Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace

Rozměr: px
Začít zobrazení ze stránky:

Download "Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace"


1 Mutace

2 Klasifikace mutací Z hlediska lokalizace mutací v genotypu Genové mutace Chromozomální mutace Genomové mutace

3 Vznik genových mutací Tranzice pyrim. za pyrim. C na T T na C purin za purin A na G G na A Příklad: A-T A-C T-A mutace normální

4 Vznik genových mutací Transverze purin za pyrim. A na T, C G na C,T pyrim. za purin T na A, G C na G, A A-T A-T T-C A-T mutace normální T-A...

5 Mechanismus vzniku mutací - příklad genové mutace - delece ZLOM YPERIT FRAGMENT Alkylace ZLOM Porušení diesterových vazeb

6 Mechanismus vzniku mutací - příklady genové - KOFEIN KOFEIN Porucha replikace DEFICIENCE (DELECE)

7 Mechanismus vzniku mutací - příklady genových mutací Změna komplementarity Substituce analogy bází Inzerce A T C G T A C G C G A C A T G C G C G C G C T A T A A Bu A T G C G C T A G C G C

8 Vznik genových mutací Ve stabilní DNA mutagen A T A Bu

9 Vznik genových mutací Při replikaci mutagen

10 Vznik genových mutací Při translaci mutagen U-G-G U-C-G serin prolin

11 Vznik genových mutací Při transkripci mrna mutagen

12 Vznik chromozomových mutací Intrachromozomální A B C D Delece B C D A B C D Deficience A C D

13 Vznik chromozomových mutací Intrachromozomální A B C D Inverze A C B D Rig. chr. A B C D Duplikace A BC BC D

14 Vznik chromozomových mutací Interchromozomální Robertsonská translokace (chr. fuse) Tandemová translokace

15 Mechanismus vzniku mutací Genomové t. aneuploidie a) nondisjunkce při meiose Normální meiosa Meiosa s nondisjunkcí

16 Mechanismus vzniku mutací Gemómové t. aneuploidie b) anafáze lag při meiose Normální meioza Meioza anafáze lag

17 Mechanismus vzniku mutací Genomové t. aneuploidie aa) při mitoze bb) při mitoze Mitoza s nondisjuncí Mitoza anafáze lag

18 Mechanismus vzniku mutací a) endomitosou Genomové t. euploidie MITOZA ENDOMITOZA TETRAPLOIDIE Mitotická polyploidie

19 Mechanismus vzniku mutací Gemómové t. euploidie b) oplozením diploidní gamety TRIPLOIDIE + diploidní vajíčko haploidní spermie Meiotická polyploidie

20 Abnormální karyotypy Změny v počtu chromozomů Polyploidie Aneuploidie - násobky celé sady chromozomů - vznikají endomitózou (dělení chromozomů bez rozdělení buňky) - změna počtu jednotlivých chromozomů - vznikají poruchou mitózy (nondisjunkcí, anafází lag)

21 Abnormální karyotypy Frekvence nejčastějších trisomií Na 1000 živě narozených dětí Trisomie 21 1,2 Downův syndrom Trisomie 18 0,2 Edwardsův syndrom Trisomie 13 0,1 Patauův syndrom (delece na 5. chr. 0,05 Syndrom kočičího křiku)

22 Abnormální karyotypy Závislost VCA na věku matky Počet na 1000 narozených dětí (otec v podstatě neovlivňuje) u 20 letých matek 1 u 30 letých matek 1,5 u 36 letých matek 7 u 40 letých matek 15 u 45 letých matek 50

23 Abnormální karyotypy Četnost vrozených chromozomálních anomálií (VCA) - nese ji 30-50% fertilizovaných vajíček - 0,5% tj. 1 z 200 narozených dětí - 2,5% nedonošených dětí - cca 5% mrtvě narozených dětí - většina plodů s chrom. anomálií je potracených - aberace pohlavních chromozomů u chlapců je cca 2x vyšší

24 Abnormální karyotypy Početní zastoupení VCA ve spontánních potratech Monosomie 19 % Trisomie 51 % Triploidie 18 % Teraploidie 6% Strukturální přestavby 6%

25 Abnormální karyotypy Anomálie pohlavních chromozomů Nese je 0,21 % novorozenců 0,14 % dívek 0,27 % chlapců

26 Abnormální karyotypy Typy anomálií a jejich frekvence v populaci Turnerův syndrom (monosomie X) X chybění jednoho ze dvou X chromozomů ženy 0,08/1000 porodů - infertilita - mentální retardace - nízký vzrůst - absence sekundárních pohlavních znaků - degenerace ovarií - aj.

