4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

Rozměr: px
Začít zobrazení ze stránky:

Download "4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie."

Transkript

1 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902 anglický lékař Archibald Edward Garrod vyšetřoval dítě s vzácnou chorobou, která se projevuje tmavnutím moči na vzduchu (pojmenovaná alkaptonurie). V té době byla znovuobjevena Mendelova práce, která si pomalu hledala cestu i k lékařům. Garrod věděl, že rodiče dítěte byli bratranec se sestřenicí a proto přemýšlel, že by alkaptonurie mohla být vzácným recesivním dědičným onemocněním, kdy onemocní jedinec pouze pokud získá obě postižené alely genu. Takové případy jsou mnohem častější v rodinách, kde jsou si rodiče blízce příbuzní a mají tudíž větší šanci sdílet stejné alely. Garrod ovšem také správně vytušil, že postiženému dítěti zřejmě chybí nějaký enzym, který přeměňuje meziprodukty při tvorbě moči. Později zjistil, že se jedná o enzym metabolismu tyrosinu, který dioxygenuje kyselinu homogentisovou. Nadbytek kys. homogentisové při alkaptonurii se vylučuje močí, která stáním (oxidací) tmavne. Chybění tohoto enzymu se v rodině dědilo. Během dalšího desetiletí Garrod naschromáždil znalosti i o dalších dědičných metabolických poruchách a formuloval hypotézu: jeden gen = jeden enzym V roce 1909 pak svoje poznatky publikoval ve svazku Inborn Errors of Metabolism. Sir Archibald Garrod těmito poznatky příliš předběhl dobu, ale dal tímto základ pro objasnění spojitosti mezi dědičnou informací, tedy geny, a proteiny, jako produkty této informace. Po objasnění struktury DNA v roce 1953 se konečně rozplynuly poslední pochyby o její roli jako nositelky dědičné informace. Po tomto objevu se Francis Crick začal intenzivně zajímat o biologické důsledky svého objevu a v druhé polovině 50. let se pustil do objasňování, jak se tvoří proteiny. Kolem roku 1958 dozrály myšlenky Francise Cricka v poměrně správný popis celého procesu syntézy proteinu: messenger RNA nese instrukce o vytvoření proteinu v cytoplazmě adaptorové molekuly ( mohou obsahovat nukleotidy ) rozpoznávají krátké sekvence v mrna, které kódují aminokyseliny ribonukleoproteinové komplexy katalyzují poskládání jednotlivých aminokyselin v proteiny podle mrna Adaptorové molekuly se nakonec ukázaly být trna, které na základě komplementarity bazí rozeznávaly genetickou informaci v mrna a přinášely na sobě navázané specické aminokyseliny. Proteiny se pak syntetizují na předpovězených ribonukleoproteinových komplexech, které byly nazvány ribozomy. Zbývalo rozluštit genetický kód. Hypotéza byla, že nejmenší jednotkou musí být triplet nukleotidů, který by mohl kódovat jednu aminokyselinu. Esenciálních aminokyselin bylo 20, tudíž 2 nukleotidy poskládané ze 4

