Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Rozměr: px
Začít zobrazení ze stránky:

Download "Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354"

Transkript

1 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

2 Genomika (KBB/GENOM)

3 SNPs Odvozování a genotyping Ing. Hana Šimková, CSc.

4 Cíl přednášky - seznámení s problematikou hledání SNP, odvozování SNP markerů a charakterizací genotypu (genotyping) Klíčová slova - SNP markery, SNP genotyping, resekvenování, sekvenování pomocí hybridizace, heteroduplexy, minisekvenační metody, metody založené na fluorogenních systémech, Illumina GoldenGate Assay

5 SNP A GENOTYPING Objevování SNP A) resekvenováním - SNP se nacházejí na základě porovnávání sekvencí získaných z různých jedinců, genotypů, linií 1. Identifikace SNP srovnáním celogenomové sekvence s cdna sekvencemi v GenBank srovnáním ESTů v databázích s využitím statistických programů (např. PolyBayes odhaluje nepravé SNP) srovnáním genomových sekvencí z různých jedinců 2. Ověření SNP resekvenováním úseku DNA kolem SNP z jedinců metodami používanými pro genotyping

6 Resekvenování cílových oblastí NimbleGen Sequence capture - zachycení cílových sekvencí ze vzorků fragmentované genomické DNA hybridizací na mikročip - na mikročipu naneseny sondy pro cílové oblasti - např. exony nebo oblasti vykazující asociaci s chorobami - odmytí nenavázaných fragmentů - vymytí a amplifikace zachycených fragmentů - osekvenování pomocí technologie 454 Mikročipy vyráběny na zakázku - sestava sekvencí dle přání zákazníka - až 5 Mb sekvencí

7 B) nalezením polymorfismů bez sekvenování a) metody vycházející ze specifických vlastností heteroduplexní DNA (= dvouřetězcová DNA, kde každý řetězec nese jinou alelu, vytváříme ji in vitro) je méně stabilní než homoduplex, dříve denaturuje - vzniká po PCR amplifikaci studovaného lokusu, následované denaturací a renaturací tvorba homoduplexů a heteroduplexů DHPLC (denaturující HPLC) produkty PCR po renaturaci se nanesou na chromatografickou kolonu, eluce fragmentů za pomoci organického rozpouštědla. Heteroduplexy jsou pomalejší. DGGE (denaturující gradientová gelová elektroforéza) na polyakrylamidovém gelu s denaturačním gradientem (močovina). Heteroduplexy denaturují dříve zpomalí se. TILLING (cíleně indukovaná lokální léze v genomech)

8 TILLING (targeting induced local lesions in genomes) - k detekci SNP (EcoTILLING) a indukovaných mutací (TILLING) Založena na schopnosti nukleáz specifických pro jednořetězce štěpit heteroduplexy. Hledání polymorfismu (SNP) mezi jedinci s normálním (N) a mutantním (M) fenotypem: - z obou se naizoluje DNA, pomocí PCR se naamplifikuje určitý úsek (gen), smíchá se, zdenaturuje. Při renaturaci se tvoří jednak homoduplexy (pro N i M genotyp), jednak heteroduplexy. Ty jsou v místě nesouladu (mismatch) roštěpeny nukleázou na sekvenátoru u heteroduplexu místo 1 fragmentu 2. Pro hlavní modelové organismy se připravují kolekce primerů pro všechny lokusy v genomu umožní proskrínovat polymorfismy v celém genomu. EcoTILLING nebo nebo Denaturace, zchlazení Normální Mutant Heteroduplex Analýza na PA gelu nebo sekvenátoru Gibson a Muse, 2004

9 b) metoda založená na detekci heterozygotů SSCP (single-stranded conformation polymorphism) analýza = polymorfismus konformace jednořetězců DNA zdenaturována a nanesena na nedenaturační polyakrylamidový gel. Elektroforéza při 4 C DNA nerenaturuje, ale tvoří intramolekulární sekundární struktury. Každé vlákno jiná sekundární struktura (konformace). Řetězec W AA aa Aa Denaturace formamidem a teplem Řetězec C Homozygot 2 konformace 2 proužky na elektroforéze Heterozygot 4 konformace 4 proužky na elektroforéze Nižší kapacita, fragmenty jen do 400 bp Gibson a Muse, 2004

