ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

Rozměr: px
Začít zobrazení ze stránky:

Download "ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce"

Transkript

1 METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction) je metoda, která umožňuje z komplexní (celkové) DNA namnožit vybraný úsek, např. určitý exon analyzovaného genu, bez předchozího klonování ve vektorech (viz dále). Předpokladem je znalost pořadí basí na začátku a na konci požadované sekvence DNA pro syntézu krátkého (oligonukleotidového) jednovláknového úseku DNA; primeru dlouhého bp. Princip PCR je obdobou replikace nukleových kyselin. Během PCR reakce dochází k cyklickému opakování enzymové syntézy nových řetězců vybraných úseků dvouřetězcové DNA ve směru 5' 3', která je zprostředkovaná DNApolymerasou. Syntetizovaný úsek DNA je tepelně denaturován (při 95 o C) a se vzniklými dvěmi jednovláknovými molekulami DNA následně hybridizují primery (při o C). Napojm primerů je umožněna syntéza komplementárních vláken DNA (při o C), kterou zajišťuje DNA-dependentní-DNA-polymerasa Taq. Taq-polymerasa je izolovaná z bakterie vyskytující se v teplých pramenech a n proto inaktivována při vyšch teplotách v průběhu PCR reakce. DNA-polymerasa tvoří komplementární vlákna DNA podle matrice DNA jen od místa navázání primerů (navazováním nukleotidů k primeru - viz replikace). Časové omez PCR reakce určuje délku nově syntetizovaného vlákna DNA. Po 1. cyklu je replikovaný úsek DNA zdvojnásoben. Následuje dal denaturace a celý cyklus se opakuje. Množ vybraného úseku pokračuje geometrickou řadou. Po 30ti cyklech bývá DNA zmnožena řádově Tím, že PCR umožňuje získání relativně velkého množství DNA z velmi malých vzorků, nachází uplatnění v mnoha oblastech molekulární biologie. Metodu PCR schematicky znázorňuje následující obrázek. PCR je automatizovaný proces, který probíhá v přístroji označovaném thermocykler. Thermocykler je naprogramován tak, aby v jednotlivých teplotních krocích byly automaticky dodržované tepelné podmínky pro (a) denaturaci DNA, (b) pro připoj primerů a (c) tvorbu komplementárních vláken DNA. Reakční směs pro PCR obsahuje pufr (roztok, který udržuje stabilní ph), vzorek DNA, dostatečné množství všech čtyř typů nukleotidů (2'- deoxyribonukleosid-5'-trifosfáty dntp), primery a DNA-dependentní-DNA-polymerasu Taq. V reakční směsi jsou dále v optimalizované koncentraci přítomny hořečnaté ionty Mg 2+, ál elům m a dal řen

2 které tvoří rozpustný komplex s dntp, který rozpoznává DNA-polymerasa a chelační činidla (např. EDTA), která inhibují deoxyribonukleasy. PRINCIP METODY PCR (1 MOLEKULA) DENATURACE 1. CYKLUS PRIMERY Taq-POLYMERASA 2. CYKLUS CYKLUS 4. CYKLUS 5. CYKLUS (2 MOLEKULY) DENATURACE PRIMERY Taq-POLYMERASA (4 MOLEKULY) DENATURACE PRIMERY Taq-POLYMERASA (8 MOLEKUL) (16 MOLEKUL) ál elům m a dal řen (32 MOLEKUL)

3 Štěp DNA Restrikční endonukleasy Restrikční endonukleasy (restriktasy) jsou sekvenčně specifické bakteriální enzymy (endonukleasy), které chrání baktérii před vniknutím cizorodé DNA, například při infekci baktérie bakteriofágem. Cizí dvouvláknová DNA je restriktasou rozštěpena, vlastní DNA je proti působ enzymu chráněna (obvykle methylací některých basí). Restrikční endonukleasy mohou štěpit dvouvláknové molekuly DNA jakéhokoliv původu, pokud v nich existují pro ně specifická cílová místa štěp se specifickým pořadím basí pro určitou restriktasu. K rozštěp molekuly DNA dochází hydrolysou fosfodiesterových vazeb obou řetězců v restrikčním místě (místo štěp). Cílového místa jsou obvykle sekvence 4-6 bp. Štěp DNA může být uvnitř této cílové sekvence, případně před nebo za ní. Názvy restrikčních endonukleas jsou odvozovány od jména baktérie, ze které byly získány. V současné době je známo přes restriktas. Například restriktasa EcoR I byla získána z bakterie Escherichia coli, kmen RY 13. Cílová sekvence této restriktasy musí být na obou vláknech DNA shodná a štěp dvouvláknové molekuly DNA je od 5' konce. Pro restriktasu EcoR I to je mezi G a následující sekvencí AATTC od 5' konce (znázorněno značkou ), tzn. 5'-G AATTC-3'. Cílové sekvence tvoří velmi často palindrom (čt sekvence shodné z obou konců). Pokud dochází ke štěp DNA uprostřed palindromu, vznikají konce bez přesahů, tzv. tupé konce. Pokud nedochází ke štěp DNA uprostřed palindromu, vznikají přerušm fosfodiesterických vazeb DNA kohezní konce (lepivé konce, konce s přesahem), viz následující obrázek. 5'-AATGCTAATGCCTAGTCAAGCTTTCATCGAG AATTCCAGTCGAA-3' 3'-TTAGCTTTACGGATCAGTTCGAAAGTAGCTCTTAA GGTCAGCTT-5' 5'-AATGCTAATGCCTAGTCAAGCTTTCATCGAG 3'-TTAGCTTTACGGATCAGTTCGAAAGTAGCTCTTAA AATTCCAGTCGAA-3' GGTCAGCTT-5' ál elům m a dal řen