2 možných dávají max. 4x4=16 možných kombinací a to nestačí. Triplet dává 4x4x4=64 kombinací. Takový kód by byl degenerovaný, kdy více kombinací kóduje jednu aminokyselinu. Rozluštění genetického kódu Do začátku 60. let byl genetický kód pouhou spekulací. Až Marshall Nirenberg a Heinrich Matthaei vyvinuli metodu, jak cracknout genetický kód a určit, který triplet je zodpovědný za jakou aminokyselinu. Nirenberg a Matthaei byli schopni syntetizovat řetězce mrna s vybranými nukleotidy. Když takovýto umělý řetězec smíchali ve zkumavce se všemi ostatními ingrediencemi, potřebnými pro syntézu proteinů, byli schopni zjistit, jaký oligopeptid (řetězec aminokyselin) vzniká při jaké kombinaci nukleotidů. Během následujících 4 let spolu s dalšími vědci byli schopni rozluštit triplety pro všech 20 aminokyselin a tak v roce 1966 je znám genetický kód: Genetickým kódem je v DNA, resp. v RNA, zakódována aminokyselinová sekvence proteinů, přičemž jedna aminokyselina je vždy kódována třemi po sobě jdoucími nukleotidy (tzv. triplet) dle výše uvedené tabulky. Protože genetický kód je degenerovaný (je více kombinací tripletů, než je aminokyselin), je většina aminokyselin kódována více než jedním tripletem (tj. více tripletů kóduje jednu stejnou aminokyselinu). Podle toho, jak jsou triplety za sebou uspořádány v kódující sekvenci, se řadí jednotlivé aminokyseliny za sebou v řetězci vznikajícího proteinu (více v panelu 3 níže). Centrální dogma bylo poprvé formulováno Francisem Crickem v roce 1958 (viz výše) a publikováno v časopise Nature v roce 1970: Central Dogma of Molecular Biology by Francis Crick (Nature 1970)

3 PANEL 3.

4 Zrod molekulární biologie Nyní tedy víme, jak vypadá DNA a také víme princip, jakým způsobem se v ní kóduje genetická informace. Ale jak v ní hledat konkrétní geny, jak se v ní naučit číst, naučit se s ní pracovat a analyzovat ji? Odpovědí byl bouřlivý (někdy pomalý a velmi pracný, jindy velmi rychlý) vývoj biotechnologických postupů. DNA je příliš malinká, než abychom v ní mohli číst přímým pozorováním (je možné ji vidět, ať už jako vlákno pomocí elektronové mikroskopie, nebo obrovský shluk vláken poskládaných do kompaktního chromozomu pomocí normálního světelného mikroskopu, dokonce je možné ji vidět ve velkém množství vysráženou ve zkumavce pouhým okem, ale bohužel jednotlivá písmenka seřazená pěkně za sebou v jednom vlákně DNA takto nepřečteme). Bylo třeba vyvinout nepřímé metody. Základem je získat určitou DNA v dostatečném množství, které nám umožní s ní dále pracovat (různých postupů pro různé aplikace je nepřeberně). Kromě malých bakteriálních plazmidů jsou DNA molekuly příliš dlouhé a obsahují příliš mnoho písmen, než aby se s nimi dalo snadno pracovat vcelku. Je třeba tedy DNA rozbít na menší kousky, se kterými by se již snáze pracovalo. Tyto kousky je nutné ale nějakým způsobem udržet, případně vybraný konkrétní kousek znovu namnožit. Pro tento úkol byly velmi rychle využity bakteriální buňky, které jsou pro to doslova stvořené. Některé bakterie totiž v sobě kromě své chromozomální DNA s esenciálními geny mají také malou plazmidovou DNA, se kterou lze poměrně snadno manipulovat, aniž by to bakterie poškozovalo. Především si ale mohou bakterie mezi sebou tuto plazmidovou DNA předávat procesem zvaným transformace (základ Griffithova experimentu při ustanovování DNA jako nositelky dědičné informace). Vědci se brzy naučili, že mohou kousky své DNA vložit do těchto bakteriálních plazmidů, transformovat je zpět do bakterií, kde se jim spolu s množením bakterií v kultuře namnoží i jejich vybraný kousek DNA a může zároveň být takto uložen pro další práci. Problém s tímto postupem byl v začátcích v tom, že vědci neměli kontrolu nad rozkouskováním a vkládáním úseků DNA do plazmidů. DNA byla rozbíjena mechanicky, přičemž pokaždé vznikly jinak dlouhé a v jiném