27 Turnerův syndrom (monosomie X)

28 Abnormální karyotypy Typy anomálií a jejich frekvence v populaci Supersamice (trisomie X) XXX jeden chromozom X navíc u ženy 0,5/1000 porodů - snížená inteligence - často schizofrenie - někdy neplodnost - poruchy menstruace a klimakteria

29 Abnormální karyotypy Typy anomálií a jejich frekvence v populaci Klinefelterův syndrom XXY jeden chromozom X navíc u muže 1,0/1000 porodů - podobnost Downovu syndromu ale normální vzrůst - mentální retardace - infertilita - eunuchoidní vzhled

30 Klinefelterův syndrom

31 13 letý pacient s Klinefelterovým syndromem a karyotypem 47XXY

32 Abnormální karyotypy Typy anomálií a jejich frekvence v populaci Supersamec (polysomie Y) XYY jeden chromozom Y navíc u muže 0,8/1000 porodů - nadprůměrná výška - plodnost zachována - agresivita - zločinnost

33 Přehled nejvýznamnějších chromozomálních aberací ANEUPLOIDIE AUTOSOMŮ Downův syndrom - trisomie chromosomu 21-47, XY, +21 (nebo 47, XX, +21) - incidence 1/600 1/800 novorozenců - okrouhlá tvář, psychomotorická retardace, hypertelorismus, mongoloidní směr očních štěrbin, epikantus, vrozené srdeční vady, zvětšený jazyk - makroglosie (otevřená ústa), Bruchfieldovy skrny na duhovce

34 Downův syndrom

35 Karyotyp pacienta s Downovým syndromem

36 Přehled nejvýznamnějších chromozomálních aberací ANEUPLOIDIE AUTOSOMŮ Edwardsův syndrom - trisomie chromosomu 18-47, XY, +18 (47, XX, +18) - incidence 1 / / 5000 (1 / ) - syndaktylie, polydaktylie, dolichocefalie, mnohačetné malformace - těžce postižené dítě, které neprospívá a umírá zpravidla několik týdnů až měsíců po narození

37 Přehled nejvýznamnějších chromozomálních aberací ANEUPLOIDIE AUTOSOMŮ Patauův syndrom - trisomie chromosomu 13-47, XY, +13 (47, XX, +13) - incidence 1 / novorozenců - translokační formy [46,XX, t(13,13)] jsou velmi vzácné - rozštěp rtu a patra, polycystické ledviny - těžce postižené neprospívající děti - přežívají pouze několik dní až týdnů po narození

38 Přehled nejvýznamnějších chromozomálních aberací STRUKTURNÍ CHROMOZOMÁLNÍ ABERACE DELECE CHROMOZOMŮ Cri du chat syndrome (= cat cry syndrome), respektive syndrom kočičího pláče - incidence 1/ (novorozenců) - delece krátkého raménka chromozomu 5-46, XX, del (5p) nebo 46, XX, del 5p- (starší způsob zápisu) - u novorozenců pláč připomínající mňoukání kočky

39 Karyotyp spontánně potraceného plodu těžce postiženého vrozenými vývojovými vadami. Cytogetickým vyšetřením byla prokázána triploidie

40 Klasifikace mutací Z hlediska typu buněk, ve kterých mutace vznikají Gametické mutace Somatické mutace

41 Klasifikace mutací Z hlediska praktického Spontánní mutace Indukované mutace

42 Klasifikace mutací Podle nadřazenosti nebo podřazenosti mutované alely vůči původní Přímé mutace Zpětné mutace

43 Klasifikace mutací Podle účinku na fenotyp nositele se člení na mutace Vitální mutace Letální mutace

44 Klasifikace mutací Z evolučního hlediska Preferované mutace Neutrální mutace Zakázané mutace

45 Klasifikace mutací Z hlediska sekvencí v molekule DNA Mutace kódujících sekvencí Mutace nekódujících sekvencí

46 Klasifikace mutací Podle účinku mutované alely na množství, aktivitu nebo absenci enzymů Hypomorfní mutace Amorfní mutace Neomorfní mutace Antimorfní mutace Hypermorfní mutace