4 Několik příkladů běžných restrikčních endonukleas a jejich restrikčních míst je uvedeno v následující tabulce. Je uvedeno ze restrikční místo na jednom vlákně DNA ve směru 5' 3'. Bakteriální zdroj Název restriktázy Cílové místo štěp (dvouvláknová DNA) Arthrobacter luteus Alu I 5'-AG CT-3' (tupé konce) Bacillus amyloliquefaciens BamH I 5'-G GATCC-3' (kohezní konce) Escherichia coli RY 13 EcoR I 5'-G AATTC-3' (kohezní konce) Haemophilus influenzae Hind III 5'-A AGCTT-3' (kohezní konce) Moraxella sp. Msp I 5'-C CGG-3' (kohezní konce) Streptomyces albus Sal I 5'-G TCGAC-3' (kohezní konce) Staphylococcus aureus Sau 3A 5'- GATC-3' (kohezní konce) Thermus aquaticus Taq I 5'-T CGA-3' (kohezní konce) Restrikční mapy Působíme-li na izolovanou DNA určitou restriktasou, dojde k jejímu rozštěp na úseky (fragmenty) rozdílné délky podle umístění cílových sekvencí štěp v molekule DNA. Restrikční mapa ukazuje pomocí vzniklých fragmentů počet restrikčních míst v molekulách DNA a velikost fragmentů pro jednotlivé restrikčních endonukleasy. Informace jsou pak kompletovány pro molekuly DNA jednotlivých chromosomů. DNA rozdělená na jednotlivé fragmenty pak může být dále analyzována se zřetelem na polymorfismy v délce restrikčních fragmentů v populaci. Polymorfismy v délce fragmentů jsou podmíněné počtem párů basí mezi dvěma cílovými místy štěp. Jsou vyvolané např. mutací v cílovém místě štěp a tím jeho zrušm nebo různým počtem tandemových repetitivních sekvencí mezi dvěma místy štěp atp. Stanov polymorfismů genomů Detekce polymorfismů (rozdílů) se může týkat celé genomové, chromosomové nebo ál elům m a dal řen mitochondrální DNA, a nebo polymorfismů specifických genů nebo jejich specifických částí,

5 tzn. polymorfismů (rozdílů) v sekvenci (v pořadí nukleotidů) DNA. Rozdíly v sekvenci DNA mohou, ale nemusí ovlivnit určité fenotypové znaky. Identifikace a typizace určitých polymorfismů umožňuje rozliš jedinců např. s ohledem na preventivní opatř a léčbu choroby. Genotypové diagnostické metody (analýza DNA) jsou, na rozdíl od diagnózy podle fenotypových projevů, přesné. Pro stanov sekvenčního polymorfismu DNA mohou být žity přímé metody, kdy se stanovuje sekvence variabilní oblasti DNA (viz sekvencování) nebo nepřímé metody, založené na amplifikaci DNA nebo využívající restrikční endonukleasovou analýzu a selektivní hybridizaci restrikčních fragmentů se specifickými sondami. Dal techniky pro identifikaci polymorfismů využívají rozdílnou pohyblivost fragmentů DNA se standardní a mutantní formou genu při elektroforéze, která je odrazem konformačních polymorfismů nukleových kyselin. Vysoce rozlišovací techniky umožňují identifikaci i jednonukleotidových polymorfismů (SNP). Polymorfismus délky restrikčních fragmentů (RFLP) Působíme-li na izolovanou DNA jedince určitou restriktasou, dojde k jejímu rozštěp na úseky (fragmenty) rozdílné délky podle umístění cílových sekvencí štěp pro žitou restriktasu. DNA od různých jedinců stejného druhu pak může mít délku fragmentů (i jejich počet) buď shodnou, nebo rozdílnou. Pokud mezi jedinci téhož druhu při žití téže restriktázy nacházíme fragmenty rozdílné délky, pak hovoříme o polymorfismu v délce restrikčních fragmentů (RFLP Restriction Fragment Length Polymorphism). Vysvětlm vzniku polymorfismu délky restrikčních fragmentů může být například mutace některého nukleotidu v cílové sekvenci štěp (variabilní restrikční místo). Restriktasa pak v takto změněné cílové sekvenci neštěpí a vzniká fragment, jehož délka je součtem délek dvou sousedních původních fragmentů. Naopak je též možné, že mutací vznikne nová cílová sekvence a tak dojde ke zkrác délky restrikčního fragmentu. Jinou možností vzniku polymorfismu délky restrikčních fragmentů je včlenění, nebo vyčlenění, nukleotidů mezi dvěmi cílovými sekvencemi - variabilita krátkých tandemově opakujících se repetic. Pak jsou získány restrikční fragmenty del (respektive krat). Schematické znázornění shodných úseků DNA vykazujících rozdílné příčiny vzniku polymorfismu délky restrikčních fragmentů ukazuje následující schéma zobrazující situaci na jednom vlákně DNA. ál elům m a dal řen