5 místě naštípané úseky DNA. Průlom v biotechnologiích přinesl až objev enzymů zvaných restrikční endonukleázy, populárně také zvané molekulární nůžky. Ty umožnily vědcům (1) rozstříhat DNA v konkrétních místech ( molecular scissors ) a (2) specificky spojit dva úseky DNA, ať už pocházely z jakéhokoliv zdroje ( molecular paste ).V dobách, kdy svět ovládaly prokaryotické organismy, bakterie byly neustále atakovány kousky genetické informace (v podobě virů) ty bakterie, které se uměly tomuto bránit, měly evoluční výhodu nad ostatními. Jednou ze strategií, jak se bránit virům, je rozštípat jejich nukleovou kyselinu na kousky. K tomu bakterie vyvinuly arzenál enzymů, zvaných restrikční endonukleázy, které právě toto dělají. Tyto enzymy ovšem neštěpí DNA kdekoliv, ale pouze v místech jedné konkrétní sekvence. Vlastní DNA bakterií je pak v těchto místech chráněna proti rozstřihání pomocí metylace DNA v místě rozpoznávací sekvence. Příklad štepení EcoRI restrikční endonukleázy a specifické spojení dvou různých fragmentů DNA: Nyní jsme tedy schopni základní manipulace s DNA její izolace, rozkouskování, uchování a dokonce jejího specifického rozstříhání a spojování cizorodých fragmentů do sebe (rekombinantní DNA). Ale pro její analýzu jí potřebujeme nějakým způsobem zviditelnit. Dvě základní metody, které nám to umožňují, jsou elektroforéza a hybridizace. Elektroforéza Základem gelové elektroforézy je záporný elektrický náboj nukleových kyselin, v elektirckém poli tedy mohou cestovat ke kladné elektrodě - v agarozovém nebo polyakrylamidovém gelu pak můžeme rozdělit DNA fragmenty podle jejich délky (na sekvenci až na speciální aplikace v podstatě nezáleží, rozhodující je velikost fragmentu - kratší fragmenty se snáze proplétají póry gelu a putují rychleji) a následně zviditelnit barvením vláken DNA např. ethidium bromidem:

6 Hybridizace Hybridizace využívá důležité vlastnosti nukleových kyselin rádi se párují do dvou komplementárních řetězců (podstata Watsonova a Crickova objevu dvojšroubovice DNA a párování bazí, princip exprese genetické informace DNA se přepisuje do RNA na základě komplementarity, vazba trna na mrna atd.) Zde se přímo nabízí metoda pro zviditelnění DNA na základě její sekvence ona kýžená touha číst v DNA. Hybridizaci nukleových kyselin můžeme využít k detekci fragmentu DNA či RNA na základě jeho sekvence. K tomu je třeba si vyrobit próbu s komplementární sekvencí k hledanému fragmentu a tuto próbu naznačit (radioktivně nebo fluorescenčními barvičkami), abychom ji později mohli detekovat. Příklad detekce vybrané sekvence na chromozomu pomocí fluorescenční in situ hybridizace (FISH):

7 Polymerázová řetězová reakce (Polymerase Chain Reaction - PCR) Množení vybraných úseků DNA pomocí klasických metod zaklonování fragmentů do plazmidových DNA bylo pomalé a velice náročné. Převrat přišel s objevem polymerázové řetězové reakce v roce Pomocí PCR je možné během krátké doby namnožit vybraný úsek DNA do velkého počtu kopií. Specifické určení úseku DNA zajistí tzv. primery, krátké sekvence DNA, které rozeznávají začátek a konec vybraného úseku. Primery jsou zpravidla dlouhé alespoň 18 nukleotidů, což ve většině případů zajistí, že bude specificky rozpoznána jedna unikátní oblast v celém genomu, z kterého chceme DNA množit. Pro PCR potřebujeme: 1. DNA, kterou chceme namnožit a která tedy bude sloužit jako templát 2. Primery, krátké oligonukleotidové sekvence, které na základě komplementarity vyhledají správnou sekvenci a ze kterých začne syntéza nových řetězců 3. Termostabilní DNA polymerázu (nejčastěji Taq polymeráza, izolovaná z termorezistentních bakterií Thermophillus aquaticus) 4. datp, dgtp, dctp a dttp deoxyribonukleotidtrifosfáty (souhrnně značené jako dntp), které slouží jako stavební kameny pro syntézu nových řetězců Reakce je pak vlastně jen střídání vysokých a nízkých teplot, kdy se při 94 C rozdělí řetězce původní templátové DNA (denaturace DNA), na které pak mohou nasednout primery (při teplotách mezi C) a z nich začne syntéza nových řetězců. Pak se znovu DNA zahřeje a vše se opakuje. Po takovýchto cyklech máme miliony nově syntetizovaných fragmentů, které jsou ohraničeny sekvencí dvou primerů, použitých pro PCR: Princip PCR popsal již v roce 1971 Dr. Kjell Kleppe (Kleppe K, Ohtsuka E, Kleppe R, Molineux I, Khorana HG. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. Journal of Molecular Biology Mar 14; 56(2): ):