47 Mutace a reparace Mutagen Gen (chromozom) Reparační mechanismy Absorbce mutagenu Gen (chromozom) Premutační změna mutant reparovaný normální gen (chromozom)

48 Mutace a reparace - příklad reparací - endonukleáza endonukleáza DNA polymeráza A Bu A A T Bu DNA ligáza

49 Mutace a reparace - příklad reparací - endonukleáza A Bu A T A T

50 Mutace a reparace - příklad reparací - endonukleáza A Bu

51 Mutace a reparace - příklad reparací - endonukleáza Světlo A Bu A T Aktivace fotoreaktivních enzymů


http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649





Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;





Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický!

Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický! Karyologie Typy chromosomů A telocentrický B akrocentrický C submetacentrický D metacentrický Člověk nemá typ telocentrický! Chromosom chromosom telomera jádro centomera telomera buňka histony dvoušroubovice



CHROMOZOMÁLNÍ ABERACE CHROMOZOMÁLNÍ ABERACE Chromosomální aberace numerické (změny v počtu chromosomů) polyploidie - změna v počtu celých chromosomových sad triploidie tetraploidie aneuploidie - změna v počtu jednotlivých chromosomů


Vrozené vývojové vady. David Hepnar

Vrozené vývojové vady. David Hepnar Vrozené vývojové vady David Hepnar Vrozené vývojové vady (VVV) jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo



21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka


Karyologie. Typy chromosomů. Chromosom. Karyotyp člověka. Chromosomy. Koncové části lineárních chromosomů - telomery

Karyologie. Typy chromosomů. Chromosom. Karyotyp člověka. Chromosomy. Koncové části lineárních chromosomů - telomery Karyologie Typy chromosomů A telocentrický B akrocentrický C submetacentrický D metacentrický Člověk nemá typ telocentrický! Chromosom Koncové části lineárních chromosomů - telomery telomera chromosom


Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár

Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár schopen spontánní koncepce, ale žena není schopna donosit


Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením


Mutační změny genotypu

Mutační změny genotypu Mutační změny genotypu - změny genotypu: segregace, kombinace + MUTACE - náhodné změny Mutace - genové - spontánní - chromozómové - indukované (uměle vyvolané) - genomové A) Genové mutace - změna (ztráta)


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár


Prenatální diagnostika v roce 2008 předběžné výsledky

Prenatální diagnostika v roce 2008 předběžné výsledky Prenatální diagnostika v roce 28 předběžné výsledky V. Gregor 1, A. Šípek 1, 2 1 Oddělení lékařské genetiky, Fakultní Thomayerova nemocnice, Praha 2 3.Lékařská fakulta Univerzity Karlovy, Praha Pracovní


- karyotyp: 47, XX, +18 nebo 47, XY, +18 = trizomie chromozomu 18 (po Downově syndromu druhou nejčatější trizomii)

- karyotyp: 47, XX, +18 nebo 47, XY, +18 = trizomie chromozomu 18 (po Downově syndromu druhou nejčatější trizomii) Edwardsův syndrom Edwardsův syndrom - karyotyp: 47, XX, +18 nebo 47, XY, +18 = trizomie chromozomu 18 (po Downově syndromu druhou nejčatější trizomii) - Prevalence v populaci: u narozených dětí cca 1:6500-1:8000,


MUTACE mutageny: typy mutací:

MUTACE mutageny: typy mutací: MUTACE charakteristika: náhodné změny v genotypu organismu oproti normálu jsou poměrně vzácné z hlediska klinické genetiky, jsou to právě mutace, které způsobují genetické choroby nebo nádorové bujení


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Chromozomální aberace nalezené u párů s poruchou reprodukce v letech

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech Chromozomální aberace nalezené u párů s poruchou reprodukce v letech 2000-2005 Jak přistupovat k nálezům minoritních gonozomálních mozaik? Šantavá A., Adamová, K.,Čapková P., Hyjánek J. Ústav lékařské