6 a) dvě restrikční místa (3 fragmenty) 5' TAATGCCTTCTCAAGCTTTCATCGAG AATTCCAGTCGAAAGCTTTCATCGAG AATTCCAGT 3' b) první restrikční místo zrušeno záměnou nukleotidů A C; 2 fragmenty 5' TAATGCCTTCTCAAGCTTTCATCGAGACTTCCAGTCGAAAGCTTTCATCGAG AATTCCAGT 3' c) vznik nového (dalho) restrikčního místa záměnou nukleotidů CC AA; 4 fragmenty 5' TAATG AATTCTCAAGCTTTCATCGAG AATTCCAGTCGAAAGCTTTCATCGAG AATTCCAGT 3' d) variabilita krátkých repetitivních sekvencí, zde CGAT, vede v obou molekulách ke štěp na dva fragmenty, ale odlišné délky 5' CGAAAGCTTCGATCGATCGATCGATCGATCGATCGATCGATTCATCGAG AATTCC 3' 5' CGAAAGCTTCGATCGATCGATCGATCGATCGATCGATCGATCGATTCATCGAG AATTCC 3' Délka restrikčních fragmentů se dědí. Dědičnost se řídí pravidly Mendelovské genetiky (viz Monohybridismus). Velikosti restrikčních fragmentů můžeme hodnotit pomocí gelové elektroforézy. Fragmenty DNA mají záporný náboj, proto všechny fragmenty putují při jednosměrném proudu od záporné elektrody (-) k elektrodě kladné (+). Mezi nejžívaněj gelové nosiče patří agaróza a polyakrylamid, které působí molekulární síto (jsou porézní, velikost pórů určuje jejich hustota). Pomocí gelové elektroforézy můžeme rozdělit jednotlivé fragmenty DNA podle jejich velikosti. Malé molekuly (fragmenty) putují v gelu rychleji než velké. O rozlož jednotlivých restrikčních fragmentů v gelu se můžeme přesvědčit obarvm barvivem ethidiumbromidem. U eukaryotických genomů získáme z komplexní DNA vysoký počet fragmentů natolik velikostně rozdílných, že vytvářejí na elektroforetogramu souvislý pruh. V těchto případech žíváme pro identifikaci fragmentů, které potřebujeme pro dal analýzu, Southernovu metodu. ál elům m a dal řen

7 Southernův přenos Southernův přenos (blotting = "přepijákování") je metoda, která se žívá při zkoumání velikosti restrikčních fragmentů určitého úseku DNA. Principy Southernovy metody jsou následující: a) Pomocí vybrané restrikční endonukleasy je rozštěpena celková (komplexní) DNA získaná z jaderných buněk jedince. b) Získané fragmenty se rozdělí gelovou elektroforézou. c) Po denaturaci DNA jsou vzorky přeneseny na hybridizační membránu (nitrocelulóza nebo nylonová membrána). Gelové nosiče nejsou vhodné pro dal postupy protože jsou velmi křehké. d) Přenos (blotting) fragmentů z gelu na membránu se realizuje vzlínáním pufru z rezervoáru. e) Po přenes fragmentů nastupuje fixace fragmentů na podložku. f) Dalm krokem je hybridizace s radioaktivně značenou sondou (probou). Sondou bývá krátká sekvence DNA, která specificky hybridizuje s restrikčními fragmenty na základě komplementarity basí. Při diagnostice dědičných chorob je vybrána sonda, která je komplementární k fragmentu, na kterém leží vyšetřovaný gen (extragenová sonda) nebo je komplementární přímo s krátkou sekvencí vyšetřovaného genu (intragenová sonda). ál elům m a dal řen

