Vrozené vývojové vady, genetika

Rozměr: px
Začít zobrazení ze stránky:

Download "Vrozené vývojové vady, genetika"


1 UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc. Praha

2 VROZENÉ VÝVOJOVÉ VADY, GENETIKA III r. Bc. 4 h. KZ Anotace: Úvodní přednášky se zabývají problematikou genetiky, popisem obecných zákonitostí, charakterizujících dědičnost a proměnlivost. Na obecné biologické procesy, probírané v anatomii, biochemii a fyziologii, navazují poznatky z molekulární genetiky, onkogenetiky, s ohledem na ekologické vlivy. Význam genetické zátěže je dokumentován na příkladech genů a znaků, dědičných chorob a vad. Tématický plán kombinovaného studia Přednášky: 1. Základy molekulární genetiky, typy genetického přenosu, genové mutace. 2. Polymorfismus nově genetické pohledy 3. Prenatální, natální a postnatální diagnostika geneticky podmíněných stavů a chorob. 4. Syndromy vrozených chromozomálních aberací. Dědičně podmíněné metabolické poruchy Požadavky na klasifikovaný zápočet: - zápočtový test Literatura: DUNGL,P. a kol. Ortopedie. Praha: Graga Publishing, ISBN KOUDELA, K. a kol. Ortopedie. Praha: Univerzita Karlova, ISBN KAPRAS, J., KOHOUTOVÁ, M., OTOVÁ, B. Kapitoly z lékařské biologie a genetiky I. 1. vyd. Praha: Karolinum, s. ISBN SOUKUPOVÁ, M., SOUKUP, F. Kapitoly z lékařské biologie a genetiky II. 1. vyd. Praha: Karolinum, s. ISBN THOMPSON, J., THOMPSON, M.G. et al.: Klinická genetika: Thompson & Thompson. 6. vydání. Praha : Triton, PRITCHARD, D. J., KORF, B.R.. Základy lékařské genetiky. Praha : Galén, 2007 OTOVÁ, Berta, et al. Lékařská biologie a genetika I. díl. 1. vydání. Praha : Karolinum, s. ISBN KOČÁREK, Eduard PÁNEK, Martin NOVOTNÁ, Drahuše. Klinická cytogenetika I.: úvod do klinické cytogenetiky, vyšetřovací metody v klinické cytogenetice. 2. vydání. Praha : Karolinum, s. ISBN

3 SNUSTAD, D. Peter SIMMONS, Michael J.. Genetika. 1. vydání. Brno : Nakladatelství Masarykovy univerzity, s. ISBN VYSKOT, Boris. Epi Genetika. 1. vydání. Olomouc : Univerzita Palackého v Olomouci, s. ISBN Samostudium: Návody: Literární zdroje pro látku určenou k samostudiu jsou uvedeny výše. Prezentace celé patologické fyziologie je i na webových stránkách FTVS UK V případě nejasností je možné konzultovat problém s vyučujícím pomocí u či se přihlásit elektronicky na individuální kontaktní konzultaci v konzultačních hodinách. Kontrolní otázky se vztahují k následující problematice: 1. Základy molekulární genetiky Literární zdroje NUSSBAUM, R.L., McINNES, R.R., WILLARD, H.F. (2004) Klinická genetika. Praha: TRITON, ISBN-10: Základy cytogenetiky (struktura a funkce genů, princip segregace, kombinace a rekombinace alel), Mendelovská a nemendelovská dědičnost - typy, křížení (str ) Molekulární genetika (transkripce, translace, mutace, genetický polymorfismus) (str ) Genetické testy (metody a způsoby genetického testování, testy otcovství) (str ) Klíčová slova: chromozomy, geny, alely, mitochondrie a mitochondriální dědičnost, genotyp, fenotyp, Mendelovy zákony dědičnosti, mutace, genetický polymorfismus, genetické testy (genealogické stromy, odběry materiálu pro genetické testování) 3

