Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/

Rozměr: px
Začít zobrazení ze stránky:

Download "Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316"

Transkript

1 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/

2 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace

3 Genetické markery Genetické markery jsou definovány jako morfologické, anatomické, fyziologické nebo biochemicko-genetické vlastnosti organismů těsně korelující s jinými, mnohdy složitějšími, vlastnostmi.

4 Rozdělení genetických markerů morfologicko-anatomické biochemicko-fyziologické markery zásobní a stavební proteiny biochemicko-genetické izoenzymy nukleové kyseliny

5 Základní rozdělení DNA markerů délkového polymorfismu fragmentů DNA vzniklých restrikčním štěpením (RFLP) detekce variability na základě amplifikace fragmentů DNA v in vitro podmínkách (PCR) různých typů propojení metod RFLP a PCR (AFLP) polymorfismu repetetivních sekvencí mini- a mikrosatelitů stanovení sekvencí neboli pořadí nukleotidových párů v molekule DNA

6 Oblasti využití genetických markerů humánní medicína veterinární medicína kriminalistika šlechtění a plemenářství evoluční biologie paleontologie detekce letálně působících genů detekce napadení člověka například viry určení paternity detekce napadení zvířat například viry detekce letálně působících genů jednoznačná identifikace osob selekce s využitím markerů identifikace odrůdové pravosti a čistoty určení paternity fytopatologie historie

7 Selekce s využitím markerů Selekce s využitím markerů neboli MAS (Marker Assisted Selection) je aktuální trend ve šlechtění rostlin i zvířat. MAS je založeno na tom, že šlechtitel selektuje potomstvo na základě genetické analýzy s využitím různých typů markerů. Tímto způsobem eliminuje chybu selekce u znaků, které jsou modifikovány vnějším prostředím. Použití metody MAS výrazně urychluje a zefektivňuje šlechtění. Řada genetických markerů vykazuje kodominanci a umožňují tak odlišit homozygoty od heterozygotů. U kvantitativních znaků jsou pomocí MAS identifikovány takzvané kandidátní geny, které vykazují majoritní efekt na úroveň kvantitativního znaku. DNA markers can be used to determine whether a seedling carries an allele of interest. Here, the marker for the red-flesh allele is detected as an additional DNA band on an agarose gel. Breeders use information like this to decide which seedlings to grow and which to discard.

8 Biochemicko-genetické markery - detekce variability organismů přímo na úrovni jejich genetické informace. - starší typy markerů (proteiny, izoenzymy) detekovaly variabilitu produktů transkripce a translace. - současnost: detekce variabilitu nositelů genetické informace DNA a RNA. - zpravidla je variabilita detekována a vyhodnocována na základě elektroforetické separace různě velkých molekul obvykle na gelovém nosiči.

9 Markery založené na polymorfismu DNA Základní vlastnosti DNA markerů: jsou aplikovatelné u všech organismů, kde je zvládnutá technika izolace DNA nejsou závislé na podmínkách prostředí jejich počet je téměř neomezený často lze DNA markery lze použít na minimálním množství DNA = nedestruktivní metody (části listů, semena) pomocí DNA markerů lze charakterizovat i velmi raná ontogenetická stádia organismů

10 Proteinové markery Jsou známy vztahy mezi přítomností určité bílkoviny, lokalizací jejího genu a dalšími vlastnostmi rostliny. Pomocí těchto markerů je možné predikovat například kvalitu složení obilky, odolnosti k některým chorobám nebo stanovit odrůdovou pravost vypracovány certifikované metodiky U skotu je obdobným způsobem provedeno hodnocení proteinů mléka. Příklad využití proteinových markerů při studiu linií pýru (Agropyron elongatum) (potenciální zdroj genů tolerance pšenice vůči salinitě a suchu). Přítomnost specifických bandů u linií s vlastnostmi, které by mohly ovlivňovat vlastnosti těsta.

11 Isozymy = allozymy U většiny enzymů existují takzvané izoformy neboli izoenzymy. Izoenzymy katalyzují stejnou biochemickou reakci, t.j. reagují s jedním substrátem a vytváří shodný produkt. Izoformy jednoho enzymu se vzájemně odlišují například velikostí molekuly. Levné, rychlé, dostupné? Omezená hodnota informací Exprese závislá na prostředí Jen čerstvý materiál

12 Isozymy = allozymy

13 Isozymy = allozymy

14 RFLP RFLP - Restriction Fragment Lenght Polymorphism Polymorfismus v délce restrikčních fragmentů gdna naštěpíme restriktázou fragmenty rozdělíme elektroforeticky z gelu je přesajeme na membránu membránu hybridizujeme se sondou navázanou sondu detekujeme U malých genomů nebo malých fragmentů DNA s malým počtem vznikajících fragmentů metoda využívá pouhé elektroforetické separace různě dlouhých fragmentů U větších genomů technika využívá DNA-DNA hybridizace na principu Southern blottingu.

15 Co jsou to restrikční fragmenty? Restrikční fragmenty jsou úseky molekul DNA, které vznikají enzymatickou aktivitou restrikčních endonukleáz, které rozpoznávají specifické sekvence, kde přestřihnou molekulu DNA.