8 g) Po opláchnutí nenavázané sondy se autoradiograficky hodnotí lokalizace fragmentů, u kterých došlo k hybridizaci sondy. Jako sondu lze např. žívat DNA z knihoven cdna (viz dále). cdna (komplementární DNA, copy DNA), je DNA získaná reversní transkripcí mrna. Takto získaná DNA nenese sekvence odpovídající intronům. V případě, že DNA analýzu nelze vyhodnotit ze pomocí délky nebo počtu restrikčních fragmentů, je možné využít dal metodu založenou na specifické hybridizaci vzorku DNA a to s tzv. alelově specifickou sondou. Alelově specifické sondy jsou oligonukleotidy o délce přibližně 20 bp, které hybridizují s neštěpenou denaturovanou DNA v místě, kde je úplná shoda všech komplementárních nukleotidů. Stačí tedy odchylka v jediném nukleotidu, aby k hybridizaci nedošlo. Alelově specifické sondy mohou tedy velmi citlivě stanovit i velmi malé genetické změny ve zkoumané DNA, pokud jsou lokalizovány v místě hybridizace sondy, nikoliv ale všechny mutace vyšetřovaného genu. Polymorfismus konformace jednořetězcových vláken DNA nebo RNA (SSCP) Polymorfismus jednořetězců nukleových kyselin ukazuje sekvenční rozdíly mezi alelami. Sekvenční rozdíly (i rozdíl jedné base) se odrazí na odlišné pohyblivosti vyšetřovaných jednořetězcových úseků DNA nebo RNA ( o velikosti pb) při nedenaturujících elektroforetických podmínkách. Polymorfismus konfirmace dvouřetězců (DSCP) Při pomalé renaturaci fragmentů DNA se vytvářejí duplexy DNA. Duplexy s úplnou komplementaritou basí (homoduplexy) mají v nedenaturujících gelech odlišnou (vyš) elektroforetickou pohyblivost než heteroduplexy, jejichž řetězce nemají úplnou komplementaritu basí. Heteroduplexy jsou důkazem bodových mutací v genomech. Sekvencování DNA Sekvencování DNA je stanov primární struktury, pořadí nukleotidů, v molekulách DNA. Cílem zkoumání je stanov pořadí nukleotidů celého genomu (např. projekt HUGO). Tato informace je základ pro exaktní genetickou diagnostiku a v perspektivě i pro kauzální genetickou terapii a odezvu jednotlivých pacientů na podání léčiva (farmakogenetika). K zjišťování pořadí (sekvence) basí v určitém úseku DNA se žívají různé metody sekvencování, často automatizované. ál elům m a dal řen

9 Jedna z žívaných metod je enzymová Sangerova metoda, která je založena na enzymově katalyzované terminaci syntézy DNA po zabudování dideoxyribonukleotidu (ddntp - 2',3'- dideoxyribonukleosid-5'-trifosfát) do nově vznikajícího komplementárního vlákna. Při sekvencování Sangerovou metodou je DNA, která má být sekvencována, žita matrice pro syntézu komplementárního vlákna. Dideoxyribonukleotidy se začleňují do vlákna syntetizované DNA náhodně na místo příslušného nukleotidu (2'-deoxyribonukleosid-5'- trifosfátu). Po zabudování dideoxyribonukleotidu, který postrádá 3'-OH skupinu, nemůže DNA-polymerasa k němu v důsledku nepřítomnosti 3'-OH skupiny připojit dal nukleotid a syntetizovaný řetězec DNA se nemůže dále prodlužovat. Výsledkem enzymové Sangerovy metody je vznik různě dlouhých fragmentů DNA, které nesou na konci určitý, fluorochromy nebo radioaktivně značený, dideoxyribonukleotid ddgtp, ddatp, ddttp, ddctp. Délka fragmentu a jeho koncový dideoxyribonukleotid informuje o sekvenci nukleotidů v analyzovaném vzorku DNA. Metoda je schematicky znázorněna na následujícím obrázku. Sekvencování je prováděno ve čtyřech vzorcích, kdy každý analyzovaný vzorek stanovuje pořadí jednoho ze čtyř nukleotidů. Každý analyzovaný vzorek obsahuje směs (i) čisté DNA, která má být sekvencována, (ii) značený primer, připojující se k vláknu analyzované DNA, (iii) směs všech čtyř nukleotidů (A, G, C, T) a v každém vzorku jeden ze čtyř ddntp, který je koncový inhibitor syntézy DNA a (iiii) DNA-polymerasu. ál elům m a dal řen

10 3' 5' Analyzovaná DNA (jednovláknová) 5' 3' Značený primer DNA-polymerasa, primer, nukleotidy - rozděl do čtyř zkumavek. Přidány jednotlivé ddntp: ddatp, ddctp, ddgtp, ddttp Následuje syntéza komplementárního vlákna (značeno barevně pro jednotlivé ddntp) ve směru 5' 3' podle analyzovaného vzorku jednovláknové DNA (černá čára; směr 3' 5') A C G T A C G T A C G T Elektroforéza A C G T - Sekvence nukleotidů je odečtena z gelu podle délky fragmentů s příslušnými koncovými ddntp Výsledná sekvence na syntetizovaném vlákně: 5'- C T A G T A G G T C C A - 3' Sekvence analyzované DNA (komplementarita párování basí): 3'- G A T C A T C C A G G T - 5' Automatické sekvencování Automatickém sekvencování je plně automatizovaný proces, který umožňuje rychlou analýzu vzorků. Při srovnání s výše uvedenou enzymovou metodou má tyto odlišnosti: (i) syntéza DNA je asymetrická polymerasová řetězová reakce, která probíhá v termocykleru za účasti Taq DNA-polymerasy; (ii) pro stanov produktů ončených specifickou basí se + ál elům m a dal řen