Proč je dobré studovat genetické procesy na úrovni buňky? Například proto, že odchylky počtu nebo struktury chromozomů mohou způsobit:

Proč je dobré studovat genetické procesy na úrovni buňky? Například proto, že odchylky počtu nebo struktury chromozomů mohou způsobit: Cytogenetika Proč je dobré studovat genetické procesy na úrovni buňky? Například proto, že odchylky počtu nebo struktury chromozomů mohou způsobit: mentální nebo psychomotorickou retardaci, poruchy vývoje


Genetické příčiny sterility a infertility v ambulantní gynekologické praxi. Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R.

Genetické příčiny sterility a infertility v ambulantní gynekologické praxi. Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R. Genetické příčiny sterility a infertility v ambulantní gynekologické praxi Šantavý J., Čapková P., Šantavá A., Kolářová J., Adamová K., Vrtěl R. Infertilita Definice: Neschopnost otěhotnět v průběhu jednoho


Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní



ší šířen CYTOGENETIKA CYTOGENETIKA V této kapitole se budeme zabývat genetickým álem lokalizovaným v buněčném jádře v útvarech zvaných chromosomy. Morfologie chromosomů se dynamicky mění během buněčného děl; v interfázi jsou


Základy klinické cytogenetiky chromosomy

Základy klinické cytogenetiky chromosomy Základy klinické cytogenetiky chromosomy Hanáková M. SHRNUTÍ PŘEDNÁŠKY chromosomy metody přípravy chromosomových preparátů, hodnocení chromosomů, metody molekulární cytogenetiky vrozené chromosomové aberace


Příčiny a projevy abnormálního vývoje

Příčiny a projevy abnormálního vývoje Příčiny a projevy abnormálního vývoje Ústav histologie a embryologie 1. LF UK v Praze MUDr. Filip Wagner Předmět: Obecná histologie a obecná embryologie (B02241) 1 Vrozené vývojové vady vývojové poruchy


VROZENÉ CHROMOSOMOVÉ ABERACE. Vytvořilo Oddělení lékařské genetiky FN Brno



Mutageneze vznik chyby na DNA mutagen (chemická látka / záření)

Mutageneze vznik chyby na DNA mutagen (chemická látka / záření) Genotoxicita - úvod Genotoxicita: toxická látka ovlivňuje genetický materiál buňky (nukleové kyseliny) Při působení vyšších koncentrací genotoxických látek dochází k přímému úhynu buněk Nižší koncentrace


Klinefelterův syndrom

Klinefelterův syndrom Klinefelterův syndrom Vypracovali: Nikola Hrdá, Jakub Mušuka, Tereza Navrátilová, Peter Slodička, Eva Štefániková, Štefan Šuška, Nikola Tkáčová, Vojtěch Svízela Klinefelterův syndróm genetické onemocnění,



Buněčné dělení ŘÍZENÍ BUNĚČNÉHO CYKLU BUNĚČNÝ CYKLUS Buněčné dělení Cykliny a na cyklinech závislé proteinkinázy (Cyclin- Dependent Protein Kinases; Cdk-proteinkinázy) - proteiny, které jsou součástí řídícího systému buněčného cyklu 8 cyklinů


Význam genetického vyšetření u pacientů s mentální retardací

Význam genetického vyšetření u pacientů s mentální retardací Význam genetického vyšetření u pacientů s mentální retardací Šantavá, A., Hyjánek, J., Čapková, P., Adamová, K., Vrtěl, R. Ústav lékařské genetiky a fetální medicíny FN a LF UP Olomouc Mentální retardace


8 cyklinů (A, B, C, D, E, F, G a H) - v jednotlivých fázích buněčného cyklu jsou přítomny určité typy cyklinů

8 cyklinů (A, B, C, D, E, F, G a H) - v jednotlivých fázích buněčného cyklu jsou přítomny určité typy cyklinů Buněč ěčné dělení BUNĚČ ĚČNÝ CYKLUS ŘÍZENÍ BUNĚČ ĚČNÉHO CYKLU cykliny a na cyklinech závislé proteinkinázy (Cyclin-Dependent Protein Kinases; Cdk-proteinkinázy) - proteiny, které jsou součástí řídícího