16 Postup RFLP Rozpoznávací místo restriktázy EcoRI - 6bp dlouhou sekvence (GAATTC) ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC Sonda -Ze všech naštípaných fragmentů vybírám pouze určitou část DNA, kterou studujeme (gen)

17 Postup RFLP Rozpoznávací místo restriktázy EcoRI - 6bp dlouhou sekvence (GAATTC) ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC

18 Postup RFLP Standartní (popř. dominantní) alela po naštěpení ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC ATCGTCCAG AATTCATGCCCTTCGCCCTTCCGTCCAG AATTCGCCCTTC

19 Postup RFLP Standartní (popř. dominantní) alela po naštěpení ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC ATCGTCCAG AATTCATGCCCTTCGCCCTTCCGTCCAG AATTCGCCCTTC Sonda

20 Postup RFLP Mutovaná (popř. recesivní) alela ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGACTTCGCCCTTC ztráta restrikčního místa (nezabrání vazbě sondy)

21 Postup RFLP Mutovaná (popř. recesivní) alela po naštěpení ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGACTTCGCCCTTC ATCGTCCAG AATTCATGCCCTTCGCCCTTCCGTCCAGACTTCGCCCTTC ztráta restrikčního místa (nezabrání vazbě sondy)

22 Postup RFLP Standartní alela Mutovaná alela ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC ATCGTCCAGAATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC Štěpení a elfo AATTCATGCCCTTCGCCCTTCCGTCCAG AATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC AATTCGCCCTTC ATCGTCCAG ATCGTCCAG Po provedení elektroforézy, přesátí a hybridizace (Southern blotting) AATTCATGCCCTTCGCCCTTCCGTCCAG AATTCATGCCCTTCGCCCTTCCGTCCAGAATTCGCCCTTC AATTCGCCCTTC ATCGTCCAG ATCGTCCAG

23 RFLP Sondou se rozumí úsek jednořetězcové DNA, který má sekvenci jako detekovaný gen. Sonda je obvykle označena radioizotopem fosforu, který ji umožňuje detekovat. classes.midlandstech.edu

24 Genetická interpretace RFLP markerů RFLP markery představují kodominantní typ markerů. Umožňují vzájemně odlišit dominantní homozygoty, heterozygoty a recesivní homozygoty. Uplatňují se například: 1. Pro vyhledávání v genomových knihovnách 2. Pro detekce konkrétních genů 3. Pro detekce bodových mutací 4. Pro tvorbu RFLP map,.

25 Segregace RFLP markeru Letální recesivní alela vznikla mutací a liší se od dominantní alely ztrátou restrikčního místa.

26 Případ Colin Pitchfork (1983 a 1986) Dvě slečny znásilněny a zavražděny v hrabství Leicestershire v Anglii Mentálně zaostalý mladík Richard Buckland, který nahlásil nález druhého těla, se přiznal k zavraždění této dívky Na základě RFLP vyloučen místních mužů bylo požádáno o vzorek krve nebo bukální stěr Pekař exhibicionista Colin Pitchfork za sebe k odběru poslal (za 200 liber) kamaráda Iana Kellyho, který se tím pochlubil v hospodě První omilostnění a první obvinění pomocí DNA důkazů.

27 Nevýhody RFLP Požadavek velkého množství intaktní DNA (50 ng odpovídá ~ buněk) Metoda málo robustní (interpretační potíže)

28 Replikace in vivo

29 Amplifikace fragmentů DNA v in vitro podmínkách Tato metoda detekce genů je označována jako polymerázová řetězová reakce PCR (Polymerase Chain Reaction). Je založena na zmnožení hledaného úseku DNA. Který je ohraničen známými sekvencemi takzvanými primery. Metoda je tvořena opakováním těchto kroků: denaturace analyzované templátové DNA nasedání dvojice primerů annealing prodlužováním fragmentů DNA. Zmnožení fragmentu DNA je prováděno v termocykleru. tnrtb.wordpress.com

30

31 objev DNA polymerázy a první pokusy s umělou syntézou většího množství DNA (amplifikace DNA) PCR replikace in vitro PCR Polymerase Chain Reaction Polymerázová řetězová reakce 1983 Karry Mullis pracoval na projektu geneticky podmíněných chorob člověka v kalifornské firmě Cetus Corporation. Hledal novou metodu analýzy mutací DNA. Modifikoval Sangerovu metodu sekvenace DNA přidal zpětný primer pro syntézu krátkých úseků DNA. Uvědomil si, že opakováním amplifikace DNA pomocí DNA polymerázy může vést k řetězovému množení specifického segmentu genomu - PCR. Pomocí PCR můžete z jedné molekuly DNA vytvořit 100 biliónů kopií za jedno odpoledne. Potřebujete jenom zkumavku, několik jednoduchých reagencií a zdroj tepla 1984 rozpracování metody s matematikem Fredem Faloonou, patentování (Mullis et al. 1986; Mullis a Faloona 1987) 1993 Nobelova cena za chemii V devadesátých letech Cetus Corp. prodává patenty PCR a Taq firmě Hoffman La Roche za 330 miliónů $

32 Polymerázová řetězová reakce denaturace annealing prodlužování cit.vfu.cz

33 Zvyšování počtu kopií fragmentu DNA při PCR

34 PCR replikace in vitro DNA

35 PCR Polymerase Chain Reaction další rozvoj metody s použitím termostabilní polymerázy z termofilní bakterie Thermus aquaticus = zkratka Taq Pol" nebo "Taq")

36 Jak lze zjistit výsledek amplifikace Výsledek amplifikace se stanovuje gelovou elektroforézou. Elektroforeogram amplifikovaných fragmentů DNA, které umožní identifikovat odrůdy brambor.

37 PCR hlavní faktory ovlivňující průběh reakce Koncentrace dntps - stock solution 100mM - ředění na 20 a 200 mol (pro každý dntp) vyšší specifičnost a nižší frekvence zařazení nesprávného nukleotidu Koncentrace MgCl2 - optimum je 1,5-2mM, - nad 6mM klesá aktivita Taq Polymerázy - nízká koncentrace nízké výtěžky PCR - příliš vysoké koncentrace rozmazané proužky na gelu nebo zmnožení nespecifických produktů Teplota annealingu nasednutí primerů - vyšší teplota = vyšší specifičnost ke komplementární sekvenci = primer nasedá na komplementární místo s vyšší přesností = přesnější výsledek PCR - nižší teplota vhodné pro studie, kdy se používají primery odvozené od příbuzných druhů; nebezpečí vzniku nespecifických produktů (jiné úseky DNA, než které jsme chtěli získat) - zvýšení specifičnosti např. tzv. Touch down PCR v prvních cyklech vyšší teplota = specifické produkty, ale v s nižším výtěžkem = v dalších cyklech vyšší teplota annealingu = zvýší se výtěžek PCR - Koncentrace templátové DNA příliš vysoká konc. DNA může bránit PCR, zároveň se naředí inhibitory PCR ve směsi (např. chemikálie použité při izolaci)