11 žívají čtyři odlišné fluorescenční značky; (iii) délka stanovené sekvence je mezi basemi. Detekce produktů sekvenčních reakcí probíhá v průběhu elektroforézy automaticky pomocí laserového detektoru napojeného na počítač, který z pořadí signálů přímo hodnotí sekvenci DNA. Obrázek ukazuje výsledek automatického sekvenování; převzato otevřená encyklopedie com). DNA čipy (expresní profilování), DNA microarrays DNA čipy jsou skleněné destičky, na které je umístěno velké množství cdna (desítky tisíc) nebo krátkých specifických sekvencí jednotlivých genů (mikromnožství pro každý vzorek). Hybridizace s fluorescenčním barvivem značenou sondou cdna, vytvořenou z mrna sledované tkáně, umožní stanovit, které geny jsou v této tkáni v daném období exprimovány (aktivní) a i intenzitu jejich transkripční aktivity. Vizualizace hybridizace se provádí v zaříz využívajícím počítačovou analýzu. Metoda expresního profilování na DNA čipech pomáhá stanovit v jednom vzorku souboru aktivitu velkého počtu genů, mnohdy i všech známých genů daného organismu. Hodnoc může být zaměřeno na různé situace je např. reakce organismu na působ nepříznivých vnějch podmínek nebo na expresi komplexu genů při různých onemocněních i s možností posoudit genovou expresi při jejich léčbě a to i se zřetelem k věku jedince (viz dále Prenatální vývoj a stárnutí organismu). V současné době n tato metoda využívána rutinně, je velmi nákladná. Vyžaduje oup drahého technického vybav a drahá je také syntéza primerů i proved PCR pro vytvoř DNA čipu. ál elům m a dal řen

12 Převzato otevřená encyklopedie com Genové inženýrství Kohezní konce jsou jednovláknové úseky DNA, které mohou na principu komplementarity bází hybridizovat s kohezním koncem i jiné DNA. Může tak dojít i k hybridizaci s cizí molekulou DNA, například plasmidu a eukaryotní buňky, pokud obě DNA byly štěpeny stejnou restriktasou. Použitím enzymu ligasy je možné vytvořit fosfodiesterovou vazbu a tak napojit úsek jedné DNA molekuly s úsekem jiné molekuly DNA. Tímto způsobem vzniká rekombinantní DNA. Pokud jde o kruhovou DNA plasmidu, musí hybridizaci předcházet linearizace molekuly DNA. Ke štěp a linearizaci je zvolena restriktasa, která DNA plasmidu štěpí ze v jednom místě a vytváří v místě štěp kohezní konce. Fragment lidské DNA (insert) má shodné kohezní konce linearizovaná DNA plasmidu, což umožňuje hybridizaci na koncích rozštěpené DNA plasmidu s fragmentem lidské DNA na základě komplementarity basí. Při hybridizaci se uplatňuje také, mimo jiné, enzym ligasa, který zajišťuje spoj vláken DNA. ál elům m a dal řen

13 působ restrikční endonukleasy na DNA plasmidu DNA plasmidu působ restrikční endonukleasy na lidskou DNA DNA plasmidu s inzertem lidské DNA Klonování lidské DNA Velikost genomu lidských buněk vyžaduje při molekulárně genetické analýze využití klonování DNA. Klonování DNA umožňuje např. štěp DNA restrikčními endonukleasami na fragmenty a vytvoř rekombinantní DNA s DNA vhodného vektoru (nosiče). Jako vektory se žívají bakteriální plasmidy, jinou možností je využití virového nosiče, jsou například bakteriofágy. Po vprav vektoru, například plasmidu do baktérie, je možné množit klony baktérií (tedy potomky jedné baktérie) s tímto vektorem a tím zapojit do procesu replikace zkoumaný úsek DNA. Touto metodou lze vytvořit genomové knihovny, tzn. různé klony baktérií s různými fragmenty DNA. Soubor klonů pak může představovat DNA celého eukaryotického genomu. Pro vytvář genomové knihovny savců je optimální délka fragmentů pro vprav do plasmidového vektoru okolo 40 kb. Jednotlivé fragmenty jsou připraveny tak, aby se jejich koncové sekvence navzájem překrývaly. Tím vznikají klony (knihovny genomové DNA), ve kterých fragmenty DNA vytvářejí informaci nejen o jednotlivých fragmentech, ale tím, že se vzájemně překrývají, i o jejich vzájemném sousedství (sledu) v komplexní DNA. Genomová DNA jednoho jedince je ve všech jeho buněčných typech stejná (s výjimkou buněk imunitního systému a nádorových buněk). Při konstrukci genomových knihoven se v současné době žívají i uměle vytvořené vektory. ál elům m a dal řen