Downův syndrom. Renata Gaillyová OLG FN Brno

Downův syndrom. Renata Gaillyová OLG FN Brno Downův syndrom Renata Gaillyová OLG FN Brno Zastoupení genetických chorob a vývojových vad podle etiologie 0,6 %-0,7% populace má vrozenou chromosomovou aberaci incidence vážných monogenně podmíněných


Cytogenetika. 4. Onkologická (kostní dřeň, periferní lymfocyty, nádorová tkáň)

Cytogenetika. 4. Onkologická (kostní dřeň, periferní lymfocyty, nádorová tkáň) Cytogenetika 1. Postnatální (periferní lymfocyty) 2. Prenatální (amniocyty, fibroblasty z plodové vody, chorium, placentální tkáň, pupečníková krev, sekční materiál.) 3. Preimplantační (buňky rýhujícího


Genetická variabilita - mutace

Genetická variabilita - mutace Genetická variabilita - mutace Kromě vzniku mechanizmu uchování a přenosu genetické informace je umožnění jejích změn - variability - základní podmínkou evoluce života. Výsledkem genetické variability


Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Chromozomová teorie dědičnosti KBI / GENE Mgr. Zbyněk Houdek Proč octomilka a T.H. Morgan? Drosophila melanogaster ideální objekt pro genetický výzkum : Rychlý reprodukční cyklus a snadný chov v laboratorních


Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny

Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny Otázka: Molekulární genetika, genetika buněk Předmět: Biologie Přidal(a): jeti52 Molekulární genetika: Do roku 1953 nebylo přesně známa podstata genetické informace, genů, dědičnosti,.. V roce 1953 Watson


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.


GENOTOXICITA LÉČIV. Klára A. Mocová. VŠCHT Praha Fakulta technologie ochrany prostředí Ústav chemie ochrany prostředí

GENOTOXICITA LÉČIV. Klára A. Mocová. VŠCHT Praha Fakulta technologie ochrany prostředí Ústav chemie ochrany prostředí GENOTOXICITA LÉČIV Klára A. Mocová VŠCHT Praha Fakulta technologie ochrany prostředí Ústav chemie ochrany prostředí Centralizovaný rozvojový projekt MŠMT č. C29: Integrovaný systém vzdělávání v oblasti


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM



CYTOGENETIKA MUTACE A JEJICH KLINICKÉ DOPADY CYTOGENETIKA MUTACE A JEJICH KLINICKÉ DOPADY Emil Rudolf rudolf@lfhk.cuni.cz 1879 Arnold publikuje zprávu o lidských chromozomech v mitóze 1956 Tjio a Levan určují počet lidských chromosomů (46) a vyvíjejí



TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI



CYTOGENETIKA MUTACE A JEJICH KLINICKÉ DOPADY CYTOGENETIKA MUTACE A JEJICH KLINICKÉ DOPADY CHROMOZOMY A PORUCHY 100% všech známých znaků (chorob) vztah ke genetické výbavě jedince Chromozomální vady - přes 200 známých syndromů Frekvence výskytu stoupá


Genetika člověka / GCPSB. Radim Vrzal

Genetika člověka / GCPSB. Radim Vrzal Genetika člověka / GCPSB Radim Vrzal Analýza chromosomů a s nimi spojených nemocí (část I.) Genetický materiál: Chromosomy Série buněčných dělení Zygota + Úkoly genetického systému Jak každá buňka dostane



CYTOGENETIKA MUTACE A JEJICH KLINICKÉ DOPADY CYTOGENETIKA MUTACE A JEJICH KLINICKÉ DOPADY CHROMOZOMY A PORUCHY 100% všech známých znaků (chorob) vztah ke genetické výbavě jedince Chromozomální vady - v současné době přes 200 známých syndromů Frekvence


Dědičnost kvantitativních znaků. Proměnlivost a dědivost. Mutace

Dědičnost kvantitativních znaků. Proměnlivost a dědivost. Mutace Přehled GMH Seminář z biologie Genetika 3 Dědičnost kvantitativních znaků Kvantitativní znaky mají kontinuální proměnlivost a jsou polygenní. Za velikost znaku je většinou zodpovědný systém několika genů