38 PCR hlavní faktory ovlivňující průběh reakce Volba polymerázy odlišné výsledky PCR od Taq P. od různých firem - např. pro sekvenace proofreading polymerase nižší procento vložení chybného nukleotidu Aditiva - pro zvýšení efektivity PCR, stabilizaci enzymu - v pufru dodávaném s polymerázou: - detergenty (TRITON X-100, TWEEN, NP-40) - zpravidla 2 ze tří uvedených - dimetylsulfoxin nebo glycerol lepší průběh denaturace a chlazení - BSA (bovinní sérový albumin) nebo želatina - Finální koncentrace aditiv se pohybuje mezi 0,1 a 1,0% celkové reakční směsi, avšak konkrétní koncentrace je většinou nutno empiricky vyzkoušet. Kontaminace nebezpečí zejména u málo koncentrovaných nebo problematických templátů - sterilní špičky, vysoce čistá voda pro PCR, pufry, PCR zkumavky, rukavice (nikdy nesterilizovat dntps, primery, polymerázu ) - příprava PCR směsí ve flow boxu v oddělené místnosti od prostor, kde se pracuje s produkty - při přecházení z místností měnit rukavice..

39 Optimalizace reakčních podmínek PCR - Změny v protokolu vedoucí k odstranění nežádoucích nespecificit a ke zvýšení množství PCR produktu. - počet cyklů - annealingová teplota - koncentrace Mg 2+, polymerázy, templátové DNA - aditiv (např. DMSO, formamid) Marker 1 - produkt 240bp Příklad optimalizace PCR Podmínky podle literatury B PCR po optimalizaci Ta = 62 C, 30 cyklů 20uM primery Ta = 67 C, 25 cyklů 10uM primery B Marker 2 - produkt 460bp Ta = 66 C, 30 cyklů 20uM primery Ta = 66 C, 25 cyklů 10uM primery

40 RAPD - Random Amplified Polymorphic DNA Variabilita délek náhodně amplifikované DNA

41 RAPD Random Amplified Polymorphic DNA Variabilita délek náhodně amplifikované DNA PCR s jedním primerem Primer dosedne na různých místech a v různých směrech amplifikuje DNA fragmenty Identifikace např. kmenů bakterií popř. ověřování homogenity linií

42 RAPD Výhody - Velmi levné - Rychlé a snadné = není třeba znát sekvenci primeru, stačí velmi málo DNA, poměrně dost fragmentů Nevýhody převažují: - Omezena hodnota informace (dominantní marker) - Nereproducibilní DNES TREND NEUŽÍVAT RAPD MARKERY

43 AFLP - Amplified Fragment Length Polymorphism Polymorfismus délky amplifikovaných fragmentů

44 AFLP Princip metoda založená na restrikci DNA dvěma enzymy selektivní namnožení jen některých proužků vizualizace proužků na gelu Postup relativně složitý (4 fáze) 1. RESTRIKCE specifické rozštěpení DNA restrikčními endonukleázami MseI - rozpoznává 4bp dlouhou sekvenci (TTAA) EcoRI - rozpoznává 6bp dlouhou sekvenci (GAATTC) (Variabilita je dána mutací v restrikčním místě insercí - delecí mezi restrikčními místy) získáme množství fragmentů s lepivými konci = sticky ends

45 AFLP 2. ligace pomocí T4 ligázy k fragmentům přidány adaptory = oligonukleotid, jeho sekvenci známe známe sekvence konců všech fragmentů můžeme je amplifikovat PCR

46 AFLP 3. preselektivní amplifikace klasická PCR s primery komplementárními k sekvenci adaptorů, navíc 1 nukleotid směrem dovnitř amplifikovaného úseku = selekce jen ca. 1/4 fragmentů (fragmenty komplementární k primerům + fragmenty EcoRI- MseI)

47 AFLP 3. preselektivní amplifikace restrikce + ligace

48 AFLP 3. preselektivní amplifikace restrikce + ligace preamplifikace

49 AFLP 4. selektivní amplifikace -fragmentů je stále mnoho pro objektivní vyhodnocení -další redukce jejich počtu použitím primerů se 3mi selektivní nukelotidy (s přesahem "dovnitř" amplifikovaných fragmentů) - tento krok se provádí opakovaně s různými primerovými kombinacemi (primery se liší zařazenými nukleotidy na koncích -redukce na 1/256 všech fragmentů (1/16 x 1/16)

50 AFLP 5. vyhodnocení -primery jsou fluorescenčně značeny sekvenátor - Primery bez značení PAGE elektroforéza

51 AFLP realizace AFLP - realizace 1: Restrikce - příprava restrikčního mixu (EcoI, MseI, buffer, voda) - přidat k DNA - inkubovat 2 hod při 37 C 2: Ligace - příprava ligačního mixu (LIGAZA, BUFF, ADAPTORY, VODA) - přidat k roztoku z předchozího kroku - inkubovat 2,5 hod při 37 C 3: Preamplifikace - klasická PCR - ligační roztok jako matrice Kroky 1-3 se provedou pouze 1x, dál pracujeme s preamplifikátem 4: Amplifikace - klasická PCR - matrice = preamplifikát - měníme kombinace primerů = detekujeme jiné fragmenty

52 MIKROSATELITY

53 MIKROSATELITY krátké tandemové repetice, STR (short tandem repeats) repetice jednoduchých sekvencí, SSR (simple sequence repeats) krátké, tandemově se opakující jednoduché sekvenční motivy zpravidla o délce 2-6bp prokaryota a eukaryota kódující i nekódující oblasti Vysoká mutační rychlost (u savců 10-3 až 10-4/lokus/generaci) hlavní zdroj vysoké proměnlivosti - sklouznutí nukleotidového řetězce během replikace (replication slippage). GTTCTGTCATATATATATATAT CGTACTT GTTCTGTCATATATATATATATATATATCGTACTT Alely se liší svou délkou Snadná separace pomocí elektroforézy