14 cdna knihovny jsou vhodné pro zkoumání transkripčně aktivních genů. Principem je získání mrna z určitého typu buněk (určité tkáně, orgánu), které jsou specializované na tvorbu některého polypeptidu. Pomocí reverzní transkripce je pak získána cdna (komplementární), která je začleněna do vhodného vektoru a následně namnožena. cdna knihovny obsahují, na rozdíl od knihoven genomových, ze informaci o funkčních genech. Informace obsažená v cdna knihovnách je omezena ze na exony příslušného genu (viz úpravy mrna transkripce). Knihovny cdna buněk odlišných tkání nejsou identické, závisí na expresi genů v konkrétních buňkách určité tkáně. To znamená, že se bude lišit cdna knihovna např. buněk jater a svalové tkáně. DNA diagnostika Metody molekulární genetiky umožňují zpřesnění rizika onemocnění pro členy rodin s výskytem Mendelovsky děděných chorob. Metody DNA diagnostiky můžeme rozdělit na metody přímé a nepřímé. Přímé metody Pomocí metody PCR se amplifikují jednotlivé úseky genu, ve kterém je očekáván nález mutace, a jednotlivé části genu (fragmenty) se pak vyšetří na přítomnost mutace. (i) (ii) (iii) Metody SSCP a DSCP (viz výše), které využívají rozdíly ve fyzikálněchemickém chování molekul DNA nesoucích mutaci v porovnání se standardní molekulou DNA (bez mutace), kdy změna sekvence mění konformaci fragmentu DNA a tím i rychlost pohybu fragmentu v gelu. Přítomnost variabilního restrikčního místa (viz RFLP). V některých genech vzniká mutací nové restrikční místo pro určitou restriktasu (přítomnost variabilního restrikčního místa) nebo restrikční místo kauzální mutací zaniká. Přítomnost nebo nepřítomnost tohoto restrikčního místa je pak přímým důkazem mutace. Jako příklad takové situace uvádíme v na populaci nejfrekventovaněj mutaci v genu, který kóduje enzym fenylalaninhydroxylasu (PAH). Mutace vytváří nové restrikční místo pro restriktasu Sty I. Mutace v obou alelách genu PAH vede ke vzniku fenylketonurie. Sekvencování zachycuje konkrétní změnu v sekvenci nukleotidů. Tato metoda se v přímé diagnostice většinou využívá až když je ve sledovaném genu nalezena přibližná lokalizace mutace, například změnou pohyblivosti určitého fragmentu ál elům m a dal řen genu v elektoforéze. Sekvencovat celý gen je pracné a finančně nákladné.

15 Nepřímá diagnostika Nepřímá metoda je metodou rodokmenovou, kdy je třeba získat DNA od postiženého jedince, jeho rodičů, sourozenců, případně dalch členů rodiny. Nepřímá metoda je založena na polymorfismu délky restrikčních fragmentů - RFLP (viz výše, dále Mendelovská dědičnost, Vazba genů). Dal součástí molekulárně genetické analýzy situace v rodině je žití vhodné sondy (próby), která hybridizuje s úsekem vyšetřovaného genu (vnitrogenová sonda) nebo v jeho blízkosti (mimogenová sonda) (viz Vazba genů, Metoda Southern-blot). Princip vyšetř spočívá v tom, že od jednotlivých osob získáme jaderné buňky, ze kterých izolujeme DNA. DNA je rozštěpena vhodnou restrikasou. Dal postup je založený na Southernově metodě (viz výše). Pomocí DNA postiženého jedince je možné stanovit lokalizaci alel sledovaného genu na fragmentu určité délky. Délka restrikčních fragmentů je děděna podle Mendelových pravidel. Na základě těchto pravidel je možné, při existenci polymorfismu délky restrikčních fragmentů v rodině, stanovit genotypy členů rodiny. Jestliže lze pomocí RFLP jednoznačně stanovit genotyp všech členů rodiny, je vyšetř plně informativní. V případě, kdy vyšetř n informativní nebo je informativní ze částečně, je nutné žít jinou restrikční endonukleasu, která by informativní výsledek poskytla. Následující obrázky uvádějí příklady konkrétní rodinné situace. Všimněte si rozdílu mezi situací, kdy gen je lokalizován na autosomu a na heterochromosomu X, kdy ženy mají dva chromosomy X a muži ze jeden X chromosom. Výskyt choroby je v obrázcích znázorněn genealogickými značkami. V dolní polovině obrázku jsou výsledky vyšetř RFLP. Jedná se o schematické znázornění výsledků elektroforézy, kdy jednotlivé osoby mají odpovídající elektroforetogram znázorněn čárou pod svou rodokmenovou značkou. Poznatky získané na základě metod molekulární genetiky jsou využívány ve farmaceutickém průmyslu a v prenatální i postnatální diagnostice monogenně děděných chorob. Výhodou molekulárně genetických technik je jejich relativně vysoká spolehlivost, rychlost získání výsledků. Je možné pracovat i s velmi malým množstvím tkáně, nebo s jadernými buňkami vzorků krve. Perspektivou je využití metod genového inženýrství při kauzální terapii genetických chorob. Pro procvič genetických zákonitostí uvádíme v následujících obrázcích schematicky diagnostiku metodou RFLP. ál elům m a dal řen