Neinvazivní testování 2 roky v klinické praxi. Jaroslav Loucký, Darina Kostelníková, Michal Zemánek, Eva Loucká, Milan Kovalčík

Neinvazivní testování 2 roky v klinické praxi. Jaroslav Loucký, Darina Kostelníková, Michal Zemánek, Eva Loucká, Milan Kovalčík Neinvazivní testování 2 roky v klinické praxi. Jaroslav Loucký, Darina Kostelníková, Michal Zemánek, Eva Loucká, Milan Kovalčík Odkud pocházejí zdroje informací využívané ve screeningu? U těhotenství s


Jihočeská univerzita v Českých Budějovicích Zdravotně sociální fakulta. Výskyt chromozomálních aberací v České republice.

Jihočeská univerzita v Českých Budějovicích Zdravotně sociální fakulta. Výskyt chromozomálních aberací v České republice. Jihočeská univerzita v Českých Budějovicích Zdravotně sociální fakulta Výskyt chromozomálních aberací v České republice bakalářská práce Jméno autora: Ivana Landová, DiS. 2010 Vedoucí práce: prof. Ing.


Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) www.uhkt.cz/nrl/db Chromosomové změny Unique - Britská svépomocná skupina



http://www.accessexcellence.org/ab/gg/chromosome.html 3. cvičení Buněčný cyklus Mitóza Modifikace mitózy 1 DNA, chromosom genetická informace organismu chromosom = strukturní podoba DNA během dělení (mitózy) řetězec DNA (chromonema) histony další enzymatické


Živočišné tkáně. Vznik - histogeneze diferenciace proliferace

Živočišné tkáně. Vznik - histogeneze diferenciace proliferace Živočišné tkáně Vznik - histogeneze diferenciace proliferace Soudržnost, adhezivita. Mezibuněčná hmota!! - vláknitá kolagen, elastin amorfní voda, anorg, ionty, glykosoaminoglykany a strukturální glykoproteiny


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly





1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická


Hermafroditismus - pohlavni rozmnozovani, ten jedinec je schopen produkce obou typu pohlavnich bunek (gonády samčí i samičí)

Hermafroditismus - pohlavni rozmnozovani, ten jedinec je schopen produkce obou typu pohlavnich bunek (gonády samčí i samičí) Otázka: Genetika Předmět: Biologie Přidal(a): Klára Mavrov Hermafroditismus - pohlavni rozmnozovani, ten jedinec je schopen produkce obou typu pohlavnich bunek (gonády samčí i samičí) Obligatni hermafrodit



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


DNA - dvojšroubovice. Chromatin chromozom. Karyotyp člověka. Dělení buněk

DNA - dvojšroubovice. Chromatin chromozom. Karyotyp člověka. Dělení buněk Genetika genetická podmíněnost nemocí Genetika, genomika genetika specializovaný biologický obor zabývající se variabilitou a dědičností klinická genetika zabývá se diagnostikou, léčením a prevencí genetických


Neinvazivní test nejčastějších chromosomálních vad plodu z volné DNA

Neinvazivní test nejčastějších chromosomálních vad plodu z volné DNA PRENATÁLN Í TEST PANORA M A TM Neinvazivní test nejčastějších chromosomálních vad plodu z volné DNA Panorama TM test TM test je vyšetření je vyšetření DNA, DNA, které které Vám Vám poskytne poskytne důležité


Lekce 7 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. CYTOGENETIKA

Lekce 7 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. CYTOGENETIKA Lekce 7 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. CYTOGENETIKA Cytogenetika se zabývá studiem organizace genomu a struktury a funkce chromozómů u eukaryot. Genom je souhrn veškeré DNA buňky. Poskytuje


Proč jsme podobní rodičům? A jak k tomu vlastně může dojít?

Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Základy genetiky Proč jsme podobní rodičům? A jak k tomu vlastně může dojít? Johann Gregor Mendel (1822 1884) O jeho životě byl mnich, zakladatel genetiky a opat augustiniánského kláštera v Brně studium


A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům Karlova univerzita, Lékařská fakulta Hradec Králové Obor: všeobecné lékařství - test z biologie Vyberte tu z nabídnutých odpovědí (1-5), která je nejúplnější. Otázka Odpověď 1. Mezi organely membránového


Incidence hypotrofických. ková, jr., Pavel Langhammer

Incidence hypotrofických. ková, jr., Pavel Langhammer Incidence hypotrofických novorozenců včr Antonín Šípek, Jitka Rychtaříkov ková, Vladimír r Gregor, Antonín Šípek jr., Pavel Langhammer Cíle: Retrospektivní studie dat s analýzou četností hypotrofických


Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální


Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat



JEDINEČNOST POROZUMĚNÍ 6 18 18 19 19 9 JEDINEČNOST POROZUMĚNÍ y 1 x 20 21 22 2 3 17 16 1 1 13 6 12 7 11 8 10 y 1 x 20 21 22 2 3 17 16 1 6 Neinvazivní prenatální test pro určení chromozomálních abnormalit plodu napříč celým genomem



VÝSLEDKY, KTERÝM MŮŽETE DŮVĚŘOVAT VÝSLEDKY, KTERÝM MŮŽETE DŮVĚŘOVAT Neinvazivní prenatální test detekuje: Aneuploidie Mikrodeleční syndromy Pohlaví plodu Trisomie 3,8,2 Trisomie pohlavních chromosomů (XXX,XXY, XYY) Monosomie X ( Turnerův





Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření

Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření Sondy k detekci aneuploidií a mikrodelečních syndromů pro prenatální i postnatální vyšetření Název sondy / vyšetřovaného syndromu vyšetřovaný gen / oblast použití Fast FISH souprava prenatálních sond DiGeorge


Zvláš. áštnosti studia genetiky člověka: nelze z etických důvodd experimenty a selekci. ství potomků. ším m prostřed (sociáln ůže sledovat maximáln

Zvláš. áštnosti studia genetiky člověka: nelze z etických důvodd experimenty a selekci. ství potomků. ším m prostřed (sociáln ůže sledovat maximáln Genetika člověka Zvláš áštnosti studia genetiky člověka: Na člověku nelze z etických důvodd vodů provádět experimenty a selekci. Člověk k mám většinou za život velmi malé množstv ství potomků. Fenotyp



DOWNŮV SYNDROM - JEHO OBRAZ Z LÉKAŘSKÉHO HLEDISKA DOWNŮV SYNDROM - JEHO OBRAZ Z LÉKAŘSKÉHO HLEDISKA Jan Šmarda Anotace: Humánní lékařství zná desítky lidských syndromů (většinou pojmenovaných podle jejich objevitelů) vyplývajících z numerických aberací


Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci


ZÍSKANÉ CHROMOSOMOVÉ ABERACE. Vytvořilo Oddělení lékařské genetiky FN Brno

ZÍSKANÉ CHROMOSOMOVÉ ABERACE. Vytvořilo Oddělení lékařské genetiky FN Brno ZÍSKANÉ CHROMOSOMOVÉ ABERACE CHROMOSOMOVÉ ABERACE (CHA) Cílem cytogenetického vyšetření je zjištění přítomnosti / nepřítomnosti chromosomových aberací (patologických chromosomových změn) TYPY ZÍSKANÝCH



TERATOGENEZA ONTOGENEZA TERATOGENEZA ONTOGENEZA Vrozené vývojové vady (VVV) Jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo 3-5 % novorozenců.


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy molekulární a buněčné biologie Přípravný kurz Komb.forma studia oboru Všeobecná sestra Genetický aparát buňky DNA = nositelka genetické informace - dvouvláknová RNA: jednovláknová mrna = messenger


Incidence hypotrofických novorozenců v ČR

Incidence hypotrofických novorozenců v ČR Incidence hypotrofických novorozenců v ČR Antonín Šípek 1,2, Jitka Rychtaříková 3, Vladimír Gregor 1,4, Antonín Šípek jr. 5, Pavel Langhammer 6 OLG, Fakultní Thomayerova nemocnice, Praha 1 3. Lékařská


14. 1. 2013. Popis využití: Výukový materiál s úkoly pro žáky s využitím dataprojektoru,