4 ÚKOLY PRO STUDENTY: Zodpovězte si kontrolní otázky: Čím se zabývá genetika základní a klinická? Jak probíhá mitotické dělení buněk? Jak probíhá meiotické dělení buněk? Popište základy mendelovské dědičnosti, známé jako Mendlovy zákony, Jak probíhá matroklinní dědičnost? Jaké typy mutací znáte uveďte příklady příčin i následných projevů. Definujte následující termíny: gen, genotyp, fenotyp, alela, dominance, recesivita. Co je to genetický polymorfismus uveďte příklad. Jaké možné genetické testy znáte, jak se využívají? Jak se sestavují genealogické stromy podle typu dědičnosti uveďte příklady. 2. Lékařská genetika a genomika Literární zdroje NUSSBAUM, R.L., McINNES, R.R., WILLARD, H.F. (2004) Klinická genetika. Praha: TRITON, ISBN-10: Genetika a genomika (str ) Mapování genomu a genová terapie (str ) Klinická genetika (přehled nejvýznamnějších genetických chorob). (str ) Vrozené vývojové vady (teratogeny a příčiny vzniku vrozených vývojových vad. Popis jednotlivých vad.) (str ) Genetické poradenství (význam, potřeba a metody genetického poradenství a prenatální diagnostiky) (str ) Etické a právní aspekty lékařské genetiky (str ) Klíčová slova: genomika,dědičnost, dědivost, heterozygotní a homozygotní poruchy, teratogeny, prenatální, natální a postnatální diagnostika, etika a genetika ÚKOLY PRO STUDENTY: Zodpovězte si kontrolní otázky: Jaký je významový vztah mezi pojmem dědičnost a dědivost uveďte příklad. Definujte následující termíny: heterozygot, homozygot uveďte příklady dědičnosti. Uveďte příčiny a příklady početních poruch pohlavních chromozomů. Uveďte příčiny a příklady strukturních poruch pohlavních chromozomů. Uveďte příčiny a příklady početních poruch somatických (nepohlavních) chromozomů. Uveďte příčiny a příklady strukturních poruch somatických (nepohlavních) chromozomů. 4

5 Jak ovlivňuje genetika možnost rozvoje zhoubného bujení? Které prenatální diagnostické metody znáte a jak se uplatňují v rámci genetické predikce? Jak probíhá genetické poradenství a stanovení genetického rizika? Jaké etické problémy jsou spojeny s genetickým testování a jak je lze řešit? 3. Geneticky podmíněné nemoci. Podstata a vlastnosti genově podmíněných nemocí monogenně, polygenně, genetický polymorfismus. Genetická predispozice. Literární zdroje: NEČAS, E.: Obecná patologická fyziologie. Karolinum Praha, s.377. ISBN X s JONES, S.: Genetika. Praha : Portál, s.160. ISBN témata jsou ze všech kapitol monografie MAČÁK J., MAČÁKOVÁ J.: Patologie. Grada Praha, s ISBN s Klíčová slova: Gen, alela. Polymorfismus. Homozygot, heterozygot. Dominance, kodominance, recesivita. Mendelovy zákony dědičnosti. Monogenní a multifaktoriální nemoci. Genetická predispozice. Genealogické stromy. ÚKOLY PRO STUDENTY: Zodpovězte si kontrolní otázky: Jaký je rozdíl mezi genem a alelou? Uveďte příklad. Které Mendelovy zákony znáte a jak se uplatňují v genetické prognóze? Jaký je rozdíl mezi dominantní a recesivní alelou a to jak v genotypu tak ve fenotypu a proč? Jak lze hodnotit genetickou predispozici s ohledem na etiologii nemoci? Uveďte příklady v souvislosti s genetickým polymorfismem. Co jsou to mutace, čím mohou být způsobeny a kdy a za jakých podmínek se mohou projevit? 5

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Vývojové vady a ortopedie. studijní opora pro kombinovanou formu studia

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Vývojové vady a ortopedie. studijní opora pro kombinovanou formu studia UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vývojové vady a ortopedie studijní opora pro kombinovanou formu studia Tělesná výchova a sport zdravotně postižených Doc.MUDr.Eva Kohlíková,



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly





Okruhy otázek ke zkoušce

Okruhy otázek ke zkoušce Okruhy otázek ke zkoušce 1. Úvod do biologie. Vznik života na Zemi. Evoluční vývoj organizmů. Taxonomie organizmů. Původ a vývoj člověka, průběh hominizace a sapientace u předků člověka vyšších primátů.


Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti


UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Oftalmopedie a surdopedie. studijní opora pro kombinovanou formu studia (Bc.

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Oftalmopedie a surdopedie. studijní opora pro kombinovanou formu studia (Bc. UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Oftalmopedie a surdopedie studijní opora pro kombinovanou formu studia (Bc.) Tělesná výchova a sport zdravotně postižených Mgr. et Mgr. Alena


UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Psychopedie a etopedie. studijní opora pro kombinovanou formu studia (Bc.