10 SNP genotyping - charakterizace genotypů pomocí SNP A) Low-tech metody ASO (alelově specifická oligohybridizace) - cílová sekvence amplifikována z jednotlivců v 96-jamkových miskách přenos na membránu, hybridizace s krátkými oligonukleotidy (15-bp) za velmi přísných podmínek signál jen při 100% komplementaritě PCR-RFLP - amplifikace specifického fragmentu pomocí PCR + štěpení produktu restriktázou (zachytí SNP v rekogničním místě) = CAPS Gibson a Muse, 2004

11 dcaps (vytvořené štěpitelné amplifikované polymorfní sekvence) Amplifikace + štěpení. PCR primer navržen tak, že pro jednu z alel (A) se za použití speciálního primeru vytvoří rekogniční místo pro restriktázu po štěpení restriktázou vzniká pro alelu A fragment o něco kratší Alela T Dlouhý produkt Alela A Štěpený produkt Gibson a Muse, 2004

12 B) Minisekvenační metody - sekvenuje se pouze 1 nebo několik nukleotidů SBE (prodloužení jedné báze) - prodloužení 3 konce primeru o jediný nukleotid ddntp (ukončí reakci) je fluorescenčně značený. Primer se váže svým 3 koncem 1 bázi před SNP místo. Multiplexing - jako templát slouží produkty multiplexní PCR (naamplifikované fragmenty DNA pro několik různých SNP). Reakce může probíhat - na čipu (primery fixovány) - v roztoku k rozlišení jednotlivých SNP: a) primery různých délek b) vychytání produktů SBE na mikrokuličky na základě zip kódu pro jednotlivé primery SBE na čipu Gibson a Muse, 2004 (amplifikace analyzovaných lokusů) Izolace cílové ssdna zachycením na kuličky se streptavidinem SBE v roztoku

13 ad b) vychytání produktů SBE na mikrokuličky -kuličky separovány průtokovým cytometrem na základě barevného kódu (viz přednáška Analýza exprese) -kuličky fixovány na arrayi (viz Illumina genotyping) c) K separaci jednotlivých produktů SBE lze místo fluorescence použít hmotnostní spektrometrie MALDI-TOF do reakce přidán jen jeden typ ddntp (+ ostatní dntps) pokud odpovídá variantě v SNP, reakce se ukončí hned, jinak až po několika nukleotidech. MALDI-TOF rozliší oba typy produktů podle velikosti, případně náboje. Lze provádět paralelně analýzu 384 vzorků.

14 Pyrosekvenování -může se provádět v 96-jamkových mističkách. Detekce v reálném čase. Může určit také frekvenci výskytu alely ve studované populaci semikvantitativní metoda. A A A Gibson a Muse, 2004

15 C) Homogenní metody založené na fluorogenních barvičkách Homogenní testy v 1 reakci v roztoku (spojení amplifikace s genotypingem). Založeny na a) ASO a použití 2 fluorescenčních barviček s překrývajícími se spektry reportér (R) a zhášeč (Q) detekovány v průběhu PCR (v misce, kapiláře). Pokud jsou v těsné blízkosti (např. 2 konce krátkého oligonukleotidu), není detekována fluorescence reportéru TaqMan 5 exonukleázový test využívá exonukleázové aktivity Taq polymerázy (při extenzi nového řetězce postupně odbourává sondu fluorescence) Molekulární majáky (Molecular beacons - MB) - majáky jsou alelově specifické oligonukleotidy obklopené krátkými inverzními repeticemi vzniká vlásenka se smyčkou R a Q blízko sebe nevzniká fluorescence. Po 100% hybridizaci na templát se R a Q dostanou od sebe vzniká fluorescence (může být alelově specifická) Do reakce sondy pro obě alely SNP (s 2 různými barvičkami) + primery pro amplifikaci lokusu SNP Gibson a Muse, 2004