54 MIKROSATELITY Dokonalé = perfect repeats (jeden nepřerušený motiv): Jednonukleotidové: AAAAAAAAAAAAAAAAAA Dinukleotidové: CACACACACACACACACACA = (CA)n Trinukleotidové: CGTCGTCGTCGTCGTCGTCGT = (CGT)n Tetranukleotidové: CAGACAGACAGACAGACAGA =(CAGA)n Pentanukleotidové: AAATTAAATTAAATTAAATT =(AAATT)n Hexanukleotidové: CTTTAACTTTAACTTTAACTTTAA =(CTTTAA)n Pr: (AG)32 ; (TAT)25 ; (CAA)7 Cicer Nedokonalé = imperfect repeats (motiv je přerusen jedním nebo několika bazemi): (TC)6A(TC)13 ; (AG)12GG(AG)3 Cicer Složené = compound: (směs dokonalých nebo nedokonalých vzorů několika motivů) (AT)6(GT)42AT(GT)5(GT)10 (AT)14(AG)8 (GAA)21 (TA)23 Nejčastější motivy: mono a dinukleotidové; 3, 4 a 5ti méně

55 MIKROSATELITY GTTCTGTCATATATATATATCGTACTT celková DNA PCR specifický pár primerů

56 ELFO separace

57 MIKROSATELITY Výhody - vysoká variabilita - velká početnost a rozmístění po celém genomu - jednoduchost analýzy (mikrosatelity lze poměrně snadno studovat pomocí PCR) - robustní a reproducibilní markery - KODOMINANTNÍ MARKER, IDENTIFIKACE ALEL Nevýhody - Musíme znát sekvence primerů - Pokud neznáme, tak testovat SSR z příbuzných druhů - Optimalicace PCR - Popřípadě vyvíjet nové: EST-SSR

58 MIKROSATELITY - využití jaderné mikrosatelity (SSRs) nejlepší marker pro zhodnocení variability na populační úrovni jsou potřeba druhově specifické primery, tj. metoda použitelná pouze v případě, že pro studovaný druh byly primery již publikovány chloroplastové mikrosatelity (cpdna SSRs) vhodné pro hodnocení variability na úrovni příbuzných druhů, někdy i na vnitrodruhové úrovni dostupné jsou univerzální primery Obecně: Forenzní genetika: kriminalistika, identifikace jedinců, příbuzenské vztahy analýza rodičovství (parentage analysis) určení rodičů semen (semenáčků) v populacích identifikace klonů populačně-genetické studie genový tok, migrace historie populací

59 MIKROSATELITY - využití

60 MIKROSATELITY - využití

61 SEKVENOVÁNÍ DNA

62 SEKVENOVÁNÍ DNA - princip zjištění pořadí nukleotidů v řetězci DNA ATATATAGGCAAGGAATCTCTATTATTAAATCATT Zjištění rozdílů mezi jedincemi, geny Základní informace pro konstrukci primerů využití informace ke zjištění průběhu a rychlosti evoluce zjištění podobnosti a příbuznosti taxonů

63 SEKVENOVÁNÍ DNA - princip 1) Předstupeň: PCR s použitím dvojice primerů namnožení studovaného úseku DNA 2) sekvenační reakce použití pouze jednoho primeru kromě dntp jsou ve směsi přítomny i ddntp produkce fragmentů lišících se přesně o 1 bázi Elektroforetická separace fragmentů na gelu automatický sekvenátor

64 SEKVENOVÁNÍ DNA Aplikace - Aplikační možnosti: 1. evoluce genů (vznik alel, lokusů,redukce polymorfismu v důsledku selekce atd.) 2. vnitrodruhové (populační) studie (geografická proměnlivost, tok genů, hybridizace, fylogeografie (př. mitochondriální geny, Y chromozom) 3. mezidruhové studie (studium speciace, biogeografie) - volba správné sekvence 4. Detekce SNP = identifikace jedinců, taxonů, populací sekvenace pomáhá nalézt drobné populačně- i taxonově-specifické rozdíly Výhoda - Možnost srovnání sekvenčních dat o vašem organismu s údaji v internetových databázích Př:

65 SEKVENOVÁNÍ DNA 1977: dvě metody zjištění pořadí nukleotidů v DNA Maxamova-Gilbertova (chemická) metoda je založena na bázově-specifické chemické modifikaci a následném štěpení fragmentů DNA - dnes se neužívá Krátká sekvencedna (ds nebo ss) * na 5' konci radioaktivně označena 32 P. * vzorek se rozdělí na pět částí a) Přídavek chemikálí modifikují vždy jeden nebo dva typy nukleotidů: 1. dimethylsulfát: G 2. kys. mravenčí: A+G 3. hydrazin: C + T 4. 1,5M NaCl: C b) Přídavkem piperidinu: štěpení DNA v místě modifikace c) Elfo separace Výsledek ELFO: sekvence DNA: 5 -GTCTGCA-3 (čte se zespodu) - narazila na technické problémy s vývojem standartních molekulárních kitů - technicky příliš komplexní a příliš mnoho toxických látek

66 SEKVENOVÁNÍ DNA Sangerova metoda terminace řetězce Sangerova metoda založena na terminaci replikace nového řetězce podle matrice zkoumané sekvence dideoxynukleozidtrifosfátem (ddntp) na 3 -uhlíku deoxyribózy chybí OH-skupina a proto k nim DNA polymeráza nemůže navázat další nukleotid pokud během replikace dojde k náhodné inkorporaci dideoxynukelotidu (dda, ddc, ddg, ddt), replikace se zde zastaví

67 SEKVENOVÁNÍ DNA Sangerova metoda založená na terminace řetězce Sangerova (enzymatická) metoda Vzorek DNA se rozdělí do čtyř zkumavek a do každé se přidá specifický primer, směs všech čtyř standartních nukleotidů a DNA polymeráza Do každého ze vzorků je přidán vždy jen jeden značený dideoxynukleotid - v určitém poměru s deoxinukleotidy Př: dda + da, dg, dc, dt ddt + da, dg, dc, dt. Po ukončení amplifikace separace pomocí denaturující PAGE v dlouhém (sekvenačním) gelu + detekce autoradiograficky výsledné pořadí nukleotidů se odečte