8 "... one would hope to obtain two structures, each containing the full length of the template strand appropriately complexed with the primer. DNA polymerase will be added to complete the process of repair replication. Two molecules of the original duplex should result. The whole cycle could be repeated, there being added every time a fresh dose of the enzyme." Nicméně o opravdovou aplikaci PCR se zasloužil až Kary B. Mullis, který v roce 1983 pracoval ve firmě Cetus Corp. a který v roce 1993 za to získal Nobelovu cenu.

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION VYUŽITÍ AUTOMATICKÉHO SEKVENOVÁNÍ DNA PRO DETEKCI POLYMORFISMŮ KANDIDÁTNÍCH GENŮ U PRASAT Vykoukalová Z., Knoll A.,

Více

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního

Více

Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace

Více

Deriváty karboxylových kyselin, aminokyseliny, estery

Deriváty karboxylových kyselin, aminokyseliny, estery Deriváty karboxylových kyselin, aminokyseliny, estery Zpracovala: Ing. Štěpánka Janstová 29.1.2012 Určeno pro 9. ročník ZŠ V/II,EU-OPVK,42/CH9/Ja Přehled a využití derivátů organických kyselin, jejich

Více

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční

Více

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu

Více

Věda v prostoru. Voda v pohybu. Buněční detektivové. Svědkové dávné minulosti Země

Věda v prostoru. Voda v pohybu. Buněční detektivové. Svědkové dávné minulosti Země 6+ Věda v prostoru Jak vědci pracují v laboratoři? Proč je zelená víc než jen obyčejná barva? Jak můžeme použít prášek do pečiva ke sfouknutí svíčky? Získejte odpovědi na všechny otázky v tomto vzrušujícím

Více

Schéma průběhu transkripce

Schéma průběhu transkripce Molekulární základy genetiky PROTEOSYNTÉZA A GENETICKÝ KÓD Proteosyntéza je složitý proces tvorby bílkovin, který zahrnuje proces přepisu genetické informace z DNA do kratšího zápisu v informační mrna

Více

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících

Více

od eukaryotické se liší svou výrazně jednodušší stavbou a velikostí Dosahuje velikosti 1-10 µm. Prokaryotní buňku mají bakterie a sinice skládá se z :

od eukaryotické se liší svou výrazně jednodušší stavbou a velikostí Dosahuje velikosti 1-10 µm. Prokaryotní buňku mají bakterie a sinice skládá se z : Otázka: Buňka Předmět: Biologie Přidal(a): konca88 MO BI 01 Buňka je základní stavební jednotka živých organismů. Je to nejmenší živý útvar schopný samostatné existence a rozmnožování. Každá buňka má svůj

Více

Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin

Více

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza Exprese genetického kódu Centrální dogma molekulární biologie - genetická informace v DNA -> RNA -> primárního řetězce proteinu 1) transkripce - přepis z DNA do mrna 2) translace - přeložení z kódu nukleových

Více

ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a

Více

Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy molekulární a buněčné biologie Přípravný kurz Komb.forma studia oboru Všeobecná sestra Genetický aparát buňky DNA = nositelka genetické informace - dvouvláknová RNA: jednovláknová mrna = messenger

Více

Proteiny Genová exprese. 2013 Doc. MVDr. Eva Bártová, Ph.D.

