou délkou Snadná separace pomocí elektroforézy

54 MIKROSATELITY Dokonalé = perfect repeats (jeden nepřerušený motiv): Jednonukleotidové: AAAAAAAAAAAAAAAAAA Dinukleotidové: CACACACACACACACACACA = (CA)n Trinukleotidové: CGTCGTCGTCGTCGTCGTCGT = (CGT)n Tetranukleotidové: CAGACAGACAGACAGACAGA =(CAGA)n Pentanukleotidové: AAATTAAATTAAATTAAATT =(AAATT)n Hexanukleotidové: CTTTAACTTTAACTTTAACTTTAA =(CTTTAA)n Pr: (AG)32 ; (TAT)25 ; (CAA)7 Cicer Nedokonalé = imperfect repeats (motiv je přerusen jedním nebo několika bazemi): (TC)6A(TC)13 ; (AG)12GG(AG)3 Cicer Složené = compound: (směs dokonalých nebo nedokonalých vzorů několika motivů) (AT)6(GT)42AT(GT)5(GT)10 (AT)14(AG)8 (GAA)21 (TA)23 Nejčastější motivy: mono a dinukleotidové; 3, 4 a 5ti méně

55 MIKROSATELITY GTTCTGTCATATATATATATCGTACTT celková DNA PCR specifický pár primerů

56 ELFO separace

57 MIKROSATELITY Výhody - vysoká variabilita - velká početnost a rozmístění po celém genomu - jednoduchost analýzy (mikrosatelity lze poměrně snadno studovat pomocí PCR) - robustní a reproducibilní markery - KODOMINANTNÍ MARKER, IDENTIFIKACE ALEL Nevýhody - Musíme znát sekvence primerů - Pokud neznáme, tak testovat SSR z příbuzných druhů - Optimalicace PCR - Popřípadě vyvíjet nové: EST-SSR

58 MIKROSATELITY - využití jaderné mikrosatelity (SSRs) nejlepší marker pro zhodnocení variability na populační úrovni jsou potřeba druhově specifické primery, tj. metoda použitelná pouze v případě, že pro studovaný druh byly primery již publikovány chloroplastové mikrosatelity (cpdna SSRs) vhodné pro hodnocení variability na úrovni příbuzných druhů, někdy i na vnitrodruhové úrovni dostupné jsou univerzální primery Obecně: Forenzní genetika: kriminalistika, identifikace jedinců, příbuzenské vztahy analýza rodičovství (parentage analysis) určení rodičů semen (semenáčků) v populacích identifikace klonů populačně-genetické studie genový tok, migrace historie populací

59 MIKROSATELITY - využití

60 MIKROSATELITY - využití

61 SEKVENOVÁNÍ DNA

62 SEKVENOVÁNÍ DNA - princip zjištění pořadí nukleotidů v řetězci DNA ATATATAGGCAAGGAATCTCTATTATTAAATCATT Zjištění rozdílů mezi jedincemi, geny Základní informace pro konstrukci primerů využití informace ke zjištění průběhu a rychlosti evoluce zjištění podobnosti a příbuznosti taxonů

63 SEKVENOVÁNÍ DNA - princip 1) Předstupeň: PCR s použitím dvojice primerů namnožení studovaného úseku DNA 2) sekvenační reakce použití pouze jednoho primeru kromě dntp jsou ve směsi přítomny i ddntp produkce fragmentů lišících se přesně o 1 bázi Elektroforetická separace fragmentů na gelu automatický sekvenátor

64 SEKVENOVÁNÍ DNA Aplikace - Aplikační možnosti: 1. evoluce genů (vznik alel, lokusů,redukce polymorfismu v důsledku selekce atd.) 2. vnitrodruhové (populační) studie (geografická proměnlivost, tok genů, hybridizace, fylogeografie (př. mitochondriální geny, Y chromozom) 3. mezidruhové studie (studium speciace, biogeografie) - volba správné sekvence 4. Detekce SNP = identifikace jedinců, taxonů, populací sekvenace pomáhá nalézt drobné populačně- i taxonově-specifické rozdíly Výhoda - Možnost srovnání sekvenčních dat o vašem organismu s údaji v internetových databázích Př:

65 SEKVENOVÁNÍ DNA 1977: dvě metody zjištění pořadí nukleotidů v DNA Maxamova-Gilbertova (chemická) metoda je založena na bázově-specifické chemické modifikaci a následném štěpení fragmentů DNA - dnes se neužívá Krátká sekvencedna (ds nebo ss) * na 5' konci radioaktivně označena 32 P. * vzorek se rozdělí na pět částí a) Přídavek chemikálí modifikují vždy jeden nebo dva typy nukleotidů: 1. dimethylsulfát: G 2. kys. mravenčí: A+G 3. hydrazin: C + T 4. 1,5M NaCl: C b) Přídavkem piperidinu: štěpení DNA v místě modifikace c) Elfo separace Výsledek ELFO: sekvence DNA: 5 -GTCTGCA-3 (čte se zespodu) - narazila na technické problémy s vývojem standartních molekulárních kitů - technicky příliš komplexní a příliš mnoho toxických látek

66 SEKVENOVÁNÍ DNA Sangerova metoda terminace řetězce Sangerova metoda založena na terminaci replikace nového řetězce podle matrice zkoumané sekvence dideoxynukleozidtrifosfátem (ddntp) na 3 -uhlíku deoxyribózy chybí OH-skupina a proto k nim DNA polymeráza nemůže navázat další nukleotid pokud během replikace dojde k náhodné inkorporaci dideoxynukelotidu (dda, ddc, ddg, ddt), replikace se zde zastaví

67 SEKVENOVÁNÍ DNA Sangerova metoda založená na terminace řetězce Sangerova (enzymatická) metoda Vzorek DNA se rozdělí do čtyř zkumavek a do každé se přidá specifický primer, směs všech čtyř standartních nukleotidů a DNA polymeráza Do každého ze vzorků je přidán vždy jen jeden značený dideoxynukleotid - v určitém poměru s deoxinukleotidy Př: dda + da, dg, dc, dt ddt + da, dg, dc, dt. Po ukončení amplifikace separace pomocí denaturující PAGE v dlouhém (sekvenačním) gelu + detekce autoradiograficky výsledné pořadí nukleotidů se odečte

68 SEKVENOVÁNÍ DNA - zefektivnění Sangerovy metody vývoj kapilárních sekvenátorů Syntéza DNA je v principu totožná s asymetrickou PCR (tj. s jedním primerem) v normálním termocykleru, s extenzí řetězce Taq polymerázou. k detekci produktů jsou užívány fluorescenčně značené ddntp = každý dideoxynukleotid má jinou značku tzv. Dye-terminator sequencing Př. ABI PRISM Big Dye Terminator v 3.1. Ready Reaction Cycle Sequencing Kit Polymerizační reakce probíhá v jednom vzorku během PCR dochází k produkci fragmentů lišících se o jednu bázi detekce produktů probíhá během elektroforetické migrace v kapiláře pomocí laserového detektoru sekvence je zaznamenána přímo do paměti počítače bp/run

69 SEKVENOVÁNÍ DNA - zefektivnění Sangerovy metody vývoj kapilárních sekvenátorů Vzorek s fluorescenčně značenými fragmenty po PCR

70 SEKVENOVÁNÍ DNA

71 SEKVENOVÁNÍ DNA - zefektivnění metody vývoj kapilárních sekvenátorů Kapiláry - vnitřní průměr 50μm - naplněny gelem s nízkou viskozitou, který nahradil polyakrylamid (dříve kapiláry nešlo opakovaně používat) - kratší časy analýz - plně automatizované systémy

72

73 Automatické sekvenátory

74 Nature Reviews Microbiology 7,

75 NGS = Next Generation Sequencing Celogenomové sekvenování - paralelně probíhající sekvenační reakce - produkují tisíce miliony sekvencí v jednom běhu - čtení kratších úseků (30-300bp) - Obecný postup 1. Izolace DNA 2. Příprava DNA knihovny PCR, klonování 3. Vlastní sekvenace 4. Vyhodnocení surových dat 5. Sestavení konsenzuální sekvence

76

77 Nature Reviews Microbiology 7,

78 454 - Pyrosekvenace - první nová sekvenační metoda (1998) - princip: detekce aktivity DNA-polymerázy během syntézy DNA - Výhody: - délka čtených úseků 700bp - rychlost sekv. cyklus 10 hodin - sekvenace PCR produktů - Nevýhody - překryvy homopolymerních oblastí - cena