68 SEKVENOVÁNÍ DNA - zefektivnění Sangerovy metody vývoj kapilárních sekvenátorů Syntéza DNA je v principu totožná s asymetrickou PCR (tj. s jedním primerem) v normálním termocykleru, s extenzí řetězce Taq polymerázou. k detekci produktů jsou užívány fluorescenčně značené ddntp = každý dideoxynukleotid má jinou značku tzv. Dye-terminator sequencing Př. ABI PRISM Big Dye Terminator v 3.1. Ready Reaction Cycle Sequencing Kit Polymerizační reakce probíhá v jednom vzorku během PCR dochází k produkci fragmentů lišících se o jednu bázi detekce produktů probíhá během elektroforetické migrace v kapiláře pomocí laserového detektoru sekvence je zaznamenána přímo do paměti počítače bp/run

69 SEKVENOVÁNÍ DNA - zefektivnění Sangerovy metody vývoj kapilárních sekvenátorů Vzorek s fluorescenčně značenými fragmenty po PCR

70 SEKVENOVÁNÍ DNA

71 SEKVENOVÁNÍ DNA - zefektivnění metody vývoj kapilárních sekvenátorů Kapiláry - vnitřní průměr 50μm - naplněny gelem s nízkou viskozitou, který nahradil polyakrylamid (dříve kapiláry nešlo opakovaně používat) - kratší časy analýz - plně automatizované systémy

72

73 Automatické sekvenátory

74 Nature Reviews Microbiology 7,

75 NGS = Next Generation Sequencing Celogenomové sekvenování - paralelně probíhající sekvenační reakce - produkují tisíce miliony sekvencí v jednom běhu - čtení kratších úseků (30-300bp) - Obecný postup 1. Izolace DNA 2. Příprava DNA knihovny PCR, klonování 3. Vlastní sekvenace 4. Vyhodnocení surových dat 5. Sestavení konsenzuální sekvence

76

77 Nature Reviews Microbiology 7,

78 454 - Pyrosekvenace - první nová sekvenační metoda (1998) - princip: detekce aktivity DNA-polymerázy během syntézy DNA - Výhody: - délka čtených úseků 700bp - rychlost sekv. cyklus 10 hodin - sekvenace PCR produktů - Nevýhody - překryvy homopolymerních oblastí - cena

79 454 sekvenování úseky 300 bp - čteno 400 tisíc fragmentů najednou Fragmentace DNA bp Ligace adaptorů - B adaptor má biotinovou značku pro přichycení na streptavidinem obalenou magnetickou kuličku Pico-titer plate (sekvenační čip - obsahuje 1,6 mil jamek širokých 44μm - průměr DNA kuličky je 26 μm -přídavek menších kuliček dvou typů jeden obsahuje chemikálie pro pyrosekvenaci, druhý typ fixuje kuličky s DNA Emulzní PCR - DNA kuličky do roztoku oleje a vody - Protřepání = vznik mikroreaktoru okolo kuličky Sekvenační reakce - Na destičku se cyklicky nanáší roztok polymerázy a vždy jednoho nukleotidu viz. pyrosekvenace Záznam a zpracování dat

80 Pyrosekvenování 1. začlenění nukleotidu (konkrétní typ, ne směs) 2. uvolnění pyrofosfátu (PPi) 3. Vznik ATP Enzym ATP sulfuryláza katalyzuje vznik ATP reakcí PPi s adenosinfosfosulfátem (APS) 4. Emise záření: enzym luciferáza spotřebuje vzniklý ATP na oxidaci luciferinu záblesk 5. Detekce záblesku 6. Enzym apyráza odstraní nespotřebované nukleotidy a ATP 7. Promytí systému 8. Změna typu nukleotidu ve směsi krok č 1.

81 pico-titer plate from Roche's FLX

82 Roche 454 sequencing

83 Illumina Genome Analyzer -metoda sekvenace syntézou (SBS-sequencing by synthesis) - r. 2006; úseky 35-50bp - 1) Příprava knihovny - fragmentace - na konce dva adaptéry - ELFO: vyříznou se fragmenty bp - přečištění - 2) Amplifikace fragmentů (bridge amplification) - na sklíčku jsou oligonukleotidy komplementární k oběma adaptorům - jednovláknové fragmenty se navážou na sklíčko vytvoří můstek - dosyntetizování komplementárního vlákna - denaturace dva identické fragmenty navázané na sklíčko blízko sebe - opakování = vznik tisíců kopií těsně vedle sebe v tzv. clusterech

84 Illumina Genome Analyzer - 3) sekvenační reakce - v každém cyklu NARÁZ všechny nukleotidy - mají fluorescenční značku a modifikovaný 3 konec (brání zařazení více nukleotidů v jednom kroku) - zařazení nukleotidu provázené emisí světla, charakteristického pro daný nukleotid - detekce - odstranění fluoresc. značky a odblokování 3 konce - opakování postupu - x cyklů - zpracování dat

85

86 Illumina sequencing

87

88 SOLiD sequencing Sekvenace pomocí LIGACE krátkých oligo sond, které jsou fluorescenčně značeny + cena + vysoká přesnost metody (99,95%) + malé množství vzorku - čtené úseky: 100 bp - náročnost zpracování dat a rychlost analýzy (týden)

89 SOLiD sequencing 1. Příprava DNA knihovny Štěpení templátové DNA na kratší fragmenty Připojení adaptorů P1 a P2 empcr amplifikace fragmentů na magn. kuličkách modifikace 5 konce připojení na sekvenační destičku 2. Vlastní sekvenace