16 b) alelově specifické ligaci a přenosu energie fluorescenční rezonancí (FRET) DOL (dye-labeled oligonucleotide ligation assay). Donor v dostatečné blízkosti stimuluje fluorescenci reportéru. SNP Gibson a Muse, 2004 Do reakce - polymeráza - primery + 3 oliga (2 různě značené sondy pro 2 alely SNP) - termostabilní ligáza PCR nejprve při vyšší, pak nižší T a (k nasednutí sond)

17 c) rozdílech v teplotě tání amplikonů HRM analýza (high-resolution melting analysis) Vybraný lokus je amplifikován, vzniklá dsdna se nabarví fluorescenční barvičkou interkalátor fluorescence jen dokud je DNA dvouřetězcová Real-time PCR fluorescence je měřena křivka teploty tání (high-resolution melting curve) Pomalá denaturace amplikonu Rozdíl jediného nukleotidu mění tvar křivky Lze rozlišit heterozygota od obou typů homozygotů

18 Illumina vysokokapacitní metoda k určení genotypu na velkém souboru SNP (v krátkém čase a za rozumnou cenu).

19 Co to vlastně Illumina je? Je to systém kombinující několik komponentů: - miniaturizovanou array jednotlivých arrayí (Sentrix Array Matrix) - konfokální skenr s vysokým rozlišením (BeadArray Reader) - vysoce multiplexní analýza genotypu (GoldenGate Assay)

20 Jak vypadá Sentrix Array Matrix? Tvoří ji : 96 miniaturních arrayí (každá o průměru 1,2 mm) uspořádaných do matrice 8x12. každá array je tvořena cca optickými vlákny spojenými do svazku každé má na konci jamku a v ní kuličku o průměru 3 µm na každé kuličce je kovalentně navázáno několik stejných oligonukleotidů (=illumicode=adresa) illumicode #561 /\/\/\/ illumicode #217 /\/\/\/ illumicode #1024 /\/\/\/

21 Jednomu analyzovanému SNP lokusu odpovídá 1 typ kuličky určený specifickým illumi kódem (adresou). Analyzuje se až 1536 lokusů, v každé miniarrayi máme tedy 1536 typů kuliček, každý typ cca 30x. Na 96 miniarrayích jedné Sentrix Array Matrix analyzujeme současně 96 vzorků DNA.

22 Jak probíhá vlastní analýza genotypu? GoldenGate Assay 1) Upevnění genomické DNA na paramagnetické kuličky a její denaturace Biotin

23 2) Allelově specifická extenze a ligace - pro každý lokus navrženy 3 oligonukleotidy: 2 z 5 konce, liší se polymorfním nukleotidem na konci 1 z 3 konce charakterizuje lokus a obsahuje illumicode adresu Genomová DNA [T/C] [T/A] Universal PCR Sequence 1 Universal PCR Sequence 2 A G illumicode Address Universal PCR Sequence 3

24 ad 2) Allelově specifická extenze a ligace Genomová DNA [T/C] Ligase [T/A] Polymerase Universal PCR Sequence 1 Universal PCR Sequence 2 A G illumicode Address Universal PCR Sequence 3

25 3) Amplifikace+inkorporace fluorescenční barvičky Amplifikace templátu PCR s univerzálními primery Cy3 Universal Primer 1 Cy5 Universal Primer 2 A illumicode #561 Universal Primer P3

26 4) Hybridizace na univerzální IllumiCode TM Array illumicode #561 /\/\/\/ illumicode #217 /\/\/\/ illumicode #1024 A/A T/T A/T /\/\/\/

27 4) Odečtení výsledků (BeadArray Reader) a interpretace získaných dat

28 Jak se získaná data využívají? Pro rozsáhlé asociační mapování, které může odhalit genetický základ komplexních dědičných chorob Pro konstrukci genetických map Konsensuální genetická mapa ječmene získaná z 3 DH mapovacích populací na základě Pilot Oligo Pool Assay (OPA1) Mapovací populace - celkem 480 jedinců 1536 SNP genotypováno současně $68,000 za 480 vzorků (5 x 96) 737,280 genotype calls za 3-4 dny 9.2 cents za data-point Při větším počtu vzorků nižší náklady

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování

Více

Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp.