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Psychopedie a etopedie. studijní opora pro kombinovanou formu studia (Bc. UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Psychopedie a etopedie studijní opora pro kombinovanou formu studia (Bc.) Tělesná výchova a sport zdravotně postižených Mgr. et Mgr. Alena Lejčarová,


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


Výuka genetiky na Přírodovědecké fakultě MU

Výuka genetiky na Přírodovědecké fakultě MU MASARYKOVA UNIVERZITA Přírodovědecká fakulta Výuka genetiky na Přírodovědecké fakultě MU Jiří Doškař Ústav experimentální biologie, Oddělení genetiky a molekulární biologie 1 V akademickém roce 1964/1965


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální



EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením


Klinická genetika, genetické poradenství, cytogenetika, DNA diagnostika (od pacienta k DNA a zpět)

Klinická genetika, genetické poradenství, cytogenetika, DNA diagnostika (od pacienta k DNA a zpět) Klinická genetika, genetické poradenství, cytogenetika, DNA diagnostika (od pacienta k DNA a zpět) OLG FN Brno LF a PřF MU 2014 Renata Gaillyová Lékařská genetika Charakteristika, historie a současný stav


KLINICKÁ GENETIKA. Praktické aplikace. Taťána Maříková Eva Seemanová KAROLINUM UČEBNÍ TEXTY UNIVERZITY KARLOVY V PRAZE. 1. vydání

KLINICKÁ GENETIKA. Praktické aplikace. Taťána Maříková Eva Seemanová KAROLINUM UČEBNÍ TEXTY UNIVERZITY KARLOVY V PRAZE. 1. vydání KAROLINUM UČEBNÍ TEXTY UNIVERZITY KARLOVY V PRAZE KLINICKÁ GENETIKA Praktické aplikace Taťána Maříková Eva Seemanová 1. vydání Klinická genetika Praktické aplikace doc. MUDr. Taťána Maříková, CSc. prof.


Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní


Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


Cvičení z genetiky a cytogenetiky na Přírodovědecké fakultě UK v Praze

Cvičení z genetiky a cytogenetiky na Přírodovědecké fakultě UK v Praze Cvičení z genetiky a cytogenetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Studenti si tvoří vlastní studijní plán, ale musejí naplnit povinný limit kreditů Velká pestrost


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho






http://www.vrozene-vady.cz Prevence vrozených vad z pohledu genetika MUDr. Vladimír Gregor, RNDr. Jiří Horáček odd. lékařské genetiky, Fakultní Thomayerova nemocnice v Praze Genetické poradenství Klinická genetika se zabývá diagnostikou


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika


Poznámky k nutrigenetice

Poznámky k nutrigenetice Poznámky k nutrigenetice Ondřej Šeda Institut klinické a experimentální medicíny, Praha Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Research Centre CHUM, Montreal, Canada Nutrigenetika Jednotlivé


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním



21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka


Obecná biologie a genetika B53 volitelný předmět pro 4. ročník

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Biologie. Mezipředmětové


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil


Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649





genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace


Doporučení týkající se informovaného souhlasu pro genetická laboratorní vyšetření

Doporučení týkající se informovaného souhlasu pro genetická laboratorní vyšetření SLG ČLS JEP verze 2.1. /22. 5. 2013 Společnost lékařské genetiky ČLS JEP vydává v souvislosti s přijetím zákonů 373/2011Sb. o specifických zdravotních službách a 372/2011 Sb. o zdravotních službách aktualizaci


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Studijní obor: Bioanalytik odborný pracovník v laboratorních metodách

Studijní obor: Bioanalytik odborný pracovník v laboratorních metodách Magisterský studijní program Biochemie (doplněk ke studijnímu katalogu zveřejněnému na webových stránkách fakultu http://www.sci.muni.cz/katalog/katalog2015/katalogbch.pdf) Garant studijního programu Prof.