90 SOLiD sequencing - Sekvenační reakce Navázání univ. primeru, ligace sondy Připojení univ. primeru k adaptoru P1 Přidání oktamerních sond s fluoro. značkami 4 barvy, 16 kombinací koncových nukleotidů na 1. a 2. pozici Pokud je sonda na 1. a 2. pozici komplementární k 1. a 2. pozici templátu prodloužení řetězce DNA ligázou 2. Emise a detekce fluoresc. signálu 3. Odštěpení fluoresc. značky (štěpení sondy mezi 5. a 6. nukeotidem) 4. Opakování kroků x-krát po konec sekvence 5. Reset primeru odštěpení nově nasynt. Vlákna 6. Napojení nového univ. primeru k adaptoru P1 - primer je o jeden nukleotid kratší 7. Opakování kroku s primery (n-2) až (n-6) 8. Vyhodnocení dat dešifrování barevného kódu

91 8. Vyhodnocení dat dešifrování barevného kódu - každá báze je určena na základě dvou nezávislých sekvenačních cyklů

92

93 SOLiD sequencing

94

95

96

97

98

99

100 Odvozené metody využívající NGS sekvenace při hledání SNP polymorfismů

101 RRL sequencing Trends in Genetics April 2013, Vol. 29, No. 4

102 RAD-Taq sequencing - restrikce: DNA je naštípána restriktázami, - ligace: na vzniklé fragmenty je navázán adaptor, - vysokokapacitní NGS sekvenování (tagged fragment amplification) - analýza dat. - Hledání SNP a) anotace k referenčnímu genomu b) pooling vzorků a hledání SNP lokusů (putative RADtaq locus) - Kombinace snížení komplexnosti genomu restrikčním štěpením s NGS sekvenováním.

103 That s all folks!

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR)

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek

Více

Sekvenování nové generace. Radka Reifová

Sekvenování nové generace. Radka Reifová Sekvenování nové generace Radka Reifová Prezentace ke stažení www.natur.cuni.cz/zoologie/biodiversity v záložce Přednášky 1. Přehled sekvenačních metod nové generace 2. Využití sekvenačních metod nové

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi

Více

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

MOLEKULÁRNÍ TAXONOMIE - 4

MOLEKULÁRNÍ TAXONOMIE - 4 MOLEKULÁRNÍ TAXONOMIE - 4 V této přednášce si představíme metody, které získávají molekulární znaky bez použití sekvenace. Všechny tyto metody je teoreticky možné sekvenací nahradit. Oproti sekvenaci celých

Více

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního

Více

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION VYUŽITÍ AUTOMATICKÉHO SEKVENOVÁNÍ DNA PRO DETEKCI POLYMORFISMŮ KANDIDÁTNÍCH GENŮ U PRASAT Vykoukalová Z., Knoll A.,

Více

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin

Více

Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů CZ.1.07/1.1.00/14.

Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů CZ.1.07/1.1.00/14. Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů CZ.1.07/1.1.00/14.0016 Molekulární markery využívané při studiu variability

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

Elektroforéza Sekvenování

Elektroforéza Sekvenování Elektroforéza Sekvenování Výsledek PCR Elektroforéza V molekulární biologii se používá k separaci nukleových kyselin a bílkovin Principem je pohyb nabitých molekul v elektrickém poli Gelová, polyakrylamidová

Více

Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

variabilita genomu bottleneck Nature Science

variabilita genomu bottleneck Nature Science variabilita genomu Nature Science genetická diverzita člověka na úrovni SNP je nízká: asi 0.1% cca. 90% variace je uvnitř populací cca. 10% mezi populacemi (kontinenty) bottleneck personal genomes James

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Metody molekulární biologie v rostlinné ekologii a systematice

Metody molekulární biologie v rostlinné ekologii a systematice Protokoly a návody pro praktikum Metody molekulární biologie v rostlinné ekologii a systematice Laboratoř molekulární biologie rostlin, PřF JCU, Branišovská 31, České Budějovice 2008, Miroslava Herbstová,

Více

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

Využití metagenomiky při hodnocení sanace chlorovaných ethylenů in situ Výsledky pilotních testů

Využití metagenomiky při hodnocení sanace chlorovaných ethylenů in situ Výsledky pilotních testů Využití metagenomiky při hodnocení sanace chlorovaných ethylenů in situ Výsledky pilotních testů Stavělová M.,* Macháčková J.*, Rídl J.,** Pačes J.** * Earth Tech CZ, s.r.o ** ÚMG AV ČR PROČ METAGENOMIKA?

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,

Více

Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava

Více

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace

Více

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902

Více

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)

Více

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp.

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp. BIOLOGICKÉ LISTY 68 (3): 207-211, 2003 Způsoby detekce polymorfismu homologních DNA a jejich využití při studiu změn ve struktuře rodičovských genomů u modelových allotetraploidních druhů rodu Nicotiana

Více

Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace

Více

Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE

Více

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases

Více

Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů

Více

CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION

CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION AFLP ANALÝZA *** Technika AFLP (Amplification Fragment Lenght Polymorphism - polymorfismus délky amplifikovaných fragmentů) je modifikací RFLP,

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

PO STOPÁCH BAKTERIÍ V/KOLEM NÁS

PO STOPÁCH BAKTERIÍ V/KOLEM NÁS PO STOPÁCH BAKTERIÍ V/KOLEM NÁS Jana Spáčilová, UK v Praze, PřF, Katedra buněčné biologie Svět bakterií je nesmírně druhově bohatý a máme ho blíž než před očima. Mikroskopickými metodami můžeme obdivovat

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta

MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Určování a ověřování paternity u koní. Bakalářská práce Brno 2006 Vedoucí bakalářské

Více

CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION

CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION CLP ANALYSIS OF MOLECULAR MARKERS DIGITAL IMAGE ANALYSIS OF ELECTROPHOEROGRAMS CZECH VERSION DIGITÁLNÍ OBRAZOVÁ ANALÝZA ELEKTROFORETICKÝCH GELŮ *** Vyhodnocování získaných elektroforeogramů: Pro vyhodnocování

Více

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

APLIKACE METAGENOMIKY PRO HODNOCENÍ PRŮBĚHU SANAČNÍHO ZÁSAHU NA LOKALITÁCH KONTAMINOVANÝCH CHLOROVANÝMI ETHYLÉNY

APLIKACE METAGENOMIKY PRO HODNOCENÍ PRŮBĚHU SANAČNÍHO ZÁSAHU NA LOKALITÁCH KONTAMINOVANÝCH CHLOROVANÝMI ETHYLÉNY APLIKACE METAGENOMIKY PRO HODNOCENÍ PRŮBĚHU SANAČNÍHO ZÁSAHU NA LOKALITÁCH KONTAMINOVANÝCH CHLOROVANÝMI ETHYLÉNY Monika Stavělová 1, Jakub Rídl 2, Maria Brennerová 3, Hana Kosinová 1, Jan Pačes 2 1 AECOM

Více

Ondřej Scheinost Nemocnice České Budějovice, a.s.