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp. BIOLOGICKÉ LISTY 68 (3): 207-211, 2003 Způsoby detekce polymorfismu homologních DNA a jejich využití při studiu změn ve struktuře rodičovských genomů u modelových allotetraploidních druhů rodu Nicotiana

Více

Genotypování markerů užitkovosti a zdraví u skotu

Genotypování markerů užitkovosti a zdraví u skotu Mezinárodní odborný seminář Využití chovatelských dat onemocnění skotu pro management stád, šlechtění a pro racionální užívání antimikrobik. Genotypování markerů užitkovosti a zdraví u skotu Jitka Kyseľová

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Fyzické mapování Fyzické kontigové mapy Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s konstrukcí

Více

Sekvenování nové generace. Radka Reifová

Sekvenování nové generace. Radka Reifová Sekvenování nové generace Radka Reifová Prezentace ke stažení www.natur.cuni.cz/zoologie/biodiversity v záložce Přednášky 1. Přehled sekvenačních metod nové generace 2. Využití sekvenačních metod nové

Více

Single nucleotide polymorphisms (SNPs)

Single nucleotide polymorphisms (SNPs) Single nucleotide polymorphisms (SNPs) A/A G/G Single nucleotide polymorphisms (SNPs) SNPs : nuclear genome (consensus) Proč nestačí jednoduše osekvenovat mtdna? Introgrese mtdna Myotis myotis - Evropa

Více

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR)

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

Metody studia genové exprese

Metody studia genové exprese Metody studia genové exprese Ing. Lucie Němcová, Ph.D. Laboratoř vývojové biologie nemcova@iapg.cas.cz Transkriptom Genová exprese: Geny jsou exprimovány tehdy, jsou-li přepsány do RNA (mrna). Rozdílná

Více

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou

Více

Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin

Více

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Modifikace PCR, sekvenování Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Multiplex PCR Reakční směs obsahuje ne jeden, ale několik párů primerů rozpoznávajících různé cílové sekvence

Více

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)

Více

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray

Více

Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění

Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění Klin. Biochem. Metab., 14 (35), 2006, No. 2, p. 89 95. Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění Gojová L., Kozák L. Centrum molekulární biologie a genové terapie, Fakultní

Více

Elektroforéza nukleových kyselin. Molekulární biologie v hygieně potravin 2, 2014/15, Ivo Papoušek

Elektroforéza nukleových kyselin. Molekulární biologie v hygieně potravin 2, 2014/15, Ivo Papoušek Elektroforéza nukleových kyselin Molekulární biologie v hygieně potravin 2, 2014/15, Ivo Papoušek Elektroforéza Patří mezi nejpoužívanější separační techniky při izolaci a analýze nukleových kyselin (X

Více

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního

Více

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika

Více

Vícefunkční chemické a biochemické mikrosystémy Strana 1. Mikrofluidní bioaplikace

Vícefunkční chemické a biochemické mikrosystémy Strana 1. Mikrofluidní bioaplikace Vícefunkční chemické a biochemické mikrosystémy Strana 1 Mikrofluidní bioaplikace Vícefunkční chemické a biochemické mikrosystémy Strana 2 Mikrofluidní aplikace pro bioanalýzu Transport, dávkování, promíchávání

Více

Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky

Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky Biotechnologický kurz Biotechnologický kurz III. letní škola metod molekulární biologie nukleových kyselin a genomiky 18. - 22. 6. 2012 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně

Více

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce

Více

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky.