79 454 sekvenování úseky 300 bp - čteno 400 tisíc fragmentů najednou Fragmentace DNA bp Ligace adaptorů - B adaptor má biotinovou značku pro přichycení na streptavidinem obalenou magnetickou kuličku Pico-titer plate (sekvenační čip - obsahuje 1,6 mil jamek širokých 44μm - průměr DNA kuličky je 26 μm -přídavek menších kuliček dvou typů jeden obsahuje chemikálie pro pyrosekvenaci, druhý typ fixuje kuličky s DNA Emulzní PCR - DNA kuličky do roztoku oleje a vody - Protřepání = vznik mikroreaktoru okolo kuličky Sekvenační reakce - Na destičku se cyklicky nanáší roztok polymerázy a vždy jednoho nukleotidu viz. pyrosekvenace Záznam a zpracování dat

80 Pyrosekvenování 1. začlenění nukleotidu (konkrétní typ, ne směs) 2. uvolnění pyrofosfátu (PPi) 3. Vznik ATP Enzym ATP sulfuryláza katalyzuje vznik ATP reakcí PPi s adenosinfosfosulfátem (APS) 4. Emise záření: enzym luciferáza spotřebuje vzniklý ATP na oxidaci luciferinu záblesk 5. Detekce záblesku 6. Enzym apyráza odstraní nespotřebované nukleotidy a ATP 7. Promytí systému 8. Změna typu nukleotidu ve směsi krok č 1.

81 pico-titer plate from Roche's FLX

82 Roche 454 sequencing

83 Illumina Genome Analyzer -metoda sekvenace syntézou (SBS-sequencing by synthesis) - r. 2006; úseky 35-50bp - 1) Příprava knihovny - fragmentace - na konce dva adaptéry - ELFO: vyříznou se fragmenty bp - přečištění - 2) Amplifikace fragmentů (bridge amplification) - na sklíčku jsou oligonukleotidy komplementární k oběma adaptorům - jednovláknové fragmenty se navážou na sklíčko vytvoří můstek - dosyntetizování komplementárního vlákna - denaturace dva identické fragmenty navázané na sklíčko blízko sebe - opakování = vznik tisíců kopií těsně vedle sebe v tzv. clusterech

84 Illumina Genome Analyzer - 3) sekvenační reakce - v každém cyklu NARÁZ všechny nukleotidy - mají fluorescenční značku a modifikovaný 3 konec (brání zařazení více nukleotidů v jednom kroku) - zařazení nukleotidu provázené emisí světla, charakteristického pro daný nukleotid - detekce - odstranění fluoresc. značky a odblokování 3 konce - opakování postupu - x cyklů - zpracování dat

85

86 Illumina sequencing

87

88 SOLiD sequencing Sekvenace pomocí LIGACE krátkých oligo sond, které jsou fluorescenčně značeny + cena + vysoká přesnost metody (99,95%) + malé množství vzorku - čtené úseky: 100 bp - náročnost zpracování dat a rychlost analýzy (týden)

89 SOLiD sequencing 1. Příprava DNA knihovny Štěpení templátové DNA na kratší fragmenty Připojení adaptorů P1 a P2 empcr amplifikace fragmentů na magn. kuličkách modifikace 5 konce připojení na sekvenační destičku 2. Vlastní sekvenace

90 SOLiD sequencing - Sekvenační reakce Navázání univ. primeru, ligace sondy Připojení univ. primeru k adaptoru P1 Přidání oktamerních sond s fluoro. značkami 4 barvy, 16 kombinací koncových nukleotidů na 1. a 2. pozici Pokud je sonda na 1. a 2. pozici komplementární k 1. a 2. pozici templátu prodloužení řetězce DNA ligázou 2. Emise a detekce fluoresc. signálu 3. Odštěpení fluoresc. značky (štěpení sondy mezi 5. a 6. nukeotidem) 4. Opakování kroků x-krát po konec sekvence 5. Reset primeru odštěpení nově nasynt. Vlákna 6. Napojení nového univ. primeru k adaptoru P1 - primer je o jeden nukleotid kratší 7. Opakování kroku s primery (n-2) až (n-6) 8. Vyhodnocení dat dešifrování barevného kódu