Ondřej Scheinost Nemocnice České Budějovice, a.s. Ondřej Scheinost Nemocnice České Budějovice, a.s. Nové technologie přelomové období principy technologií klinická použitelnost chips (arrays) sekvenační technologie Důležitost genetických informací i další

Více

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace praktických cvičení molekulárně-biologických předmětů o sekvenční úlohy PRACOVNÍ PROTOKOL PRO PŘEDMĚT GENETCKÁ DIVERZITA Vypracováno

Více

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae).

Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). Populační studie Fisher M. & al. (2000): RAPD variation among and within small and large populations of the rare clonal plant Ranunculus reptans (Ranunculaceae). American Journal of Botany 87(8): 1128

Více

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce

Více

5. Sekvenování, přečtení genetické informace, éra genomiky.

5. Sekvenování, přečtení genetické informace, éra genomiky. 5. Sekvenování, přečtení genetické informace, éra genomiky. Minulá přednáška nastínila zrod molekulární biologie a představila některé možnosti, jak pracovat s DNA - jak ji analyzovat na základě velikosti

Více

ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN

ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN Fragmenty nukleových kyselin lze dle jejich velikosti rozdělit elektroforézou. Elektroforéza využívá rozdílné pohyblivosti jednotlivých fragmentů, danou právě

Více

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)

Více

SEKVENAČNÍ METODY NOVÉ GENERACE: JEJICH PRINCIPY A POTENCIÁLNÍ VYUŢITÍ V GENETICE ČLOVĚKA, ETICKÉ ASPEKTY

SEKVENAČNÍ METODY NOVÉ GENERACE: JEJICH PRINCIPY A POTENCIÁLNÍ VYUŢITÍ V GENETICE ČLOVĚKA, ETICKÉ ASPEKTY BAKALÁŘSKÁ PRÁCE MASARYKOVA UNIVERZITA PŘÍRODOVĚDECKÁ FAKULTA ÚSTAV EXPERIMENTÁLNÍ BIOLOGIE ODDĚLENÍ GENETIKY A MOLEKULÁRNÍ BIOLOGIE SEKVENAČNÍ METODY NOVÉ GENERACE: JEJICH PRINCIPY A POTENCIÁLNÍ VYUŢITÍ

Více

Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry

Více

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK

REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK Molekulární základy dědičnosti - rozšiřující učivo REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK REPLIKACE deoxyribonukleové kyseliny (zdvojení DNA) je děj, při kterém se tvoří z jedné dvoušoubovice DNA dvě nová

Více

Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI

Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI Výborný přístroj, výborné výsledky Fragmentační analyzátor je automatizovaný kapilárový systém s CE značkou

Více

Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený

Více

Vizualizace DNA ETHIDIUM BROMID. fluorescenční barva interkalační činidlo. do gelu do pufru barvení po elfu SYBR GREEN

Vizualizace DNA ETHIDIUM BROMID. fluorescenční barva interkalační činidlo. do gelu do pufru barvení po elfu SYBR GREEN ETHIDIUM BROMID fluorescenční barva interkalační činidlo do gelu do pufru barvení po elfu Vizualizace DNA SYBR GREEN Barvení proteinů Coommassie Brilliant Blue Coomassie Blue x barvení stříbrem Porovnání

Více

Laboratorní přístrojová technika

Laboratorní přístrojová technika Laboratorní přístrojová technika Co najdeme v laboratoři? Přístroje pro obecné použití centrifugy, třepačky, pipety, biohazard boxy Trocha teorie o DNA a PCR Analytické přístroje a příprava vzorků elektroforézy

Více

TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů

Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů Vzdělávání středoškolských pedagogů a studentů středních škol jako nástroj ke zvyšování kvality výuky přírodovědných předmětů Registrační číslo: CZ.1.07/1.1.00/14.0016 Proces forenzní identifikace pomocí

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Centrální dogma molekulární biologie

Centrální dogma molekulární biologie řípravný kurz LF MU 2011/12 Centrální dogma molekulární biologie Nukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Mendel) 1869 objev nukleových kyselin (Miescher) 1944 genetická informace v nukleových

Více

Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký

Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký Kapitola 3 Biomolecular Design and Biotechnology Překlad: Jaroslav Krucký Problémy chemie a biologie mohou být velmi nápomocné, jestliže se naše schopnost vidět to, co děláme, a dělat věci na atomární

Více

Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů

Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů Ústav úspěšně dokončil realizaci dvou investičních projektů s využitím prostředků z Operačního

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení

Více

Metodické listy OPVK. Molekulární metody hodnocení genotypů Marker Assisted Breeding 14.

Metodické listy OPVK. Molekulární metody hodnocení genotypů Marker Assisted Breeding 14. Metodické listy OPVK Molekulární metody hodnocení genotypů Marker Assisted Breeding 14. Molekulární metody hodnocení genotypů 14.1. Izolace DNA V aplikacích zaměřených na analýzu rostlinného genomu je

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

DY D NE N X Hana Vlastníková

DY D NE N X Hana Vlastníková DYNEX Hana Vlastníková Molekulární biologie: Vybavení laboratoře na klíč Přístrojová technika Kompatibilní diagnostické soupravy Profesionální přístup SOP Technická podpora Servis Přístrojové vybavení:

Více

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o.