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální

Více

Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace

Více

ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN

ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN Fragmenty nukleových kyselin lze dle jejich velikosti rozdělit elektroforézou. Elektroforéza využívá rozdílné pohyblivosti jednotlivých fragmentů, danou právě

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace Genetické markery Genetické markery

Více

PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ

PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ 10 SEZNAM PŘÍLOH PŘÍLOHA č. 1 SEZNAM ZKRATEK A MYSLIVECKÝCH A GENETICKÝCH POJMŮ PŘÍLOHA č. 2 MAPY Mapa 1 Lokalizace zájmového území (zdroj: Mapy.cz) Mapa 2 Místa odlovených nebo uhynulých kusů (zdroj:

Více

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Moderní metody pro studium diverzity a evoluce rostlin Hana Šimková Ekologie

Více

BioArray Molecular. Graham Smallridge, Immucor Prague November 2013

BioArray Molecular. Graham Smallridge, Immucor Prague November 2013 BioArray Molecular Immunohaematology Graham Smallridge, Immucor Prague November 2013 1 BioArray Solutions BioArray Solutions Ltd. Bylo založeno ve městě Warren, New Jersey, (USA) v roce 1997 skupinou vědeckých

Více

Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI INDUKOVANÉ PŮSOBENÍM ORGANICKÝCH LÁTEK Z PRACHOVÝCH ČÁSTIC V OVZDUŠÍ Kateřina Hanzalová Oddělení genetické ekotoxikologie Ústav experimentální medicíny AV ČR v.v.i.

Více

Písemná zpráva zadavatele

Písemná zpráva zadavatele Písemná zpráva zadavatele veřejné zakázky zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, ve znění účinném ke dni zahájení zadávacího řízení (dále jen ZVZ ). Veřejná zakázka Název: Ostatní

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky

Více

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC 1 Výrobce Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC Tento návod k použití si důkladně přečtěte před použitím tohoto produktu. Uschovejte si tento návod k použití,

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,

Více

Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů

Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů Ústav experimentální medicíny AV ČR úspěšně rozšířil přístrojové vybavení pro vědce z peněz evropských fondů Ústav úspěšně dokončil realizaci dvou investičních projektů s využitím prostředků z Operačního

Více

Univerzita Palackého v Olomouci. Bakalářská práce

Univerzita Palackého v Olomouci. Bakalářská práce Univerzita Palackého v Olomouci Bakalářská práce Olomouc 2012 Eliška Růžičková Univerzita Palackého v Olomouci Přírodovědecká fakulta Katedra buněčné biologie a genetiky Real-time PCR a jeho využití pro

Více

Ondřej Scheinost Nemocnice České Budějovice, a.s.

Ondřej Scheinost Nemocnice České Budějovice, a.s. Ondřej Scheinost Nemocnice České Budějovice, a.s. Nové technologie přelomové období principy technologií klinická použitelnost chips (arrays) sekvenační technologie Důležitost genetických informací i další

Více

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Kamila Zdeňková Transgenní rostliny, tj. takové rostliny, do jejichž dědičného základu byly metodami genového inženýrství

Více

Návod k použití CRC RAScan Combination Kit

Návod k použití CRC RAScan Combination Kit Návod k použití CRC RAScan Combination Kit Souprava SURVEYOR Scan KRAS a NRAS Exons 2, 3 & 4 CE IVD se systémy Tento návod k použití si důkladně přečtěte před použitím tohoto produktu. Uschovejte si tento

Více

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases

Více

Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka

Více

FUNKČNÍ VARIANTA GENU ANXA11 SNIŽUJE RIZIKO ONEMOCNĚNÍ

FUNKČNÍ VARIANTA GENU ANXA11 SNIŽUJE RIZIKO ONEMOCNĚNÍ FUNKČNÍ VARIANTA GENU ANXA11 SNIŽUJE RIZIKO ONEMOCNĚNÍ SARKOIDÓZOU: POTVRZENÍ VÝSLEDKŮ CELOGENOMOVÉ ASOCIAČNÍ STUDIE. Sťahelová A. 1, Mrázek F. 1, Kriegová E. 1, Hutyrová B. 2, Kubištová Z. 1, Kolek V.

