Detekce Leidenské mutace

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Detekce Leidenské mutace"


1 Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků

2 Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky restrikční fragmenty biologický význam: ochrana bakterií před cizí DNA (bakteriofágy, plazmidy) vlastní DNA je chráněna metylací v restrikčním místě rozpoznávají specifické sekvence (restrikční místa) vdna a DNA v nich štěpí restrikční místa dlouhá asi 4-8 nukleotidů, často mají charakter palindromů (obrácených repetic) označování: EcoRI podle rodového, respektive druhového jména organismu, ze kterého restriktasa pochází, např. Escherichia coli pořadové číslo označení kmene 5 - GAATTC CTTAAG-5

3 Palindrom -je jakákoliv sekvence symbolů -slovo, věta, číslo, sekvence DNA, kterou lze číst zprava doleva nebo zleva doprava a má vždy stejnývýznam nezařazen, Anna, Kuna nese nanuk, Palindrom v genetice sekvence NK (DNA nebo RNA), která je stejná pokud se čte od 5 konce k 3 konci jednoho vlákna a od 5 k 3 konci na komplementárním vlákně G A AT TC 3 3 -C T TA AG

4 endonukleázy - štěpí fosfodiesterovou vazbu uvnitř řetězce x exonukleázy - štěpí fosfodiesterovou vazbu od 3 nebo 5 konce (exo)

5 známo asi 3000 restriktáz, asi 600 komerčně dostupných Podle aktivity: I. typu - vyžadují ATP pro štěpení bifunkční enzymy spojující methylacia štěpení štěpí daleko od rozpoznávaného místa II. typu -nejčastěji využívané v genovém inženýrství nevyžadují ATP pro štěpení štěpí přímo v restrikčním místě nebo v jeho bezprostřední blízkosti frekvence štěpení závisí na délce rozeznávané sekvence 4 n III. typu - rozpoznávají dvě nepalindromické sekvence v inverzní orientaci štěpí bází za rozpoznávacím místem IV. typu - štěpí modifikovanou DNA např. methylovanou

6 The Restriction Enzyme Database

7 Štěpení DNA restrikční endonukleázou nástroj ke štěpení a skládání fragmentů DNA do nových celků RE nerozlišují původ DNA jen svoji specifickou sekvenci

8 Příklad


10 Štěpení DNA restrikční endonukleázou EcoRI


12 Využitírestrikčních endonukleas fragmentaci DNA AFLP (Amplified Fragment Length Polymorphism) RFLP (Restriction Fragment Length Polymorphism) STRP (Short Tandem Repeat Polymorphism) při molekulárním klonování fragmentu DNA do vektoru či spojování dvou fragmentů DNA dohromady

13 Využití restrikčních endonukleas k fragmentaci DNA DNA fingerprinting RFLP (Restriction Fragment Length Polymorphism) PCR-RFLP = AFLP (Amplified Fragment Length Polymorphism) STRP (Short Tandem Repeat Polymorphism) při molekulárním klonování fragmentu DNA do vektoru či spojování dvou fragmentů DNA dohromady

14 RE restrikční fragmenty separace pomocí ELFO

15 Rekombinace DNA vložení do bakterie kulfvace klonu



18 Moraxella nonliquefaciens

19 MnlI Moraxella non liquefaciens - atypický RE (restrikční enzym) - rozpoznává tuto sekvenci (asymetrické místo není palindromem): jednonukleotidový přesah -enzym je dodáván ve FastDigestGreen pufru obsahuje: modré barvivo (xylenová modř) rychlost migrace v 1 % agarosovémgelu -3-5 kbdna + žluté barvivo rychlost 10 bpdna

20 Vztah protein C hemokoagulační kaskáda degr. degr.

21 Stanovení Leidenské mutace záměna GA štěpné místo pro restrikční enzym MnlIchybí úsek DNA zůstává vcelku 1.PCR úseku DNA kde nastává mutace a okolí v rozsahu 288 bp 2. štěpení PCR produktu restrikčním enzymem 3. elektroforesa vyštěpených produktů






27 alela Leiden

28 Detekce Faktor V Leiden Fprimer A R primer GAACATGTTAGTTAGGTCTCTGGCTA 158bp 130bp 93bp 37 bp délka PCR produktu 288 bp