16 A) V rodině, ve které je matka a dcera postižena brachydaktylií (AD) bylo provedeno DNA vyšetř členů rodiny metodou RFLP. Výsledek vyšetř je graficky znázorněn (rodokmen a elektroforéza fragmentů DNA Southern-blot). a) Posuďte, zda je vyšetř informativní a pokud ano, jaký je genotyp plodu, u které se zatím choroba neprojevila. b) v případě, že vyšetř n informativní, vypočítejte pravděpodobnost, že plod bude postižen pomocí Mendlových zákonitostí o dědičnosti. Genotyp matky a dcery postižené brachydaktylií je Aa (viz AD děděné choroby), otec s normálně vyvinutými prsty rukou má genotyp aa. Pro prenatální diagnostiku plodu musí být provedeno vyšetř všech členů rodiny včetně plodu metodou RFLP. fragmenty a 2 1 A a a Aa Aa nebo aa Vyšetř n informativní. Genotyp plodu nelze určit. Vysvětl: Otec je heterozygot v délce restrikčních fragmenů a homozygot v alelách (aa). Matka je homozygotka v délce fragmenů a heterozygotka v alelách (Aa). Prvorozená dcera zdědila od matky dominantní alelu, která je ve vazbě s fragmentem 1, a od otce recesivní alelu vázanou na fragment 2. Plod zdědil od otce recesivní alelu, která je ve vazbě s fragmentem 1. Od matky jeden z fragmentů 1, ale nelze identifikovat zda ve vazbě s dominantní nebo recesivní alelou. V tomto případě podle Mendelových zákonitostí o dědičnosti můžeme ze ál elům m a dal řen konstatovat pravděpodobné riziko postiž, které u AD onemocnění je 50%.

17 B) Využití RFLP pro nepřímou diagnostiku (vazebná analýza) u autosomálně recesivního onemocnění (např. fenylketonurie, cystická fibróza) 2 A A A 1 aa a AA a a Vysvětl: Postižený chlapec je recesivní homozygot aa. Oba rodiče jsou heterozygoti Aa. Oba rodiče jsou zároveň i heterozygoti v délce restrikčních fragmentů; heterozygocie alel a restrikčních fragmentů jsou dva na sobě nezávislé jevy. Postižený syn je homozygot v délce fragmentů 1. To znamená, že od obou rodičů zdědil fragment 1, se kterým je ve vazbě recesivní alela sledovaného genu. Na homologních chromosomech u rodičů je tedy alela A ve vazbě s fragmentem 2 a alela a (mutovaná) s fragmentem 1. S fragmentem 2 u obou rodičů je ve vazbě dominantní alela A. Genotyp druhorozené dcery je AA, je homozygota pro fragmenty 2. Vyšetř plodu ukázalo, přítomnost fragment 1 a 2 (jedem byl zděděn od otce, druhý od matky. Genotyp plodu je Aa. Dítě bude zdravé. Vyšetř metodou RFLP je plně informativní. ál elům m a dal řen

18 C) Využití RFLP pro nepřímou diagnostiku (vazebná analýza) u gonosomálně recesivních onemocnění (např. hemofílie, barvoslepost). 2 X + X + X + X + 1 X - X - X - Vysvětl: X chromosom dědí synové od matky. Dcery dědí jeden chromosom X od matky, druhý chromosom X od otce. Ženy mohou být přenašečkami mutované alely (heterozygotky X + X - ). Mužové jsou buď zdraví (X + Y) nebo nemocní (X - Y). Při RFLP analýze bude u mužů detekován ze jeden restrikční fragment (jeden chromosom X), u žen dva (dva chromosomy X). Prvorozený syn je postižený (X - ). Postižený chlapec získal X chromosom s mutací (X - ) ve sledovaném genu od heterozygotní matky (X + X - ). Mutovaný gen je u matky ve vazbě s fragmentem 1. S fragmentem 2 je u matky ve vazbě nemutovaný gen ((X + ). Otec je zdráv (X + ); nemutovaný gen je ve vazbě s fragmentem 2. Dcera je heterozygotka v délce fragmentů. Její genotyp je X + X -. U plodu mužského pohlaví, které bylo stanoveno cytogenetickým vyšetřm buněk plodu, byl nalezen fragment 2 nesoucí nemutovaný gen. Tato situace představuje úspěšnou DNA diagnostiku. Vyšetř je informativní. ál elům m a dal řen

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika

Více

Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních

Více

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární

Více

Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,

Více

Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících

Více

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip

Více

MIKROBIOLOGIE V BIOTECHNOLOGII

MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického

Více

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické

Více

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin

Více

Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace

Více

MIKROBIOLOGIE V BIOTECHNOLOGII

MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Termín biotechnologie byl poprvé použit v roce 1917 Procesy, při kterých se na tvorbě výsledného produktu podílejí živé organismy Širší definice: biotechnologie

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky.

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální

Více

Příprava rekombinantních molekul pro diagnostické účely

Příprava rekombinantních molekul pro diagnostické účely 1 Příprava rekombinantních molekul pro diagnostické účely doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 2 Obsah přednášky 1) Pojem rekombinantní DNA 2) Historické milníky

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

Klonování gen a genové inženýrství

Klonování gen a genové inženýrství Klonování gen a genové inženýrství Genové inženýrství užite né termíny Rekombinantní DNA = DNA, ve které se nachází geny nejmén ze dvou zdroj, asto ze dvou zných druh organism Biotechnologie = manipulace

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.