Proteiny Genová exprese. 2013 Doc. MVDr. Eva Bártová, Ph.D. Proteiny Genová exprese 2013 Doc. MVDr. Eva Bártová, Ph.D. Bílkoviny (proteiny), 15% 1g = 17 kj Monomer = aminokyseliny aminová skupina karboxylová skupina α -uhlík postranní řetězec Znát obecný vzorec

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219.

Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219. Vzdělávací materiál vytvořený v projektu OP VK Název školy: Gymnázium, Zábřeh, náměstí Osvobození 20 Číslo projektu: Název projektu: Číslo a název klíčové aktivity: CZ.1.07/1.5.00/34.0211 Zlepšení podmínek

Více

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi

Více

NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin:

NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin: NUKLEOVÉ KYSELINY Deoxyribonukleová kyselina (DNA, odvozeno z anglického názvu deoxyribonucleic acid) Ribonukleová kyselina (RNA, odvozeno z anglického názvu ribonucleic acid) Definice a zařazení: Nukleové

Více

Struktura a funkce nukleových kyselin

Struktura a funkce nukleových kyselin Struktura a funkce nukleových kyselin ukleové kyseliny Deoxyribonukleová kyselina - DA - uchovává genetickou informaci Ribonukleová kyselina RA - genová exprese a biosyntéza proteinů Složení A stavební

Více

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy

a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy 1 Nukleové kyseliny Nukleové kyseliny (NK) sice tvoří malé procento hmotnosti buňky ale významem v kódování genetické informace a její expresí zcela nezbytným typem biopolymeru všech živých soustav a)

Více

Centrální dogma molekulární biologie

Centrální dogma molekulární biologie řípravný kurz LF MU 2011/12 Centrální dogma molekulární biologie Nukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Mendel) 1869 objev nukleových kyselin (Miescher) 1944 genetická informace v nukleových

Více

Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro

Více

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010

Více

TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE

TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy

Více

ENZYMY A NUKLEOVÉ KYSELINY

ENZYMY A NUKLEOVÉ KYSELINY ENZYMY A NUKLEOVÉ KYSELINY Autor: Mgr. Stanislava Bubíková Datum (období) tvorby: 28. 3. 2013 Ročník: devátý Vzdělávací oblast: Člověk a příroda / Chemie / Organické sloučeniny 1 Anotace: Žáci se seznámí

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace

Více

Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní

Více

15. Základy molekulární biologie

15. Základy molekulární biologie 15. Základy molekulární biologie DNA je zkratka pro kyselinu deoxyribonukleovou, která je nositelkou genetické informace všech živých buněčných organismů. Je tedy nezbytná pro život pomocí svých informací

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 5. Metody molekulární biologie II DNA footprinting hledání interakcí DNA s proteiny Polymerázová řetězová reakce (Polymerase chain reaction PCR) Malé

Více

Úvod do studia biologie. Základy molekulární genetiky

Úvod do studia biologie. Základy molekulární genetiky Úvod do studia biologie Základy molekulární genetiky Katedra biologie PdF MU, 2011 - podobor genetiky (genetika je obecnější) Genetika: - nauka o dědičnosti a proměnlivosti - věda 20. století Johann Gregor

Více

Nukleové kyseliny Replikace Transkripce translace

Nukleové kyseliny Replikace Transkripce translace Nukleové kyseliny Replikace Transkripce translace Figure 4-3 Molecular Biology of the Cell ( Garland Science 2008) Figure 4-4 Molecular Biology of the Cell ( Garland Science 2008) Figure 4-5 Molecular

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,

Více

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

MODERNÍ BIOFYZIKÁLNÍ METODY:

MODERNÍ BIOFYZIKÁLNÍ METODY: MODERNÍ BIOFYZIKÁLNÍ METODY: POKROČILÉ PRAKTICKÉ VZDĚLÁVÁNÍ V EXPERIMENTÁLNÍ BIOLOGII Operační program Vzdělávání pro konkurenceschopnost Číslo projektu: CZ.1.07/2.3.00/09.0046 Praktický kurz pokročilých