91 8. Vyhodnocení dat dešifrování barevného kódu - každá báze je určena na základě dvou nezávislých sekvenačních cyklů

92

93 SOLiD sequencing

94

95

96

97

98

99

100 Odvozené metody využívající NGS sekvenace při hledání SNP polymorfismů

101 RRL sequencing Trends in Genetics April 2013, Vol. 29, No. 4

102 RAD-Taq sequencing - restrikce: DNA je naštípána restriktázami, - ligace: na vzniklé fragmenty je navázán adaptor, - vysokokapacitní NGS sekvenování (tagged fragment amplification) - analýza dat. - Hledání SNP a) anotace k referenčnímu genomu b) pooling vzorků a hledání SNP lokusů (putative RADtaq locus) - Kombinace snížení komplexnosti genomu restrikčním štěpením s NGS sekvenováním.

103 That s all folks!

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION

CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION AFLP ANALÝZA *** Technika AFLP (Amplification Fragment Lenght Polymorphism - polymorfismus délky amplifikovaných fragmentů) je modifikací RFLP,

Více

Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Metodické listy OPVK. Molekulární metody hodnocení genotypů Marker Assisted Breeding 14.

Metodické listy OPVK. Molekulární metody hodnocení genotypů Marker Assisted Breeding 14. Metodické listy OPVK Molekulární metody hodnocení genotypů Marker Assisted Breeding 14. Molekulární metody hodnocení genotypů 14.1. Izolace DNA V aplikacích zaměřených na analýzu rostlinného genomu je

Více

Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený

Více

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION

CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION DIGITÁLNÍ OBRAZOVÁ ANALÝZA ELEKTROFORETICKÝCH GELŮ *** Vyhodnocování získaných elektroforeogramů: Pro vyhodnocování

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery ve šlechtění rostlin Petr Smýkal Katedra botaniky, PřF UPOL 1. Mikrosatelitní markery

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

Molekulární základ dědičnosti

Molekulární základ dědičnosti Molekulární základ dědičnosti Dědičná informace je zakódována v deoxyribonukleové kyselině, která je uložena v jádře buňky v chromozómech. Zlomovým objevem pro další rozvoj molekulární genetiky bylo odhalení

Více

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Kamila Zdeňková Transgenní rostliny, tj. takové rostliny, do jejichž dědičného základu byly metodami genového inženýrství

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských

Více

Co se o sobě dovídáme z naší genetické informace

Co se o sobě dovídáme z naší genetické informace Genomika a bioinformatika Co se o sobě dovídáme z naší genetické informace Jan Pačes, Mgr, Ph.D Ústav molekulární genetiky AVČR, CZECH FOBIA (Free and Open Bioinformatics Association) hpaces@img.cas.cz

Více

Filozofie validace. Je validace potřebná? Mezinárodní doporučení pro provádění validací ve forenzně genetických laboratořích

Filozofie validace. Je validace potřebná? Mezinárodní doporučení pro provádění validací ve forenzně genetických laboratořích INVESTICE DO ROZVOJE VZDĚLÁVÁNÍ Vzdělávání v oblasti forenzní genetiky reg. č. CZ.1.07/2.3.00/09.0080 Mezinárodní doporučení pro provádění validací ve forenzně genetických laboratořích INVESTICE DO ROZVOJE

Více

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 10 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 26.06.2014 Ročník: 6AF, 6BF Anotace DUMu: Procesy následující bezprostředně po transkripci.

Více

Bioinformatika. hledání významu biologických dat. Marian Novotný. Friday, April 24, 15

Bioinformatika. hledání významu biologických dat. Marian Novotný. Friday, April 24, 15 Bioinformatika hledání významu biologických dat Marian Novotný Bioinformatika sběr biologických dat archivace biologických dat organizace biologických dat interpretace biologických dat 2 Biologové sbírají

Více

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK Richard Prùša Richard Prùša Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK . Základy analytických metod v klinické molekulární biologii Richard Prùša Praha 1997 Základy analytických metod

Více

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC 1 Výrobce Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC Tento návod k použití si důkladně přečtěte před použitím tohoto produktu. Uschovejte si tento návod k použití,