14. 1. 2013. Popis využití: Výukový materiál s úkoly pro žáky s využitím dataprojektoru, VY_32_INOVACE_PSYPS13260ZAP Výukový materiál v rámci projektu OPVK 1.5 Peníze středním školám Číslo projektu: CZ.1.07/1.5.00/34.0883 Název projektu: Rozvoj vzdělanosti Číslo šablony: III/2 Datum vytvoření:



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


Vrozené chromosomové aberace. LF MU 2015 Renata Gaillyová

Vrozené chromosomové aberace. LF MU 2015 Renata Gaillyová Vrozené chromosomové aberace LF MU 2015 Renata Gaillyová Zastoupení genetických chorob a vývojových vad podle etiologie 0,6 % populace má vrozenou chromosomovou aberaci incidence vážných monogenně podmíněných


Organizace genomu eukaryot a prokaryot GENE Mgr. Zbyněk Houdek Stavba prokaryotické buňky Prokaryotické jádro nukleoid 1 molekula 2-řetězcové DNA (chromozom kružnicová struktura), bez jaderné membrány.


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


DNA, komplementarita, dopsání komplementárního vlákna

DNA, komplementarita, dopsání komplementárního vlákna Příklady z genetiky Řešené příklady ze stránek http://genetika.wz.cz/priklady/. Jakákoli písemná publikace tohoto textu bez uvedení zdroje není povolena. DNA, komplementarita, dopsání komplementárního


Virtuální svět genetiky 1. Cytogenetika

Virtuální svět genetiky 1. Cytogenetika - struktura chromozomu se zabývá studiem dědičnosti a genetické informace na úrovni chromozomu za pomocí cytologických a genetických technik. Metacentrický má jednotlivá ramena stejně dlouhá Submetacetrický




Zeptejte se svého lékaře

Zeptejte se svého lékaře Jednoduchý a bezpečný krevní test, který nabízí vysokou citlivost stanovení Neinvazivní test, který vyhodnocuje riziko onemocnění chromozomálního původu, jako je např. Downův syndrom, a nabízí také možnost


Determinace pohlaví a evoluce pohlavních chromosomů

Determinace pohlaví a evoluce pohlavních chromosomů Determinace pohlaví a evoluce pohlavních chromosomů Radka Reifová Katedra zoologie Prezentaci naleznete na: http://web.natur.cuni.cz/~radkas/ v záložce Courses Jak vznikají dvě pohlaví Mechanismy determinace


Vrozené chromosomové aberace. LF MU 2013 Renata Gaillyová

Vrozené chromosomové aberace. LF MU 2013 Renata Gaillyová Vrozené chromosomové aberace LF MU 2013 Renata Gaillyová Zastoupení genetických chorob a vývojových vad podle etiologie 0,6 % populace má vrozenou chromosomovou aberaci incidence vážných monogenně podmíněných


Chromosomové translokace

Chromosomové translokace 12 Unique - Britská svépomocná skupina pro vzácné chromosomové vady. Tel: + 44 (0) 1883 330766 Email: info@rarechromo.org www.rarechromo Chromosomové translokace EuroGentest - Volně přístupné webové stránky


Význam. V minulosti se pouze u minority onemocnění předpokládala genetická souvislost.

Význam. V minulosti se pouze u minority onemocnění předpokládala genetická souvislost. Lékařská genetika Definice Lékařská genetika je široce interdisciplinární obor preventivní medicíny, který se zabývá prevencí a diagnostikou závažných dědičných nemocí a vad V návaznosti na jiné obory


Slovníček genetických pojmů

Slovníček genetických pojmů Slovníček genetických pojmů A Adenin 6-aminopurin; purinová báze, přítomná v DNA i RNA AIDS Acquired immunodeficiency syndrome syndrom získané imunodeficience, způsobený virem HIV (Human immunodeficiency



GENETIKA ÚVOD DO PROBLEMATIKY A CYTOGENETIKA. Biologie, 12, 2015/2016, Ivan Literák GENETIKA ÚVOD DO PROBLEMATIKY A CYTOGENETIKA Biologie, 12, 2015/2016, Ivan Literák GENETIKA je nauka o a Plně porozumět životu znamená porozumět dědičnosti termín genetika poprvé použil v r. 1905 W. BATESON