Více

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace

Více

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce

Více

GENETIKA. zkoumá dědičnost a proměnlivost organismů

GENETIKA. zkoumá dědičnost a proměnlivost organismů GENETIKA zkoumá dědičnost a proměnlivost organismů Dědičnost: schopnost organismů uchovávat informace o své struktuře a funkčních schopnostech a předávat je svým potomkům Proměnlivost (variabilita) je

Více

Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

Enzymy používané v molekulární biologii

Enzymy používané v molekulární biologii Enzymy používané v molekulární biologii Rozdělení enzymů 1. Podle substrátové specifity: většina metod molekulární biologie je závislá na použití enzymů, jejichž substrátem jsou nukleové kyseliny. Tyto

Více

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

EPIGENETIKA reverzibilních změn funkce genů, Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická

EPIGENETIKA reverzibilních změn funkce genů, Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická EPIGENETIKA Epigenetika se zabývá studiem reverzibilních změn funkce genů, aniž by při tom došlo ke změnám v sekvenci jaderné DNA. Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická

Více

Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi

Více

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace

Více

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR)

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor

Více

Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti

Více

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION VYUŽITÍ AUTOMATICKÉHO SEKVENOVÁNÍ DNA PRO DETEKCI POLYMORFISMŮ KANDIDÁTNÍCH GENŮ U PRASAT Vykoukalová Z., Knoll A.,

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci

Více

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin

Více

Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2 http://www.paternityexperts.com/basicgenetics.html

Více

Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.:

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.: Yi TPMT Diagnostická souprava Návod k použití Výrobce: YBUX s.r.o. Haasova 27 Brno 616 00 Česká republika IČ 63487951 tel.: +420 541 423 710 e-mail: ybux@ybux.eu Název: Yi TPMT Popis: Diagnostická souprava

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto

Více

Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava

Více

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka

Více

Struktura a funkce nukleových kyselin

Struktura a funkce nukleových kyselin Struktura a funkce nukleových kyselin ukleové kyseliny Deoxyribonukleová kyselina - DA - uchovává genetickou informaci Ribonukleová kyselina RA - genová exprese a biosyntéza proteinů Složení A stavební

Více

Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna

Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna Obsah přednášky 1) Klonování složených eukaryotických genů 2) Úprava rekombinantních genů 3) Produkce rekombinantních proteinů v expresních systémech 4) Promotory 5) Vektory 6) Reportérové geny Zdrojem

Více

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc.

Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské. doc. RNDr. Ivan Mazura, CSc. Genetický polymorfismus jako nástroj identifikace osob v kriminalistické a soudnělékařské praxi doc. RNDr. Ivan Mazura, CSc. Historie forenzní genetiky 1985-1986 Alec Jeffreys a satelitní DNA 1980 Ray

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Biologie. Mezipředmětové

Více

Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI

Více

Genetické markery - princip a využití

Genetické markery - princip a využití Genetika a šlechtění lesních dřevin Genetické markery - princip a využití Doc. Ing. RNDr. Eva Palátová, PhD. Ing. R. Longauer, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Fyzické mapování Fyzické kontigové mapy Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s konstrukcí

Více

TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE

TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy

Více

REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK

REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK Molekulární základy dědičnosti - rozšiřující učivo REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK REPLIKACE deoxyribonukleové kyseliny (zdvojení DNA) je děj, při kterém se tvoří z jedné dvoušoubovice DNA dvě nová

Více

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

Molekulární základ dědičnosti

Molekulární základ dědičnosti Molekulární základ dědičnosti Dědičná informace je zakódována v deoxyribonukleové kyselině, která je uložena v jádře buňky v chromozómech. Zlomovým objevem pro další rozvoj molekulární genetiky bylo odhalení

Více

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

První testový úkol aminokyseliny a jejich vlastnosti

První testový úkol aminokyseliny a jejich vlastnosti První testový úkol aminokyseliny a jejich vlastnosti Vysvětlete co znamená pojem α-aminokyselina Jaký je rozdíl mezi D a L řadou aminokyselin Kolik je základních stavebních aminokyselin a z čeho jsou odvozeny

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní

Více

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková Diagnostika retrovirů Lentiviry - HIV Vladislava Růžičková VI. Třída RNA-viry se zpětnou transkriptázou RT Čeleď: Retroviridae (hostitelé: Obratlovci) Rody: Alpharetrovirus Betaretrovirus Gammaretrovirus

Více

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.

Více

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza Exprese genetického kódu Centrální dogma molekulární biologie - genetická informace v DNA -> RNA -> primárního řetězce proteinu 1) transkripce - přepis z DNA do mrna 2) translace - přeložení z kódu nukleových

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

Centrální dogma molekulární biologie

Centrální dogma molekulární biologie řípravný kurz LF MU 2011/12 Centrální dogma molekulární biologie Nukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Mendel) 1869 objev nukleových kyselin (Miescher) 1944 genetická informace v nukleových

Více