29 Stanovení Leidenské mutace pomocí PCR RFLP 158 bp bp 3 5 alela normální 3 restrikční endonukleasa MnlI 158 bp 130 bp 5 alela Leiden

30 Elektroforéza 3 % agarózovýgel s TAE pufrem Agaróza z mořských řas, lineární polysacharid (D-gal a L-gal)


32 + -

33 Elektroforéza 3 % agarózovýgel s TAE pufrem Agaróza z mořských řas, lineární polysacharid (D-gal a L-gal)

34 DNA marker směs purifikovaných DNA fragmentů je dodáván s nanášecím pufrem Loading Dye: - bromphenol blue barva, lepší orientace na gelu - glycerol zvyšuje hustotu vzorku -rychlost migrace na gelu přibl. 500 bp + - modré barvivo (xylenová modř)- rychlost migrace 3-5 kb TAE pufr 3 % agarosegel

35 Nanášení vzorků na gel

36 Nanášení vzorků na gel

37 Připojení k elektrickému zdroji Dělení - +

38 Dělení - +

39 Ukončení elektroforézy odpojení od zdroje elektrického napětí, vyjmutí gelu z elektroforetické vany Dělení - +

40 Ethidium bromid


42 158 bp bp 3 5 restrikční endonukleasa MnlI bp 130 bp alela normální alela Leiden 158bp 130bp 93bp 37 bp

43 Analýza produktů PCR po elektroforese na gelu 100 bp DNA ladder PCR produkt PCR produkt wt / wt Leiden / wt neg. kontrola 300 bp 200 bp 100 bp 288 bp 158 bp 130 bp 93 bp

44 195 (158+37) 158 bp 130 bp 93 bp (37 bp) G/A 2. A /A 3. G/G 158 bp, 130 bp, 93 bp, (37 bp) heterozygot 158 bp, 130 bp homozygot s mutovanou alelou 158 bp, 93 bp, (37 bp) homozygot s normální alelou




Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika


MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,


Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,


Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:


Enzymy používané v molekulární biologii

Enzymy používané v molekulární biologii Enzymy používané v molekulární biologii Rozdělení enzymů 1. Podle substrátové specifity: většina metod molekulární biologie je závislá na použití enzymů, jejichž substrátem jsou nukleové kyseliny. Tyto





Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní


Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin



ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN Fragmenty nukleových kyselin lze dle jejich velikosti rozdělit elektroforézou. Elektroforéza využívá rozdílné pohyblivosti jednotlivých fragmentů, danou právě


Genetické markery - princip a využití

Genetické markery - princip a využití Genetika a šlechtění lesních dřevin Genetické markery - princip a využití Doc. Ing. RNDr. Eva Palátová, PhD. Ing. R. Longauer, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)


Klonování gen a genové inženýrství

Klonování gen a genové inženýrství Klonování gen a genové inženýrství Genové inženýrství užite né termíny Rekombinantní DNA = DNA, ve které se nachází geny nejmén ze dvou zdroj, asto ze dvou zných druh organism Biotechnologie = manipulace


Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


Pulzní gelová elektroforéza Při konvenční gelové elektroforéze je rozdělení molekul je podmíněno rychlejším průchodem menších molekul pórovitou

Pulzní gelová elektroforéza Při konvenční gelové elektroforéze je rozdělení molekul je podmíněno rychlejším průchodem menších molekul pórovitou Pulzní gelová elektroforéza Při konvenční gelové elektroforéze je rozdělení molekul je podmíněno rychlejším průchodem menších molekul pórovitou strukturou gelové matrice. Tento princip separace se uplatňuje



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit


Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk


Kyselina hyaluronová. Kyselina hyaluronová. Streptococcus equi subsp. produkovaná kyselina hyaluronová a. Autor prezentace: Mgr.

Kyselina hyaluronová. Kyselina hyaluronová. Streptococcus equi subsp. produkovaná kyselina hyaluronová a. Autor prezentace: Mgr. Kyselina hyaluronová Streptococcus equi subsp. zooepidemicus a jím produkovaná kyselina hyaluronová a glukuronidáza Marcela Tlustá Biotechnologická laborato Meyer a Palmer, 1934 Extracelulární matrix,



REKOMBINACE Přestavby DNA REKOMBINACE Přestavby DNA variace v kombinacích genů v genomu adaptace evoluce 1. Obecná rekombinace ( General recombination ) Genetická výměna mezi jakýmkoli párem homologních DNA sekvencí - často lokalizovaných