Více

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody Návod k použití souprav Wipe test Kontaminační kontrola Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody REF 7091 40 reakcí 1. Popis výrobku V posledních letech se

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů

Více

Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR Mikrobiologický ústav AV ČR Příloha 6 Havarijní plán 1/5 Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR a) Adresa pracoviště Mikrobiologický ústav AV ČR

Více

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura

Více

Výuka genetiky na Přírodovědecké fakultě MU

Výuka genetiky na Přírodovědecké fakultě MU MASARYKOVA UNIVERZITA Přírodovědecká fakulta Výuka genetiky na Přírodovědecké fakultě MU Jiří Doškař Ústav experimentální biologie, Oddělení genetiky a molekulární biologie 1 V akademickém roce 1964/1965

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci

Více

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková Metody detekce a identifikace MO se zaměřením na PCR a její variace Kamila Zdeňková Metody detekce a identifikace MO rozdělení metod pro mikrobiologické zkoušení potravin přehled rychlých metod detekce

Více

Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku. Richard J W Currie

Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku. Richard J W Currie Molekulární diagnostika infekční bronchitidy v České republice a na Slovensku Richard J W Currie Virus infekční bronchitidy RNA (nukleová kyselina) uvnitř Proteiny (spike proteiny S1 a S2) na vnější straně

Více

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem

Více

Výukový materiál zpracovaný v rámci operačního programu Vzdělávání pro konkurenceschopnost

Výukový materiál zpracovaný v rámci operačního programu Vzdělávání pro konkurenceschopnost Výukový materiál zpracovaný v rámci operačního programu Vzdělávání pro konkurenceschopnost Registrační číslo: CZ.1.07/1. 5.00/34.0084 Šablona: III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Sada:

Více

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob PGD preimplantační genetická diagnostika zahrnuje soubor technik, které se používají pro zjištění

Více

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dgmp) Koncept párování bazí je striktně konzervativní Cytosine

Více

Písemná zpráva zadavatele

Písemná zpráva zadavatele Písemná zpráva zadavatele veřejné zakázky zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, ve znění účinném ke dni zahájení zadávacího řízení (dále jen ZVZ ). Veřejná zakázka Název: Ostatní

Více

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci

Více

Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi

Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Co je to vlastně ta fluorescence? Některé látky (fluorofory)

Více

Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12

Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12 Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12 Firma Abbott Laboratories nabízí na imunoanalytických systémech ARCHITECT test ke stanovení biologicky aktivní části vitaminu

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

PROTOKOL WESTERN BLOT

PROTOKOL WESTERN BLOT WESTERN BLOT 1. PŘÍPRAVA ELEKTROFORETICKÉ APARATURY Saponátem a vodou se důkladně umyjí skla, plastové vložky a hřebínek, poté se důkladně opláchnou deionizovanou/destilovanou vodou a etanolem a nechají

Více

Biochemie. ochrana životního prostředí analytická chemie chemická technologie Forma vzdělávání: Platnost: od 1. 9. 2009 do 31. 8.

Biochemie. ochrana životního prostředí analytická chemie chemická technologie Forma vzdělávání: Platnost: od 1. 9. 2009 do 31. 8. Studijní obor: Aplikovaná chemie Učební osnova předmětu Biochemie Zaměření: ochrana životního prostředí analytická chemie chemická technologie Forma vzdělávání: denní Celkový počet vyučovacích hodin za

Více

Diagnostické metody v lékařské mikrobiologii

Diagnostické metody v lékařské mikrobiologii Diagnostické metody v lékařské mikrobiologii Výuková prezentace z: Lékařské mikrobiologie Jan Smíšek ÚLM 3. LF UK 2009 Princip identifikace Soubor znaků s rozdílnou diskriminační hodnotou Základní problémy

Více

Biochemie Ch52 volitelný předmět pro 4. ročník

Biochemie Ch52 volitelný předmět pro 4. ročník Biochemie Ch52 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Chemie. Mezipředmětové přesahy a

Více

O původu života na Zemi Václav Pačes

O původu života na Zemi Václav Pačes O původu života na Zemi Václav Pačes Ústav molekulární genetiky Akademie věd ČR centrální dogma replikace transkripce DNA RNA protein reverzní transkripce translace informace funkce Exon 1 Intron (413