Více

Možné účinky XENOBIOTIK

Možné účinky XENOBIOTIK Možné účinky XENOBIOTIK přímý toxický účinek -látka působí pouhou svou přítomností na kritickém místě v organismu biochemický účinek - látka interaguje s cílovou molekulou (receptorem), ovlivní nějaký

Více

VYSOKÉ UČENÍ TECHNICKÉ V BRNĚ BRNO UNIVERSITY OF TECHNOLOGY

VYSOKÉ UČENÍ TECHNICKÉ V BRNĚ BRNO UNIVERSITY OF TECHNOLOGY VYSOKÉ UČENÍ TECHNICKÉ V BRNĚ BRNO UNIVERSITY OF TECHNOLOGY FAKULTA CHEMICKÁ ÚSTAV CHEMIE POTRAVIN A BIOTECHNOLOGIÍ FACULTY OF CHEMISTRY INSTITUTE OF FOOD SCIENCE AND BIOTECHNOLOGYOGY IZOLACE DNA V KVALITĚ

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

REPLIKACE A REPARACE DNA

REPLIKACE A REPARACE DNA REPLIKACE A REPARACE DNA 1 VÝZNAM REPARACE DNA V MEDICÍNĚ Příklad: Reparace DNA: enzymy reparace nukleotidovou excizí Onemocnění: xeroderma pigmentosum 2 3 REPLIKACE A REPARACE DNA: Replikace DNA: 1. Podstata

Více

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

Gymnázium, Brno, Elgartova 3

Gymnázium, Brno, Elgartova 3 Gymnázium, Brno, Elgartova 3 Šablona: III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: GE Vyšší kvalita výuky Číslo projektu: CZ.1.07/1.5.00/34.0925 Autor: Mgr. Hana Křivánková Téma:

Více

Základy metod forenzní genetiky. Hana Šumberová, DiS

Základy metod forenzní genetiky. Hana Šumberová, DiS Základy metod forenzní genetiky Hana Šumberová, DiS Bakalářská práce 2011 PROHLÁŠENÍ AUTORA BAKALÁŘSKÉ PRÁCE Beru na vědomí, že odevzdáním bakalářské práce souhlasím se zveřejněním své práce podle zákona

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních

Více

Přípravný kurz z biologie MUDr. Jana Kolářová, CSc. témata 1 Mgr. Kateřina Caltová témata 3-5 doc. PharmDr. Emil Rudolf, Ph.D. 2 + 6-10 materiály k

Přípravný kurz z biologie MUDr. Jana Kolářová, CSc. témata 1 Mgr. Kateřina Caltová témata 3-5 doc. PharmDr. Emil Rudolf, Ph.D. 2 + 6-10 materiály k Přípravný kurz z biologie MUDr. Jana Kolářová, CSc. témata 1 Mgr. Kateřina Caltová témata 3-5 doc. PharmDr. Emil Rudolf, Ph.D. 2 + 6-10 materiály k přípravnému kurzu: stránka Ústavu lékařské biologie a

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Mária Majeská Čudejková 3. Proteosyntéza Centrální dogma molekulární biologie Rozluštění genetického kódu in vitro Marshall Nirenberg a Heinrich Matthaei zjistili,

Více

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Dle čl. 7 odst. 2 Směrnice děkana pro realizaci bakalářských

Více

MIKROBIOLOGIE V BIOTECHNOLOGII

MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického

Více

Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti

Více

Masarykova univerzita v Brně, Fakulta lékařská

Masarykova univerzita v Brně, Fakulta lékařská Masarykova univerzita v Brně, Fakulta lékařská Obor: Všeobecné lékařství Biologie Testy předpokládají znalost středoškolské biologie. Hlavním podkladem při jejich přípravě byl "Přehled biologie" (Rosypal,

Více

BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc.

BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. BAKTERIÁLNÍ GENETIKA Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. -dědičnost u baktérií principiálně stejná jako u komplexnějších organismů -genom haploidní a značně menší Bakteriální genom

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 1. Struktura a replikace DNA Literatura: Alberts a kol.: Základy buněčné biologie Espero Publishing, 2000 Garrett & Grisham: Biochemistry 2nd ed., Saunders

Více

METODY STUDIA PROTEINŮ

METODY STUDIA PROTEINŮ METODY STUDIA PROTEINŮ Mgr. Vlasta Němcová vlasta.furstova@tiscali.cz OBSAH PŘEDNÁŠKY 1) Stanovení koncentrace proteinu 2) Stanovení AMK sekvence proteinu Hmotnostní spektrometrie Edmanovo odbourávání

Více

Sekvenování příští generace (Next Generation Sequencing, NGS)

Sekvenování příští generace (Next Generation Sequencing, NGS) Sekvenování příští generace (Next Generation Sequencing, NGS) Přednáška 6, 2013/14 Ivo Papoušek Next generation sequencing poptávka po nízkonákladovém sekvenování vyvolala tlak na vývoj high-throughput

Více

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR)

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek

Více

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům Karlova univerzita, Lékařská fakulta Hradec Králové Obor: všeobecné lékařství - test z biologie Vyberte tu z nabídnutých odpovědí (1-5), která je nejúplnější. Otázka Odpověď 1. Mezi organely membránového

Více

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce

Více

Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka

Více

Příprava rekombinantních molekul pro diagnostické účely

Příprava rekombinantních molekul pro diagnostické účely 1 Příprava rekombinantních molekul pro diagnostické účely doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 2 Obsah přednášky 1) Pojem rekombinantní DNA 2) Historické milníky

Více

Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich

Více

GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných

Více

Struktura nukleových kyselin Vlastnosti genetického materiálu

Struktura nukleových kyselin Vlastnosti genetického materiálu Struktura nukleových kyselin Vlastnosti genetického materiálu V předcházejících kapitolách bylo konstatováno, že geny jsou uloženy na chromozomech a kontrolují fenotypové vlastnosti a že chromozomy se

Více

FLUORESCENČNÍ MIKROSKOP

FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po

Více

Kde se NK vyskytují?

Kde se NK vyskytují? ukleové kyseliny Kde se K vyskytují? Struktura ukleotid H 2 - H báze Zbytek kyseliny fosforečné H Cukerná složka H H H H H H H H H H H ribosa β-d-ribofuranosa H H H H H H H H H H deoxyribosa 2-deoxy-β-D-ribofuranosa

Více

Otázka: Nebuněčné a prokaryotické organismy. Předmět: Biologie. Přidal(a): Kristýna Brandová VIRY: CHARAKTERISTIKA

Otázka: Nebuněčné a prokaryotické organismy. Předmět: Biologie. Přidal(a): Kristýna Brandová VIRY: CHARAKTERISTIKA Otázka: Nebuněčné a prokaryotické organismy Předmět: Biologie Přidal(a): Kristýna Brandová VIRY: CHARAKTERISTIKA vir= x částic, virion= 1 částice můžeme/nemusíme je zařadit mezi živé organismy stejné chemické

Více

Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k

Více

Škola: Střední škola obchodní, České Budějovice, Husova 9. Inovace a zkvalitnění výuky prostřednictvím ICT

Škola: Střední škola obchodní, České Budějovice, Husova 9. Inovace a zkvalitnění výuky prostřednictvím ICT Škola: Střední škola obchodní, České Budějovice, Husova 9 Projekt MŠMT ČR: EU PENÍZE ŠKOLÁM Číslo projektu: CZ.1.07/1.5.00/34.0536 Název projektu školy: Výuka s ICT na SŠ obchodní České Budějovice Šablona

Více

1 Biochemické animace na internetu

1 Biochemické animace na internetu 1 Biochemické animace na internetu V dnešní době patří internet mezi nejužívanější zdroje informací. Velmi často lze pomocí internetu legálně stáhnout řadu již vytvořených výukových materiálů sloužících

Více

Translace (druhý krok genové exprese)

Translace (druhý krok genové exprese) Translace (druhý krok genové exprese) Od RN k proteinu Milada Roštejnská Helena Klímová 1 enetický kód trn minoacyl-trn-synthetasa Translace probíhá na ribosomech Iniciace translace Elongace translace

Více

Nukleové kyseliny Replikace DNA Doc. MVDr. Eva Bártová, Ph.D.