MOLEKULÁRNÍ TAXONOMIE - 4 MOLEKULÁRNÍ TAXONOMIE - 4 V této přednášce si představíme metody, které získávají molekulární znaky bez použití sekvenace. Všechny tyto metody je teoreticky možné sekvenací nahradit. Oproti sekvenaci celých


Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů


Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární


Elektroforéza nukleových kyselin

Elektroforéza nukleových kyselin Elektroforéza nukleových kyselin Elektroforéza nukleových kyselin je založena na tom, že NK jsou v neutrálním nebo zásaditém prostředí polyanionty. Protože se zvyšujícím se počtem nukleotidů v molekule



Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální


14. přednáška z BIOLOGIE pro Bakaláře studující fyzioterapii, optometrii a pro nutriční terapeuty M.Gabriel, BÚ LF MU

14. přednáška z BIOLOGIE pro Bakaláře studující fyzioterapii, optometrii a pro nutriční terapeuty M.Gabriel, BÚ LF MU 14. přednáška z BIOLOGIE pro Bakaláře studující fyzioterapii, optometrii a pro nutriční terapeuty Genová diagnostika. 4. 1. 2012 M.Gabriel, BÚ LF MU Pojem alela. Geny existují v různých formách a mohou



ZÁKLADY BAKTERIÁLNÍ GENETIKY Zdroj rozmanitosti mikrorganismů ZÁKLADY BAKTERIÁLNÍ GENETIKY Různé sekvence nukleotidů v DNA kódují různé proteiny Různé proteiny vedou k různým organismům s různými vlastnostmi Exprese genetické informace


Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Fyzické mapování Fyzické kontigové mapy Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s konstrukcí


Globální pohled na průběh replikace dsdna

Globální pohled na průběh replikace dsdna Globální pohled na průběh replikace dsdna 3' 5 3 vedoucí řetězec 5 3 prodlužování vedoucího řetězce (polymerace ) DNA-ligáza směr pohybu enzymů DNA-polymeráza I DNA-polymeráza III primozom 5' 3, 5, hotový



TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy


Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,


2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících


Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních


Elektroforéza Sekvenování

Elektroforéza Sekvenování Elektroforéza Sekvenování Výsledek PCR Elektroforéza V molekulární biologii se používá k separaci nukleových kyselin a bílkovin Principem je pohyb nabitých molekul v elektrickém poli Gelová, polyakrylamidová



PO STOPÁCH BAKTERIÍ V/KOLEM NÁS PO STOPÁCH BAKTERIÍ V/KOLEM NÁS Jana Spáčilová, UK v Praze, PřF, Katedra buněčné biologie Svět bakterií je nesmírně druhově bohatý a máme ho blíž než před očima. Mikroskopickými metodami můžeme obdivovat



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Termín biotechnologie byl poprvé použit v roce 1917 Procesy, při kterých se na tvorbě výsledného produktu podílejí živé organismy Širší definice: biotechnologie


Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2


Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký

Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký Kapitola 3 Biomolecular Design and Biotechnology Překlad: Jaroslav Krucký Problémy chemie a biologie mohou být velmi nápomocné, jestliže se naše schopnost vidět to, co děláme, a dělat věci na atomární


Elektromigrační metody

Elektromigrační metody Elektromigrační metody Princip metoda využívaná k separaci makromolekul na základě náboje, konformace nebo velikosti migrace nabitéčástice v elektrickém poli je úměrná jejímu celkovému náboji, velikosti


Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava


Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp.

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp. BIOLOGICKÉ LISTY 68 (3): 207-211, 2003 Způsoby detekce polymorfismu homologních DNA a jejich využití při studiu změn ve struktuře rodičovských genomů u modelových allotetraploidních druhů rodu Nicotiana


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání






MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického


Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace laboratorních úloh genetických předmětů metodikami pracujícími s ribonukleovými kyselinami pšenice Metodické návody pro laboratorní


4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 1. Struktura a replikace DNA Literatura: Alberts a kol.: Základy buněčné biologie Espero Publishing, 2000 Garrett & Grisham: Biochemistry 2nd ed., Saunders



MOLEKULÁRNÍ BIOLOGIE I PŘÍPRAVA TKÁNĚ K IZOLACI DNA Cvičení 9,10,11: MOLEKULÁRNÍ BIOLOGIE Jméno: Skupina: Cíl: Seznámení se se základními metodami, využívanými k analýze DNA 1. izolace DNA 2. amplifikace DNA pomocí PCR 3. restrikční štěpení PCR produktu


Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění





Exprese rekombinantních proteinů

Exprese rekombinantních proteinů Exprese rekombinantních proteinů Exprese rekombinantních proteinů je proces, při kterém můžeme pomocí různých expresních systémů vytvořit protein odvozený od konkrétního genu, nebo části genu. Tento protein



VYUŽITÍ AFLP PRO DNA GENOTYPIZACI ROSTLIN RNDr. Jaroslava Ovesná, CSc. Mgr. Jan Hodek VYUŽITÍ AFLP PRO DNA GENOTYPIZACI ROSTLIN METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2007 Metodika byla vypracována pracovníky Národní Referenční


2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou


Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí,

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí, Využití molekulárních markerů v systematice a populační biologii rostlin 12. Shrnutí, Přehled molekulárních markerů 1. proteiny isozymy 2. DNA markery RFLP (Restriction Fragment Length Polymorphism) založené



Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Popis Column DNA Lego Kit je základ moderní stavebnicové (Lego) soupravy pro izolaci čisté DNA různého


První testový úkol aminokyseliny a jejich vlastnosti

První testový úkol aminokyseliny a jejich vlastnosti První testový úkol aminokyseliny a jejich vlastnosti Vysvětlete co znamená pojem α-aminokyselina Jaký je rozdíl mezi D a L řadou aminokyselin Kolik je základních stavebních aminokyselin a z čeho jsou odvozeny


a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy

a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy 1 Nukleové kyseliny Nukleové kyseliny (NK) sice tvoří malé procento hmotnosti buňky ale významem v kódování genetické informace a její expresí zcela nezbytným typem biopolymeru všech živých soustav a)


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců



MODERNÍ BIOFYZIKÁLNÍ METODY: MODERNÍ BIOFYZIKÁLNÍ METODY: POKROČILÉ PRAKTICKÉ VZDĚLÁVÁNÍ V EXPERIMENTÁLNÍ BIOLOGII Operační program Vzdělávání pro konkurenceschopnost Číslo projektu: CZ.1.07/2.3.00/09.0046 Praktický kurz pokročilých


Příprava rekombinantních molekul pro diagnostické účely

Příprava rekombinantních molekul pro diagnostické účely 1 Příprava rekombinantních molekul pro diagnostické účely doc. RNDr. Milan Bartoš, Ph.D. Přírodovědecká fakulta MU, 2014 2 Obsah přednášky 1) Pojem rekombinantní DNA 2) Historické milníky


V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Vysoká škola chemicko-technologická v Praze. Ing. Iva Pacovská Ústav biochemie a mikrobiologie, VŠCHT Praha

Vysoká škola chemicko-technologická v Praze. Ing. Iva Pacovská Ústav biochemie a mikrobiologie, VŠCHT Praha Vysoká škola chemicko-technologická v Praze Ing. Iva Pacovská Ústav biochemie a mikrobiologie, VŠCHT Praha dichlordifenyltrichlormethylmethan Insekticid Bílý krystalický prášek Poprvé syntetizován v roce


Elektromigrační metody

Elektromigrační metody Elektromigrační metody Princip metoda využívaná k separaci makromolekul na základě náboje, konformace nebo velikosti migrace nabité částice v elektrickém poli je úměrná jejímu celkovému náboji, velikosti


Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace Genetické markery Genetické markery


Mumie versus Zombie: na koho si vsadit v případě jaderné katastrofy

Mumie versus Zombie: na koho si vsadit v případě jaderné katastrofy Mumie versus Zombie: na koho si vsadit v případě jaderné katastrofy Čeněk Malík* Tereza Baštová** Marie Dohnalová*** Gymnázium Litoměřická, Litoměřická 726, Praha 9* Gymnázium Česká Lípa, Žitovská 2969,


CENÍK. Restrikční enzymy

CENÍK. Restrikční enzymy CENÍK obchodní divize Forenzní DNA servis, s.r.o. Budínova 2, 180 81 Praha 8, CZE tel/fax: 233 931 123, GSM: 731 503 250 e-mail: Cena chlazených a mražených produktů neobsahuje dopravné


Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 5. Metody molekulární biologie II DNA footprinting hledání interakcí DNA s proteiny Polymerázová řetězová reakce (Polymerase chain reaction PCR) Malé


Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014 Molekulárně biologické metody v mikrobiologii Mgr. Martina Sittová Jaro 2014 Harmonogram 1. den Izolace DNA 2. den Měření koncentrace DNA spektrofotometricky, real-time PCR 3. den Elektroforéza Molekulární


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Vztah struktury a funkce nukleových kyselin. Replikace, transkripce

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Vztah struktury a funkce nukleových kyselin. Replikace, transkripce Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Vztah struktury a funkce nukleových kyselin. Replikace, transkripce Nukleová kyselina gen základní jednotka informace v živých systémech,


Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje


TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně


Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží


ÚLOHA C Klonování PCR produktu do plasmidu

ÚLOHA C Klonování PCR produktu do plasmidu Jméno a učo: Datum: ÚLOHA C Klonování PCR produktu do plasmidu TEORETICKÝ ÚVOD Při klonování PCR produktů do plasmidů se využívá vlastnosti Taq polymerasy, a jiných non-proofreading polymeras, přidávat


Elektroforéza nukleových kyselin. Molekulární biologie v hygieně potravin 2, 2014/15, Ivo Papoušek

Elektroforéza nukleových kyselin. Molekulární biologie v hygieně potravin 2, 2014/15, Ivo Papoušek Elektroforéza nukleových kyselin Molekulární biologie v hygieně potravin 2, 2014/15, Ivo Papoušek Elektroforéza Patří mezi nejpoužívanější separační techniky při izolaci a analýze nukleových kyselin (X



KURZ ZÁKLADNÍCH METOD MOLEKULÁRNÍ BIOLOGIE EKOTECH KURZ ZÁKLADNÍCH METOD MOLEKULÁRNÍ BIOLOGIE Biologické centrum AV ČR, České Budějovice Lektoři: Radmila Čapková Frydrychová Miroslava Sýkorová Jindra Šíchová Václav Brož OBSAH STR. PŘÍPRAVA ROZTOKŮ.


Hybridizace. doc. RNDr. Milan Bartoš, Ph.D.

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. Hybridizace doc. RNDr. Milan Bartoš, Ph.D. Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi


Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem



MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Určování a ověřování paternity u koní. Bakalářská práce Brno 2006 Vedoucí bakalářské


Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská


Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů


DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod.

DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. Od 1.1.2014 DYNEX jediným OFICIÁLNÍM (autorizovaným) distributorem společnosti


Molekulární základ dědičnosti

Molekulární základ dědičnosti Molekulární základ dědičnosti Dědičná informace je zakódována v deoxyribonukleové kyselině, která je uložena v jádře buňky v chromozómech. Zlomovým objevem pro další rozvoj molekulární genetiky bylo odhalení


Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o.

Genetické markery. pro masnou produkci. Mgr. Jan Říha. Výzkumný ústav pro chov skotu, s.r.o. Genetické markery ve šlechtění skotu pro masnou produkci Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Genetické markery Polymorfní místa v DNA, které vykazují asociaci na sledované znaky Příčinné





Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Čtvrtek 11:30 13:00 1. Struktura a replikace DNA (25.09.2014, Mgr. M. Čudejková, Ph.D) 2. Metody molekulární biologie I (09.10.2014, Doc. Mgr. P. Galuszka, Ph.D)



VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ Lucie Vištejnová 2, Jan Hodek 1, Patrik Sekerka 2, Jaroslava Ovesná 1, Kateřina Demnerová 2 1. Výzkumný ústav rostlinné výroby, Drnovská 507,


Identifikace mikroorganismů pomocí sekvence jejich genu pro 16S rrna

Identifikace mikroorganismů pomocí sekvence jejich genu pro 16S rrna Praktická úloha Identifikace mikroorganismů pomocí sekvence jejich genu pro 16S rrna Pro spolehlivou identifikaci mikroorganismů pomocí genetických metod se velmi často využívá stanovení nukleotidové sekvence


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního


Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu

Tok GI v buňce. Genetický polymorfizmus popis struktury populací. Organizace genetického materiálu. Definice polymorfismu Genetický olymorfizmus ois struktury oulací Tok GI v buňce Dr. Ing. Urban Tomáš ÚSTAV GEETIKY MZLU Brno htt:// Seminář doktorského grantu 53/03/H076 : Molekulárn