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

ANALYSIS OF GENOMIC MARKER CSN2 IN COW'S MILK ANALÝZA GENOMICKÉHO MARKERU CSN2 V MLÉCE SKOTU

ANALYSIS OF GENOMIC MARKER CSN2 IN COW'S MILK ANALÝZA GENOMICKÉHO MARKERU CSN2 V MLÉCE SKOTU ANALYSIS OF GENOMIC MARKER CSN2 IN COW'S MILK ANALÝZA GENOMICKÉHO MARKERU CSN2 V MLÉCE SKOTU Šrubařová P., Dvořák J. Ústav Morfologie, fyziologie a genetiky zvířat, Agronomická fakulta, Mendelova zemědělská

Více

FLUORESCENČNÍ MIKROSKOP

FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

SLEDOVÁNÍ VÝSKYTU GENOTOXICKÝCH LÁTEK V POVODÍ ŘEKY SVRATKY V SOUVISLOSTI S URANOVÝM PRŮMYSLEM

SLEDOVÁNÍ VÝSKYTU GENOTOXICKÝCH LÁTEK V POVODÍ ŘEKY SVRATKY V SOUVISLOSTI S URANOVÝM PRŮMYSLEM SLEDOVÁNÍ VÝSKYTU GENOTOXICKÝCH LÁTEK V POVODÍ ŘEKY SVRATKY V SOUVISLOSTI S URANOVÝM PRŮMYSLEM Jana Badurová, Hana Hudcová, Radoslava Funková, Helena Mojžíšková, Jana Svobodová Toxikologická rizika spojená

Více

Vytvořen. ení genetické databanky vybraných druhů savců ČR ití pro udržitelný rozvoj dopravy. Tomáš. Libosvár

Vytvořen. ení genetické databanky vybraných druhů savců ČR ití pro udržitelný rozvoj dopravy. Tomáš. Libosvár Vytvořen ení genetické databanky vybraných druhů savců ČR k využit ití pro udržitelný rozvoj dopravy Tomáš Libosvár TA02031259 Vytvořen ení genetické databanky vybraných druhů savců ČR k využit ití pro

Více

ZŠ ÚnO, Bratří Čapků 1332

ZŠ ÚnO, Bratří Čapků 1332 Animovaná chemie Top-Hit Analytická chemie Analýza anorganických látek Důkaz aniontů Důkaz kationtů Důkaz kyslíku Důkaz vody Gravimetrická analýza Hmotnostní spektroskopie Chemická analýza Nukleární magnetická

Více

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100% F8 - hemofilie A monogenní

Více

Jsme tak odlišní. Co nás spojuje..? Nukleové kyseliny

Jsme tak odlišní. Co nás spojuje..? Nukleové kyseliny Jsme tak odlišní Co nás spojuje..? ukleové kyseliny 1 UKLEVÉ KYSELIY = K anj = A ositelky genetických informací Základní význam pro všechny organismy V buňkách a virech Identifikace v buněčném jádře (nucleos)

Více

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno Zpracování a využití biologického materiálu pro výzkumné účely od nemocných s monoklonální gamapatií Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie,

Více

NMR spektroskopie. Úvod

NMR spektroskopie. Úvod NMR spektroskopie Úvod Zkratka NMR znamená Nukleární Magnetická Rezonance. Jde o analytickou metodu, která na základě absorpce radiofrekvenčního záření vzorkem umístěným v silném magnetickém poli poskytuje

Více

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová. KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová. KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2009 Metodika byla vypracována pracovníky

Více

Návrh směrnice pro správnou laboratorní praxi pro molekulárně genetické vyšetřování Huntingtonovy choroby

Návrh směrnice pro správnou laboratorní praxi pro molekulárně genetické vyšetřování Huntingtonovy choroby Návrh směrnice pro správnou laboratorní praxi pro molekulárně genetické vyšetřování Huntingtonovy choroby Připravily: V.Kebrlová, J.Židovská Poslední revize: březen 2007 Směrnice jsou sestaveny podle doporučení