Nukleové kyseliny Replikace DNA Doc. MVDr. Eva Bártová, Ph.D. Nukleové kyseliny Replikace DNA 2013 Doc. MVDr. Eva Bártová, Ph.D. Nukleové kyseliny 7% cytozin Monomer: NUKLEOTID, tvoří jej: uracil kyselina fosforečná pentóza (ribóza, deoxyribóza) tymin organická dusíkatá

Více

Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie

Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie Centrální dogma molekulární biologie ukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Transkripce D R Translace rotein Mendel) Replikace 1869 objev nukleových kyselin (Miescher) 1944 nukleové kyseliny

Více

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci

Více

PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER

PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER Trojan V., Hanáček P., Havel L. Department of Plant Biology, Faculty of Agronomy, Mendel University of Agriculture and Forestry in Brno, Zemedelska

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2 http://www.paternityexperts.com/basicgenetics.html

Více

Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký

Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký Kapitola 3 Biomolecular Design and Biotechnology Překlad: Jaroslav Krucký Problémy chemie a biologie mohou být velmi nápomocné, jestliže se naše schopnost vidět to, co děláme, a dělat věci na atomární

Více

~ 10 base pairs (3.4 nm)

~ 10 base pairs (3.4 nm) Metody molekulární biologie 1. Manipulace s DNA - mutace, delece, - genomová DNA x cdna - restrikční endonukleasy a enzymy modifikující DNA - DNA a RNA polymerasy - syntetické oligonukleotidy (primery

Více

Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin

Více

Globální pohled na průběh replikace dsdna

Globální pohled na průběh replikace dsdna Globální pohled na průběh replikace dsdna 3' 5 3 vedoucí řetězec 5 3 prodlužování vedoucího řetězce (polymerace ) DNA-ligáza směr pohybu enzymů DNA-polymeráza I DNA-polymeráza III primozom 5' 3, 5, hotový

Více

První testový úkol aminokyseliny a jejich vlastnosti

První testový úkol aminokyseliny a jejich vlastnosti První testový úkol aminokyseliny a jejich vlastnosti Vysvětlete co znamená pojem α-aminokyselina Jaký je rozdíl mezi D a L řadou aminokyselin Kolik je základních stavebních aminokyselin a z čeho jsou odvozeny

Více

Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,

Více

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases

Více

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika

Více

Genetický screening predispozice k celiakii

Genetický screening predispozice k celiakii VETERINÁRN RNÍ A FARMACEUTICKÁ UNIVERZITA BRNO Farmaceutická fakulta Ústav humánn nní farmakologie a toxikologie Genetický screening predispozice k celiakii RNDr. Ladislava Bartošov ová,ph.d. 1, PharmDr.

Více

Molekulární základ dědičnosti

Molekulární základ dědičnosti Molekulární základ dědičnosti Dědičná informace je zakódována v deoxyribonukleové kyselině, která je uložena v jádře buňky v chromozómech. Zlomovým objevem pro další rozvoj molekulární genetiky bylo odhalení

Více

Biosyntéza a metabolismus bílkovin

Biosyntéza a metabolismus bílkovin Bílkoviny Biosyntéza a metabolismus bílkovin lavní stavební materiál buněk a tkání Prakticky jediný zdroj dusíku pro heterotrofní organismy eexistují zásobní bílkoviny nutný dostatečný přísun v potravě

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Přehled Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymerasa Princip procesu PCR Optimalizace PCR Typy PCR Aplikace

Více