Více

Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická

Více

5. Sekvenování, přečtení genetické informace, éra genomiky.

5. Sekvenování, přečtení genetické informace, éra genomiky. 5. Sekvenování, přečtení genetické informace, éra genomiky. Minulá přednáška nastínila zrod molekulární biologie a představila některé možnosti, jak pracovat s DNA - jak ji analyzovat na základě velikosti

Více

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.:

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.: Yi TPMT Diagnostická souprava Návod k použití Výrobce: YBUX s.r.o. Haasova 27 Brno 616 00 Česká republika IČ 63487951 tel.: +420 541 423 710 e-mail: ybux@ybux.eu Název: Yi TPMT Popis: Diagnostická souprava

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

Izolace nukleových kyselin

Izolace nukleových kyselin Izolace nukleových kyselin Požadavky na izolaci nukleových kyselin V nativním stavu z přirozeného materiálu v dostatečném množství požadované čistotě. Nukleové kyseliny je třeba zbavit všech látek, které

Více

Systém pro kvantitativní multiplex amplifikaci DNA PLEXAMP KIT. PXT5 Detekce genomové přestavby genu BRCA2 NÁVOD K POUŽITÍ

Systém pro kvantitativní multiplex amplifikaci DNA PLEXAMP KIT. PXT5 Detekce genomové přestavby genu BRCA2 NÁVOD K POUŽITÍ Systém pro kvantitativní multiplex amplifikaci DNA PLEXAMP KIT PXT5 Detekce genomové přestavby genu BRCA2 NÁVOD K POUŽITÍ REFERENCE: PXT5-01.01.25: 25 testů PXT5-01.01.50: 50 testů PXT5-01.01.100: 100

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery ve šlechtění rostlin Petr Smýkal Katedra botaniky, PřF UPOL 1. Mikrosatelitní markery

Více

MOLEKULÁRNÍ TAXONOMIE - 4

MOLEKULÁRNÍ TAXONOMIE - 4 MOLEKULÁRNÍ TAXONOMIE - 4 V této přednášce si představíme metody, které získávají molekulární znaky bez použití sekvenace. Všechny tyto metody je teoreticky možné sekvenací nahradit. Oproti sekvenaci celých

Více

Mikročipy v mikrobiologii

Mikročipy v mikrobiologii Mikročipy v mikrobiologii doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 Obsah přednášky 1) Charakteristika biočipů, DNA microarrays a DNA chip 2) Výroba čipů, charakteristika

Více

Verze: 1.2 Datum poslední revize: 24.9.2014. Nastavení real-time PCR cykleru. Light Cycler 480 Instrument. (Roche) generi biotech

Verze: 1.2 Datum poslední revize: 24.9.2014. Nastavení real-time PCR cykleru. Light Cycler 480 Instrument. (Roche) generi biotech Verze: 1.2 Datum poslední revize: 24.9.2014 Nastavení real-time PCR cykleru Light Cycler 480 Instrument (Roche) generi biotech OBSAH 1. Nastavení teplotního profilu...3 1.1. Nastavení nového teplotního

Více

VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ

VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ Lucie Vištejnová 2, Jan Hodek 1, Patrik Sekerka 2, Jaroslava Ovesná 1, Kateřina Demnerová 2 1. Výzkumný ústav rostlinné výroby, Drnovská 507,

Více

Genetická kartografie

Genetická kartografie Genetická kartografie Vazba U klasického dihybridismu podle Johanna Gregora Mendela segregují různé alely dvou genů nezávisle. Rekapitulace dihybridismu je na obrázku 8.1. Toto schéma platí jen pro lokusy

Více

Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich

Více

TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně

Více

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin Část Molekulární biologie a imunologie 6. Základy dědičnosti Mendelovská dědičnost (autozomálně recesivní, autozomálně dominantní a X-vázaný přenos mutací). Nemendelovská dědičnost (uniparentální disomie,

Více

Molekulární metody ve studiích kořenových systémů. Jiří Košnar, 2016

Molekulární metody ve studiích kořenových systémů. Jiří Košnar, 2016 Molekulární metody ve studiích kořenových systémů Jiří Košnar, 2016 Úvod Řešení otázek: identifikace (barcoding) a kvantifikace rostlinných druhů ve společenstvu identifikace (barcoding) a kvantifikace