Více

2. PROTEINOVÉ TECHNIKY

2. PROTEINOVÉ TECHNIKY OBSAH 1. DNA TECHNIKY (P. Kotrba, Z. Knejzlík) 1 1.1 Polymerasová řetězová reakce - klonování DNA in vitro 1 1.2 Polymorfismus DNA a jeho analýza 3 1.3 VNTR sekvence, jejich význam v kriminalistice a diagnostice

Více

Písemná zpráva zadavatele pro část 4. - Fluorometr pro testování proteinů, RNA, DNA

Písemná zpráva zadavatele pro část 4. - Fluorometr pro testování proteinů, RNA, DNA Písemná zpráva zadavatele pro část 4. - Fluorometr pro testování proteinů, RNA, DNA veřejné zakázky zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, v platném znění (dále jen ZVZ ). Veřejná

Více

BÍLKOVINY HLÍZ BRAMBOR

BÍLKOVINY HLÍZ BRAMBOR Jihočeská univerzita v Českých Budějovicích ZEMĚDĚLSKÁ FAKULTA BÍLKOVINY HLÍZ BRAMBOR jejich izolace a možnosti uplatnění Jan Bárta a kol. 19. května 2015, České Budějovice Kancelář transferu technologií

Více

Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady

Více

Využití synchrotronového záření pro diagnostiku a vývoj nových léčiv

Využití synchrotronového záření pro diagnostiku a vývoj nových léčiv Využití synchrotronového záření pro diagnostiku a vývoj nových léčiv J.Hašek, ÚMCH AV ČR Zisky farmaceutických společností a společností využívajících biotechnologie činící mnoha miliard dolarů ročně jsou

Více

Analyzátory moči a močového sedimentu

Analyzátory moči a močového sedimentu KATALOG 2013 Dirui Industrial Co., Ltd Analyzátory moči a močového sedimentu Katalog produktů firmy DIRUI Analyzátory moči a močového sedimentu Analyzátory přístrojové vybavení Název Popis H-100 - analyzátor

Více

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí Stárnutí organismu Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí poklesy funkcí se liší mezi orgánovými systémy Některé projevy stárnutí ovlivňuje výživa Diagnostické metody odlišují

Více

Genetická "oblast nejasnosti" u HCH: co to znamená? Genetický základ

Genetická oblast nejasnosti u HCH: co to znamená? Genetický základ Novinky ve výzkumu Huntingtonovy nemoci. Ve srozumitelném jazyce. Napsáno vědci. Určeno široké huntingtonské veřejnosti. Genetická "oblast nejasnosti" u HCH: co to znamená? Přechodní alely a alely s redukovanou

Více

Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách

Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách Teorie Stanovení celkových proteinů Celkové množství proteinů lze stanovit pomocí několika metod; například: Hartree-Lowryho

Více

doc. RNDr. Milan Bartoš, Ph.D.

doc. RNDr. Milan Bartoš, Ph.D. doc. RNDr. Milan Bartoš, Ph.D. Konference Klonování a geneticky modifikované organismy Parlament České republiky, Poslanecká sněmovna 7. května 2015, Praha Výroba léků rekombinantních léčiv Výroba diagnostických

Více

nastavení real-time PCR cykleru Rotor Gene 3000

nastavení real-time PCR cykleru Rotor Gene 3000 Verze: 1.4 Datum poslední revize: 25. 3. 2015 nastavení real-time PCR cykleru Rotor Gene 3000 (Corbett Research) generi biotech OBSAH: 1. Nastavení teplotního profilu a spuštění cykleru... 3 2. Zadání

Více

Pavel Čermák. Thomayerova nemocnice Praha - Krč. 14.2.2013 výroční zasedání SLM

Pavel Čermák. Thomayerova nemocnice Praha - Krč. 14.2.2013 výroční zasedání SLM Pavel Čermák Thomayerova nemocnice Praha - Krč Úkoly na rok 2012 Vytvoření seznamu přístrojů Doplnění podkladů pro kalkulaci Možná úprava některých stávajících výkonů?? Revize pracovních časů u všech výkonů

Více

Absorpční spektroskopie při biologické analýze molekul

Absorpční spektroskopie při biologické analýze molekul Absorpční spektroskopie při biologické analýze molekul Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 8.11.2007 7 1 UV spektroskopie DNA a proteinů Všechny atomy absorbují v UV oblasti

Více

Vakcíny z nádorových buněk

Vakcíny z nádorových buněk Protinádorové terapeutické vakcíny Vakcíny z nádorových buněk V. Vonka, ÚHKT, Praha Výhody vakcín z nádorových buněk 1.Nabízejí imunitnímu systému pacienta celé spektrum nádorových antigenů. 2. Jejich

Více

JIC, zájmové sdružení právnických osob Brno, U Vodárny 2, PSČ 616 00 tel. +420 511 205 330 fax +420 541 143 011 e-mail jic@jic.cz www.jic.