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o. Genetické markery ve šlechtění skotu pro masnou produkci Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Genetické markery Polymorfní místa v DNA, které vykazují asociaci na sledované znaky Příčinné

Více

Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018

Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018 Tento projekt je spolufinancován Evropským sociálním fondem a Státním rozpočtem ČR InoBio CZ.1.07/2.2.00/28.0018 2.4 GENETICKÉ MANIPULACE in vitro - nekonvenční techniky, kterými lze modifikovat rostlinný

Více

POSOUZENÍ PRAKTICKÉ VYUŽITELNOSTI VYBRANÝCH DNA MARKERŮ REZISTENCE BRAMBORU VŮČI PHYTOPHTHORA INFESTANS

POSOUZENÍ PRAKTICKÉ VYUŽITELNOSTI VYBRANÝCH DNA MARKERŮ REZISTENCE BRAMBORU VŮČI PHYTOPHTHORA INFESTANS POSOUZENÍ PRAKTICKÉ VYUŽITELNOSTI VYBRANÝCH DNA MARKERŮ REZISTENCE BRAMBORU VŮČI PHYTOPHTHORA INFESTANS Assesment of Applicability of Elected Potato Resistance DNA Markers against Late Blight Petr Sedlák

Více

UTILIZATION OF DNA MICROSATELLITES USED IN PARENTITY PANEL IN EVALUATION OF DIVERZITY AND DISTANCES BETWEEN THE BREEDS OF PIGS IN CZECH REPUBLIC

UTILIZATION OF DNA MICROSATELLITES USED IN PARENTITY PANEL IN EVALUATION OF DIVERZITY AND DISTANCES BETWEEN THE BREEDS OF PIGS IN CZECH REPUBLIC UTILIZATION OF DNA MICROSATELLITES USED IN PARENTITY PANEL IN EVALUATION OF DIVERZITY AND DISTANCES BETWEEN THE BREEDS OF PIGS IN CZECH REPUBLIC VYUŽITÍ DNA MIKROSATELITŮ POUŽÍVANÝCH V PANELU NA URČOVÁNÍ

Více

ALLELE FREQUENCY OF KIT GENE ASSOCIATED WITH TOBIANO SPOTTING PATTERN IN PAINT HORSE BREED

ALLELE FREQUENCY OF KIT GENE ASSOCIATED WITH TOBIANO SPOTTING PATTERN IN PAINT HORSE BREED ALLELE FREQUENCY OF KIT GENE ASSOCIATED WITH TOBIANO SPOTTING PATTERN IN PAINT HORSE BREED FREKVENCE ALEL GENU KIT ASOCIOVANÉHO SE STRAKATOSTÍ TOBIANO U KONÍ PLEMENE PAINT HORSE Chalupová P., Déduchová

Více

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Biologie. Mezipředmětové

Více

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI INDUKOVANÉ PŮSOBENÍM ORGANICKÝCH LÁTEK Z PRACHOVÝCH ČÁSTIC V OVZDUŠÍ Kateřina Hanzalová Oddělení genetické ekotoxikologie Ústav experimentální medicíny AV ČR v.v.i.

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

CVD-T StripAssay. Kat. číslo 4-360. 20 testů 2-8 C

CVD-T StripAssay. Kat. číslo 4-360. 20 testů 2-8 C CVD-T StripAssay Kat. číslo 4-360 20 testů 2-8 C Popis stripu Pracovní postup Izolace DNA Použijte čerstvou nebo zmraženou krev s EDTA nebo citrátem, jako antikoagulans, vyhněte se krvi s obsahem heparinu.

Více

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských

Více

PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER

PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER Trojan V., Hanáček P., Havel L. Department of Plant Biology, Faculty of Agronomy, Mendel University of Agriculture and Forestry in Brno, Zemedelska

Více

Polymorfismus délky restrikčních fragmentů

Polymorfismus délky restrikčních fragmentů Polymorfismus délky restrikčních fragmentů Princip: Chemikálie: PCR produkt z předchozího praktického cvičení Endonukleáza KpnI 10 U μl -1 Pufr pro KpnI 10 koncentrovaný (Tris-HCl 100 mmol l -1 ph 7,5,

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery ve šlechtění rostlin Petr Smýkal Katedra botaniky, PřF UPOL 1. Mikrosatelitní markery

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny

Více

Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219.

Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219. Vzdělávací materiál vytvořený v projektu OP VK Název školy: Gymnázium, Zábřeh, náměstí Osvobození 20 Číslo projektu: Název projektu: Číslo a název klíčové aktivity: CZ.1.07/1.5.00/34.0211 Zlepšení podmínek

Více

DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod.

DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. Od 1.1.2014 DYNEX jediným OFICIÁLNÍM (autorizovaným) distributorem společnosti

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 10 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 26.06.2014 Ročník: 6AF, 6BF Anotace DUMu: Procesy následující bezprostředně po transkripci.

Více

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno urban@mendelu.cz htt://www.mendelu.cz/af/genetika/ Seminář doktorského grantu 53/03/H076 : Molekulárn

Více

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH RÁMCOVÝ VZDĚLÁVACÍ PROGRAM PRO ZÍSKÁNÍ SPECIALIZOVANÉ ZPŮSOBILOSTI v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH 1. Cíl specializačního vzdělávání Cílem specializačního vzdělávání

Více

Molekulární základ dědičnosti

Molekulární základ dědičnosti Molekulární základ dědičnosti Dědičná informace je zakódována v deoxyribonukleové kyselině, která je uložena v jádře buňky v chromozómech. Zlomovým objevem pro další rozvoj molekulární genetiky bylo odhalení

Více

Sure-MeDIP I. with magnetic beads and MNase. www.krd.cz

Sure-MeDIP I. with magnetic beads and MNase. www.krd.cz Sure-MeDIP I with magnetic beads and MNase www.krd.cz 1 Obsah soupravy a skladování MeDIP souprava obsahuje reagencie na provedení 25 reakcí. Souprava je rozdělen do dvou částí, jedna je distribuována

Více