Více

Principy a využit. ití qpcr. KBC/BAM Pokročil. rní biologie

Principy a využit. ití qpcr. KBC/BAM Pokročil. rní biologie Principy a využit ití qpcr KBC/BAM Pokročil ilé biochemické a biotechnologické metody Mgr. Mária M Šmehilová, Ph.D. UP PŘF CRH Oddělen lení molekulárn rní biologie Úvod do PCR PCR - 1984 Kary Mullis (Nobelova

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi

Více

ODLIŠENÍ ODRŮD PŠENICE OBECNÉ TRITICUM AESTIVUM L. METODOU RAPD

ODLIŠENÍ ODRŮD PŠENICE OBECNÉ TRITICUM AESTIVUM L. METODOU RAPD ODLIŠENÍ ODRŮD PŠENICE OBECNÉ TRITICUM AESTIVUM L. METODOU RAPD Distinguishing of Wheat Varieties (Tritium aestivum L.) by Method RAPD Zuzana Kohutová, Zuzana Kocourková, Hana Vlastníková, Petr Sedlák

Více

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno urban@mendelu.cz htt://www.mendelu.cz/af/genetika/ Seminář doktorského grantu 53/03/H076 : Molekulárn

Více

Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární

Více

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK Richard Prùša Richard Prùša Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK . Základy analytických metod v klinické molekulární biologii Richard Prùša Praha 1997 Základy analytických metod

Více

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

První testový úkol aminokyseliny a jejich vlastnosti

První testový úkol aminokyseliny a jejich vlastnosti První testový úkol aminokyseliny a jejich vlastnosti Vysvětlete co znamená pojem α-aminokyselina Jaký je rozdíl mezi D a L řadou aminokyselin Kolik je základních stavebních aminokyselin a z čeho jsou odvozeny

Více

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení

Více

KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR)

KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) Metoda Real-time PCR slouží pro kvantifikaci DNA a transkripce. Metoda je založena na klasické PCR, ovšem s využitím speciálního cycleru, který v průběhu PCR

Více

variabilita genomu bottleneck Nature Science

variabilita genomu bottleneck Nature Science variabilita genomu Nature Science genetická diverzita člověka na úrovni SNP je nízká: asi 0.1% cca. 90% variace je uvnitř populací cca. 10% mezi populacemi (kontinenty) bottleneck personal genomes James

Více

velké fragmenty střední fragmenty malé fragmenty

velké fragmenty střední fragmenty malé fragmenty velké fragmenty střední fragmenty malé fragmenty Southern 1975 Northern Western denaturace DNA hybridizace primerů (annealing) (mají délku kolem 20 bází) syntéza nové DNA termostabilní polymerázou vstup

Více

nastavení real-time PCR cykleru Rotor Gene 3000

nastavení real-time PCR cykleru Rotor Gene 3000 Verze: 1.4 Datum poslední revize: 25. 3. 2015 nastavení real-time PCR cykleru Rotor Gene 3000 (Corbett Research) generi biotech OBSAH: 1. Nastavení teplotního profilu a spuštění cykleru... 3 2. Zadání

Více

Elektroforéza Sekvenování

Elektroforéza Sekvenování Elektroforéza Sekvenování Výsledek PCR Elektroforéza V molekulární biologii se používá k separaci nukleových kyselin a bílkovin Principem je pohyb nabitých molekul v elektrickém poli Gelová, polyakrylamidová

Více

Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová

Enterotoxiny Staphylococcus aureus. Jana Kotschwarová Andrea Koťová Enterotoxiny Staphylococcus aureus Jana Kotschwarová Andrea Koťová Obsah Charakteristika Staphylococcus aureus Vlastnosti Faktory virulence Enterotoxiny Patogeneze Výskyt Metody stanovení Prevence výskytu

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

Genetické mapování. v přírodních populacích i v laboratoři

Genetické mapování. v přírodních populacích i v laboratoři Genetické mapování v přírodních populacích i v laboratoři Funkční genetika Cílem je propojit konkrétní mutace/geny s fenotypem Vzniklý v laboratoři pomocí mutageneze či vyskytující se v přírodě. Forward

Více