JIC, zájmové sdružení právnických osob Brno, U Vodárny 2, PSČ 616 00 tel. +420 511 205 330 fax +420 541 143 011 e-mail jic@jic.cz www.jic. JIC, zájmové sdružení právnických osob Brno, U Vodárny 2, PSČ 616 00 tel. +420 511 205 330 fax +420 541 143 011 e-mail jic@jic.cz www.jic.cz zprostředkovávání zaměstnanců na pracovní pozice v top, nižším

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Vědecký výbor veterinární

Vědecký výbor veterinární Vědecký výbor veterinární Klasifikace: Draft Pro vnitřní potřebu VVV Oponovaný draft Pro vnitřní potřebu VVV Finální dokument X Pro oficiální použití Deklasifikovaný dokument Pro veřejné použití MOŽNOSTI

Více

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD Shrnutí webináře Dystrofin 101: vše, co jste kdy chtěli vědět o dystrofinu (a nebáli jste se zeptat) Francesco Muntoni (University College of London), John Porter (PPMD) Dystrofinopatie: DMD versus BMD

Více

Zkoumání přírody. Myšlení a způsob života lidí vyšší nervová činnost odlišnosti člověka od ostatních organismů

Zkoumání přírody. Myšlení a způsob života lidí vyšší nervová činnost odlišnosti člověka od ostatních organismů Předmět: PŘÍRODOPIS Ročník: 9. Časová dotace: 1 hodina týdně Výstup předmětu Rozpracované očekávané výstupy Učivo předmětu Přesahy, poznámky Konkretizované tématické okruhy realizovaného průřezového tématu

Více

Výukový materiál zpracován v rámci projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0996

Výukový materiál zpracován v rámci projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0996 Výukový materiál zpracován v rámci projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0996 Šablona: III/2 č. materiálu: VY_32_INOVACE_CHE_412 Jméno autora: Třída/ročník: Mgr. Alena

Více

Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění

Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění Klin. Biochem. Metab., 14 (35), 2006, No. 2, p. 89 95. Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění Gojová L., Kozák L. Centrum molekulární biologie a genové terapie, Fakultní

Více

P ehled výsledk z Referen ní laborato e

P ehled výsledk z Referen ní laborato e P ehled výsledk z Referen ní laborato e 1,3 Hajdúch M, 1,3 Trojanec R, 2,3 Kolá Z, 1,3 Bouchalová K, 2,3 Sedláková E. 1 Laborato experimentální medicíny p i D tské klinice LF UP a FN Olomouc 2 Laborato

Více

Činnost a aktivity zdravotníků v oblasti klonování a GMO

Činnost a aktivity zdravotníků v oblasti klonování a GMO Konference ZV PS ČR Klonování a GMO dne 7. 5. 2015 v Praze Činnost a aktivity zdravotníků v oblasti klonování a GMO Vladimír Ostrý Státní zdravotní ústav v Praze Centrum zdraví, výživy a potravin v Brně

Více

variability mám k dispozici ohrožený druh k tomu, aby se přizpp m?

variability mám k dispozici ohrožený druh k tomu, aby se přizpp m? Jakou jednotku máme m me chránit? (populaci, druh, poddruh) Jak genetické faktory ovlivňuj ují životaschopnost a přežívání populací?? Kolik jedinců je potřeba k záchraně druhu? Kolik genetické variability

Více

Sylabus pro předmět Biochemie pro jakost

Sylabus pro předmět Biochemie pro jakost Sylabus pro předmět Biochemie pro jakost Kód předmětu: BCHJ Název v jazyce výuky: Biochemie pro Jakost Název česky: Biochemie pro Jakost Název anglicky: Biochemistry Počet přidělených ECTS kreditů: 6 Forma

Více