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Vzdělávací program specializačního vzdělávání v oboru

Vzdělávací program specializačního vzdělávání v oboru Vzdělávací program specializačního vzdělávání v oboru 1 Cíl specializačního vzdělávání... 2 2 Minimální požadavky na specializační vzdělávání... 2 2.1 Základní kmen pro klinické laboratorní obory klinická



http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00


UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu ETIKA POMÁHAJÍCÍCH PROFESÍ. studijní opora kombinovaného studia

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu ETIKA POMÁHAJÍCÍCH PROFESÍ. studijní opora kombinovaného studia UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu ETIKA POMÁHAJÍCÍCH PROFESÍ studijní opora kombinovaného studia Tělesná výchova a sport zdravotně postižených PhDr. Miloš Bednář, Ph.D. Praha


UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Somatopedie a logopedie. studijní opora pro kombinovanou formu studia

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Somatopedie a logopedie. studijní opora pro kombinovanou formu studia UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Somatopedie a logopedie studijní opora pro kombinovanou formu studia Tělesná výchova a sport zdravotně postižených Mgr. et Mgr. Alena Lejčarová,



GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Fyziologie zátěže. studijní opora pro kombinovanou formu studia

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Fyziologie zátěže. studijní opora pro kombinovanou formu studia UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Fyziologie zátěže studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc. MUDr. Jan Heller, CSc. Praha 2012 Anotace



CZ.1.07/1.5.00/ Projekt: Příjemce: Digitální učební materiály ve škole, registrační číslo projektu CZ.1.07/1.5.00/34.0527 Střední zdravotnická škola a Vyšší odborná škola zdravotnická, Husova 3, 371 60 České Budějovice


GENOM X GENOTYP Genom u jedinců stejného druhu je stejný Genotypy jedinců stejného druhu mohou být rozdílné

GENOM X GENOTYP Genom u jedinců stejného druhu je stejný Genotypy jedinců stejného druhu mohou být rozdílné Kdo navštěvuje a kdo by měl navštívit genetickou poradnu?..od patologie k prenatální diagnostice.. Renata Gaillyová, LG FN Brno Brno, 2011 GENM X GENTYP Genom u jedinců stejného druhu je stejný Genotypy





Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním


UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Psychopedie a etopedie. studijní opora pro kombinovanou formu studia (Mgr.

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Psychopedie a etopedie. studijní opora pro kombinovanou formu studia (Mgr. UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Psychopedie a etopedie studijní opora pro kombinovanou formu studia (Mgr.) Tělesná výchova a sport zdravotně postižených Mgr. et Mgr. Alena Lejčarová,



http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Genetika člověka. Základním cílem genetiky člověka je studium genetické variability, kterou lze rozdělit na patologickou a nepatologickou.

Genetika člověka. Základním cílem genetiky člověka je studium genetické variability, kterou lze rozdělit na patologickou a nepatologickou. Genetika člověka Jednou z možností členění genetiky je její třídění podle druhu studovaných organismů (genetika virů, bakterií, rostlin, zvířat, člověka atd.). Genetiku člověka jsme se rozhodli zařadit








Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


Pohled genetika na racionální vyšetřování v preventivní kardiologii

Pohled genetika na racionální vyšetřování v preventivní kardiologii Pohled genetika na racionální vyšetřování v preventivní kardiologii Tomáš Freiberger Genetická laboratoř, Centrum kardiovaskulární a transplantační chirurgie Brno, ČR Osnova Genetické faktory vzniku KV



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ



PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie lizal@sci.muni.cz 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin


Vzdělávací obsah vyučovacího předmětu

Vzdělávací obsah vyučovacího předmětu Vzdělávací obsah vyučovacího předmětu Přírodopis 8. ročník Zpracovala: RNDr. Šárka Semorádová Biologie živočichů porovná základní vnější a vnitřní stavbu těla vybraných živočichů; určí vybrané zástupce


Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Význam integrovaného testu a NIPT při screeningu chromozomálních aberací

Význam integrovaného testu a NIPT při screeningu chromozomálních aberací Význam integrovaného testu a NIPT při screeningu chromozomálních aberací Jaroslav Loucký 1, Drahomíra Springer 2, Vladimír Gregor 3, David Čutka 4, Martin Hynek 5, David Stejskal 5 1 Prediko, Zlín 2 ÚLBLD


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových


LCH/PAK01. 5 hodin cvičení

LCH/PAK01. 5 hodin cvičení Studijní program : Porodní asistence bakalářské studium - kombinovaná forma Název předmětu : Klinická biochemie Rozvrhová zkratka : LCH/PAK01 Rozvrh výuky : 5 hodin přednášek 5 hodin cvičení Zařazení výuky


A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům Karlova univerzita, Lékařská fakulta Hradec Králové Obor: všeobecné lékařství - test z biologie Vyberte tu z nabídnutých odpovědí (1-5), která je nejúplnější. Otázka Odpověď 1. Mezi organely membránového


GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem
