ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce"

Transkript

1 METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction) je metoda, která umožňuje z komplexní (celkové) DNA namnožit vybraný úsek, např. určitý exon analyzovaného genu, bez předchozího klonování ve vektorech (viz dále). Předpokladem je znalost pořadí basí na začátku a na konci požadované sekvence DNA pro syntézu krátkého (oligonukleotidového) jednovláknového úseku DNA; primeru dlouhého bp. Princip PCR je obdobou replikace nukleových kyselin. Během PCR reakce dochází k cyklickému opakování enzymové syntézy nových řetězců vybraných úseků dvouřetězcové DNA ve směru 5' 3', která je zprostředkovaná DNApolymerasou. Syntetizovaný úsek DNA je tepelně denaturován (při 95 o C) a se vzniklými dvěmi jednovláknovými molekulami DNA následně hybridizují primery (při o C). Napojm primerů je umožněna syntéza komplementárních vláken DNA (při o C), kterou zajišťuje DNA-dependentní-DNA-polymerasa Taq. Taq-polymerasa je izolovaná z bakterie vyskytující se v teplých pramenech a n proto inaktivována při vyšch teplotách v průběhu PCR reakce. DNA-polymerasa tvoří komplementární vlákna DNA podle matrice DNA jen od místa navázání primerů (navazováním nukleotidů k primeru - viz replikace). Časové omez PCR reakce určuje délku nově syntetizovaného vlákna DNA. Po 1. cyklu je replikovaný úsek DNA zdvojnásoben. Následuje dal denaturace a celý cyklus se opakuje. Množ vybraného úseku pokračuje geometrickou řadou. Po 30ti cyklech bývá DNA zmnožena řádově Tím, že PCR umožňuje získání relativně velkého množství DNA z velmi malých vzorků, nachází uplatnění v mnoha oblastech molekulární biologie. Metodu PCR schematicky znázorňuje následující obrázek. PCR je automatizovaný proces, který probíhá v přístroji označovaném thermocykler. Thermocykler je naprogramován tak, aby v jednotlivých teplotních krocích byly automaticky dodržované tepelné podmínky pro (a) denaturaci DNA, (b) pro připoj primerů a (c) tvorbu komplementárních vláken DNA. Reakční směs pro PCR obsahuje pufr (roztok, který udržuje stabilní ph), vzorek DNA, dostatečné množství všech čtyř typů nukleotidů (2'- deoxyribonukleosid-5'-trifosfáty dntp), primery a DNA-dependentní-DNA-polymerasu Taq. V reakční směsi jsou dále v optimalizované koncentraci přítomny hořečnaté ionty Mg 2+, ál elům m a dal řen

2 které tvoří rozpustný komplex s dntp, který rozpoznává DNA-polymerasa a chelační činidla (např. EDTA), která inhibují deoxyribonukleasy. PRINCIP METODY PCR (1 MOLEKULA) DENATURACE 1. CYKLUS PRIMERY Taq-POLYMERASA 2. CYKLUS CYKLUS 4. CYKLUS 5. CYKLUS (2 MOLEKULY) DENATURACE PRIMERY Taq-POLYMERASA (4 MOLEKULY) DENATURACE PRIMERY Taq-POLYMERASA (8 MOLEKUL) (16 MOLEKUL) ál elům m a dal řen (32 MOLEKUL)

3 Štěp DNA Restrikční endonukleasy Restrikční endonukleasy (restriktasy) jsou sekvenčně specifické bakteriální enzymy (endonukleasy), které chrání baktérii před vniknutím cizorodé DNA, například při infekci baktérie bakteriofágem. Cizí dvouvláknová DNA je restriktasou rozštěpena, vlastní DNA je proti působ enzymu chráněna (obvykle methylací některých basí). Restrikční endonukleasy mohou štěpit dvouvláknové molekuly DNA jakéhokoliv původu, pokud v nich existují pro ně specifická cílová místa štěp se specifickým pořadím basí pro určitou restriktasu. K rozštěp molekuly DNA dochází hydrolysou fosfodiesterových vazeb obou řetězců v restrikčním místě (místo štěp). Cílového místa jsou obvykle sekvence 4-6 bp. Štěp DNA může být uvnitř této cílové sekvence, případně před nebo za ní. Názvy restrikčních endonukleas jsou odvozovány od jména baktérie, ze které byly získány. V současné době je známo přes restriktas. Například restriktasa EcoR I byla získána z bakterie Escherichia coli, kmen RY 13. Cílová sekvence této restriktasy musí být na obou vláknech DNA shodná a štěp dvouvláknové molekuly DNA je od 5' konce. Pro restriktasu EcoR I to je mezi G a následující sekvencí AATTC od 5' konce (znázorněno značkou ), tzn. 5'-G AATTC-3'. Cílové sekvence tvoří velmi často palindrom (čt sekvence shodné z obou konců). Pokud dochází ke štěp DNA uprostřed palindromu, vznikají konce bez přesahů, tzv. tupé konce. Pokud nedochází ke štěp DNA uprostřed palindromu, vznikají přerušm fosfodiesterických vazeb DNA kohezní konce (lepivé konce, konce s přesahem), viz následující obrázek. 5'-AATGCTAATGCCTAGTCAAGCTTTCATCGAG AATTCCAGTCGAA-3' 3'-TTAGCTTTACGGATCAGTTCGAAAGTAGCTCTTAA GGTCAGCTT-5' 5'-AATGCTAATGCCTAGTCAAGCTTTCATCGAG 3'-TTAGCTTTACGGATCAGTTCGAAAGTAGCTCTTAA AATTCCAGTCGAA-3' GGTCAGCTT-5' ál elům m a dal řen

4 Několik příkladů běžných restrikčních endonukleas a jejich restrikčních míst je uvedeno v následující tabulce. Je uvedeno ze restrikční místo na jednom vlákně DNA ve směru 5' 3'. Bakteriální zdroj Název restriktázy Cílové místo štěp (dvouvláknová DNA) Arthrobacter luteus Alu I 5'-AG CT-3' (tupé konce) Bacillus amyloliquefaciens BamH I 5'-G GATCC-3' (kohezní konce) Escherichia coli RY 13 EcoR I 5'-G AATTC-3' (kohezní konce) Haemophilus influenzae Hind III 5'-A AGCTT-3' (kohezní konce) Moraxella sp. Msp I 5'-C CGG-3' (kohezní konce) Streptomyces albus Sal I 5'-G TCGAC-3' (kohezní konce) Staphylococcus aureus Sau 3A 5'- GATC-3' (kohezní konce) Thermus aquaticus Taq I 5'-T CGA-3' (kohezní konce) Restrikční mapy Působíme-li na izolovanou DNA určitou restriktasou, dojde k jejímu rozštěp na úseky (fragmenty) rozdílné délky podle umístění cílových sekvencí štěp v molekule DNA. Restrikční mapa ukazuje pomocí vzniklých fragmentů počet restrikčních míst v molekulách DNA a velikost fragmentů pro jednotlivé restrikčních endonukleasy. Informace jsou pak kompletovány pro molekuly DNA jednotlivých chromosomů. DNA rozdělená na jednotlivé fragmenty pak může být dále analyzována se zřetelem na polymorfismy v délce restrikčních fragmentů v populaci. Polymorfismy v délce fragmentů jsou podmíněné počtem párů basí mezi dvěma cílovými místy štěp. Jsou vyvolané např. mutací v cílovém místě štěp a tím jeho zrušm nebo různým počtem tandemových repetitivních sekvencí mezi dvěma místy štěp atp. Stanov polymorfismů genomů Detekce polymorfismů (rozdílů) se může týkat celé genomové, chromosomové nebo ál elům m a dal řen mitochondrální DNA, a nebo polymorfismů specifických genů nebo jejich specifických částí,

5 tzn. polymorfismů (rozdílů) v sekvenci (v pořadí nukleotidů) DNA. Rozdíly v sekvenci DNA mohou, ale nemusí ovlivnit určité fenotypové znaky. Identifikace a typizace určitých polymorfismů umožňuje rozliš jedinců např. s ohledem na preventivní opatř a léčbu choroby. Genotypové diagnostické metody (analýza DNA) jsou, na rozdíl od diagnózy podle fenotypových projevů, přesné. Pro stanov sekvenčního polymorfismu DNA mohou být žity přímé metody, kdy se stanovuje sekvence variabilní oblasti DNA (viz sekvencování) nebo nepřímé metody, založené na amplifikaci DNA nebo využívající restrikční endonukleasovou analýzu a selektivní hybridizaci restrikčních fragmentů se specifickými sondami. Dal techniky pro identifikaci polymorfismů využívají rozdílnou pohyblivost fragmentů DNA se standardní a mutantní formou genu při elektroforéze, která je odrazem konformačních polymorfismů nukleových kyselin. Vysoce rozlišovací techniky umožňují identifikaci i jednonukleotidových polymorfismů (SNP). Polymorfismus délky restrikčních fragmentů (RFLP) Působíme-li na izolovanou DNA jedince určitou restriktasou, dojde k jejímu rozštěp na úseky (fragmenty) rozdílné délky podle umístění cílových sekvencí štěp pro žitou restriktasu. DNA od různých jedinců stejného druhu pak může mít délku fragmentů (i jejich počet) buď shodnou, nebo rozdílnou. Pokud mezi jedinci téhož druhu při žití téže restriktázy nacházíme fragmenty rozdílné délky, pak hovoříme o polymorfismu v délce restrikčních fragmentů (RFLP Restriction Fragment Length Polymorphism). Vysvětlm vzniku polymorfismu délky restrikčních fragmentů může být například mutace některého nukleotidu v cílové sekvenci štěp (variabilní restrikční místo). Restriktasa pak v takto změněné cílové sekvenci neštěpí a vzniká fragment, jehož délka je součtem délek dvou sousedních původních fragmentů. Naopak je též možné, že mutací vznikne nová cílová sekvence a tak dojde ke zkrác délky restrikčního fragmentu. Jinou možností vzniku polymorfismu délky restrikčních fragmentů je včlenění, nebo vyčlenění, nukleotidů mezi dvěmi cílovými sekvencemi - variabilita krátkých tandemově opakujících se repetic. Pak jsou získány restrikční fragmenty del (respektive krat). Schematické znázornění shodných úseků DNA vykazujících rozdílné příčiny vzniku polymorfismu délky restrikčních fragmentů ukazuje následující schéma zobrazující situaci na jednom vlákně DNA. ál elům m a dal řen

6 a) dvě restrikční místa (3 fragmenty) 5' TAATGCCTTCTCAAGCTTTCATCGAG AATTCCAGTCGAAAGCTTTCATCGAG AATTCCAGT 3' b) první restrikční místo zrušeno záměnou nukleotidů A C; 2 fragmenty 5' TAATGCCTTCTCAAGCTTTCATCGAGACTTCCAGTCGAAAGCTTTCATCGAG AATTCCAGT 3' c) vznik nového (dalho) restrikčního místa záměnou nukleotidů CC AA; 4 fragmenty 5' TAATG AATTCTCAAGCTTTCATCGAG AATTCCAGTCGAAAGCTTTCATCGAG AATTCCAGT 3' d) variabilita krátkých repetitivních sekvencí, zde CGAT, vede v obou molekulách ke štěp na dva fragmenty, ale odlišné délky 5' CGAAAGCTTCGATCGATCGATCGATCGATCGATCGATCGATTCATCGAG AATTCC 3' 5' CGAAAGCTTCGATCGATCGATCGATCGATCGATCGATCGATCGATTCATCGAG AATTCC 3' Délka restrikčních fragmentů se dědí. Dědičnost se řídí pravidly Mendelovské genetiky (viz Monohybridismus). Velikosti restrikčních fragmentů můžeme hodnotit pomocí gelové elektroforézy. Fragmenty DNA mají záporný náboj, proto všechny fragmenty putují při jednosměrném proudu od záporné elektrody (-) k elektrodě kladné (+). Mezi nejžívaněj gelové nosiče patří agaróza a polyakrylamid, které působí molekulární síto (jsou porézní, velikost pórů určuje jejich hustota). Pomocí gelové elektroforézy můžeme rozdělit jednotlivé fragmenty DNA podle jejich velikosti. Malé molekuly (fragmenty) putují v gelu rychleji než velké. O rozlož jednotlivých restrikčních fragmentů v gelu se můžeme přesvědčit obarvm barvivem ethidiumbromidem. U eukaryotických genomů získáme z komplexní DNA vysoký počet fragmentů natolik velikostně rozdílných, že vytvářejí na elektroforetogramu souvislý pruh. V těchto případech žíváme pro identifikaci fragmentů, které potřebujeme pro dal analýzu, Southernovu metodu. ál elům m a dal řen

7 Southernův přenos Southernův přenos (blotting = "přepijákování") je metoda, která se žívá při zkoumání velikosti restrikčních fragmentů určitého úseku DNA. Principy Southernovy metody jsou následující: a) Pomocí vybrané restrikční endonukleasy je rozštěpena celková (komplexní) DNA získaná z jaderných buněk jedince. b) Získané fragmenty se rozdělí gelovou elektroforézou. c) Po denaturaci DNA jsou vzorky přeneseny na hybridizační membránu (nitrocelulóza nebo nylonová membrána). Gelové nosiče nejsou vhodné pro dal postupy protože jsou velmi křehké. d) Přenos (blotting) fragmentů z gelu na membránu se realizuje vzlínáním pufru z rezervoáru. e) Po přenes fragmentů nastupuje fixace fragmentů na podložku. f) Dalm krokem je hybridizace s radioaktivně značenou sondou (probou). Sondou bývá krátká sekvence DNA, která specificky hybridizuje s restrikčními fragmenty na základě komplementarity basí. Při diagnostice dědičných chorob je vybrána sonda, která je komplementární k fragmentu, na kterém leží vyšetřovaný gen (extragenová sonda) nebo je komplementární přímo s krátkou sekvencí vyšetřovaného genu (intragenová sonda). ál elům m a dal řen

8 g) Po opláchnutí nenavázané sondy se autoradiograficky hodnotí lokalizace fragmentů, u kterých došlo k hybridizaci sondy. Jako sondu lze např. žívat DNA z knihoven cdna (viz dále). cdna (komplementární DNA, copy DNA), je DNA získaná reversní transkripcí mrna. Takto získaná DNA nenese sekvence odpovídající intronům. V případě, že DNA analýzu nelze vyhodnotit ze pomocí délky nebo počtu restrikčních fragmentů, je možné využít dal metodu založenou na specifické hybridizaci vzorku DNA a to s tzv. alelově specifickou sondou. Alelově specifické sondy jsou oligonukleotidy o délce přibližně 20 bp, které hybridizují s neštěpenou denaturovanou DNA v místě, kde je úplná shoda všech komplementárních nukleotidů. Stačí tedy odchylka v jediném nukleotidu, aby k hybridizaci nedošlo. Alelově specifické sondy mohou tedy velmi citlivě stanovit i velmi malé genetické změny ve zkoumané DNA, pokud jsou lokalizovány v místě hybridizace sondy, nikoliv ale všechny mutace vyšetřovaného genu. Polymorfismus konformace jednořetězcových vláken DNA nebo RNA (SSCP) Polymorfismus jednořetězců nukleových kyselin ukazuje sekvenční rozdíly mezi alelami. Sekvenční rozdíly (i rozdíl jedné base) se odrazí na odlišné pohyblivosti vyšetřovaných jednořetězcových úseků DNA nebo RNA ( o velikosti pb) při nedenaturujících elektroforetických podmínkách. Polymorfismus konfirmace dvouřetězců (DSCP) Při pomalé renaturaci fragmentů DNA se vytvářejí duplexy DNA. Duplexy s úplnou komplementaritou basí (homoduplexy) mají v nedenaturujících gelech odlišnou (vyš) elektroforetickou pohyblivost než heteroduplexy, jejichž řetězce nemají úplnou komplementaritu basí. Heteroduplexy jsou důkazem bodových mutací v genomech. Sekvencování DNA Sekvencování DNA je stanov primární struktury, pořadí nukleotidů, v molekulách DNA. Cílem zkoumání je stanov pořadí nukleotidů celého genomu (např. projekt HUGO). Tato informace je základ pro exaktní genetickou diagnostiku a v perspektivě i pro kauzální genetickou terapii a odezvu jednotlivých pacientů na podání léčiva (farmakogenetika). K zjišťování pořadí (sekvence) basí v určitém úseku DNA se žívají různé metody sekvencování, často automatizované. ál elům m a dal řen

9 Jedna z žívaných metod je enzymová Sangerova metoda, která je založena na enzymově katalyzované terminaci syntézy DNA po zabudování dideoxyribonukleotidu (ddntp - 2',3'- dideoxyribonukleosid-5'-trifosfát) do nově vznikajícího komplementárního vlákna. Při sekvencování Sangerovou metodou je DNA, která má být sekvencována, žita matrice pro syntézu komplementárního vlákna. Dideoxyribonukleotidy se začleňují do vlákna syntetizované DNA náhodně na místo příslušného nukleotidu (2'-deoxyribonukleosid-5'- trifosfátu). Po zabudování dideoxyribonukleotidu, který postrádá 3'-OH skupinu, nemůže DNA-polymerasa k němu v důsledku nepřítomnosti 3'-OH skupiny připojit dal nukleotid a syntetizovaný řetězec DNA se nemůže dále prodlužovat. Výsledkem enzymové Sangerovy metody je vznik různě dlouhých fragmentů DNA, které nesou na konci určitý, fluorochromy nebo radioaktivně značený, dideoxyribonukleotid ddgtp, ddatp, ddttp, ddctp. Délka fragmentu a jeho koncový dideoxyribonukleotid informuje o sekvenci nukleotidů v analyzovaném vzorku DNA. Metoda je schematicky znázorněna na následujícím obrázku. Sekvencování je prováděno ve čtyřech vzorcích, kdy každý analyzovaný vzorek stanovuje pořadí jednoho ze čtyř nukleotidů. Každý analyzovaný vzorek obsahuje směs (i) čisté DNA, která má být sekvencována, (ii) značený primer, připojující se k vláknu analyzované DNA, (iii) směs všech čtyř nukleotidů (A, G, C, T) a v každém vzorku jeden ze čtyř ddntp, který je koncový inhibitor syntézy DNA a (iiii) DNA-polymerasu. ál elům m a dal řen

10 3' 5' Analyzovaná DNA (jednovláknová) 5' 3' Značený primer DNA-polymerasa, primer, nukleotidy - rozděl do čtyř zkumavek. Přidány jednotlivé ddntp: ddatp, ddctp, ddgtp, ddttp Následuje syntéza komplementárního vlákna (značeno barevně pro jednotlivé ddntp) ve směru 5' 3' podle analyzovaného vzorku jednovláknové DNA (černá čára; směr 3' 5') A C G T A C G T A C G T Elektroforéza A C G T - Sekvence nukleotidů je odečtena z gelu podle délky fragmentů s příslušnými koncovými ddntp Výsledná sekvence na syntetizovaném vlákně: 5'- C T A G T A G G T C C A - 3' Sekvence analyzované DNA (komplementarita párování basí): 3'- G A T C A T C C A G G T - 5' Automatické sekvencování Automatickém sekvencování je plně automatizovaný proces, který umožňuje rychlou analýzu vzorků. Při srovnání s výše uvedenou enzymovou metodou má tyto odlišnosti: (i) syntéza DNA je asymetrická polymerasová řetězová reakce, která probíhá v termocykleru za účasti Taq DNA-polymerasy; (ii) pro stanov produktů ončených specifickou basí se + ál elům m a dal řen

11 žívají čtyři odlišné fluorescenční značky; (iii) délka stanovené sekvence je mezi basemi. Detekce produktů sekvenčních reakcí probíhá v průběhu elektroforézy automaticky pomocí laserového detektoru napojeného na počítač, který z pořadí signálů přímo hodnotí sekvenci DNA. Obrázek ukazuje výsledek automatického sekvenování; převzato otevřená encyklopedie com). DNA čipy (expresní profilování), DNA microarrays DNA čipy jsou skleněné destičky, na které je umístěno velké množství cdna (desítky tisíc) nebo krátkých specifických sekvencí jednotlivých genů (mikromnožství pro každý vzorek). Hybridizace s fluorescenčním barvivem značenou sondou cdna, vytvořenou z mrna sledované tkáně, umožní stanovit, které geny jsou v této tkáni v daném období exprimovány (aktivní) a i intenzitu jejich transkripční aktivity. Vizualizace hybridizace se provádí v zaříz využívajícím počítačovou analýzu. Metoda expresního profilování na DNA čipech pomáhá stanovit v jednom vzorku souboru aktivitu velkého počtu genů, mnohdy i všech známých genů daného organismu. Hodnoc může být zaměřeno na různé situace je např. reakce organismu na působ nepříznivých vnějch podmínek nebo na expresi komplexu genů při různých onemocněních i s možností posoudit genovou expresi při jejich léčbě a to i se zřetelem k věku jedince (viz dále Prenatální vývoj a stárnutí organismu). V současné době n tato metoda využívána rutinně, je velmi nákladná. Vyžaduje oup drahého technického vybav a drahá je také syntéza primerů i proved PCR pro vytvoř DNA čipu. ál elům m a dal řen

12 Převzato otevřená encyklopedie com Genové inženýrství Kohezní konce jsou jednovláknové úseky DNA, které mohou na principu komplementarity bází hybridizovat s kohezním koncem i jiné DNA. Může tak dojít i k hybridizaci s cizí molekulou DNA, například plasmidu a eukaryotní buňky, pokud obě DNA byly štěpeny stejnou restriktasou. Použitím enzymu ligasy je možné vytvořit fosfodiesterovou vazbu a tak napojit úsek jedné DNA molekuly s úsekem jiné molekuly DNA. Tímto způsobem vzniká rekombinantní DNA. Pokud jde o kruhovou DNA plasmidu, musí hybridizaci předcházet linearizace molekuly DNA. Ke štěp a linearizaci je zvolena restriktasa, která DNA plasmidu štěpí ze v jednom místě a vytváří v místě štěp kohezní konce. Fragment lidské DNA (insert) má shodné kohezní konce linearizovaná DNA plasmidu, což umožňuje hybridizaci na koncích rozštěpené DNA plasmidu s fragmentem lidské DNA na základě komplementarity basí. Při hybridizaci se uplatňuje také, mimo jiné, enzym ligasa, který zajišťuje spoj vláken DNA. ál elům m a dal řen

13 působ restrikční endonukleasy na DNA plasmidu DNA plasmidu působ restrikční endonukleasy na lidskou DNA DNA plasmidu s inzertem lidské DNA Klonování lidské DNA Velikost genomu lidských buněk vyžaduje při molekulárně genetické analýze využití klonování DNA. Klonování DNA umožňuje např. štěp DNA restrikčními endonukleasami na fragmenty a vytvoř rekombinantní DNA s DNA vhodného vektoru (nosiče). Jako vektory se žívají bakteriální plasmidy, jinou možností je využití virového nosiče, jsou například bakteriofágy. Po vprav vektoru, například plasmidu do baktérie, je možné množit klony baktérií (tedy potomky jedné baktérie) s tímto vektorem a tím zapojit do procesu replikace zkoumaný úsek DNA. Touto metodou lze vytvořit genomové knihovny, tzn. různé klony baktérií s různými fragmenty DNA. Soubor klonů pak může představovat DNA celého eukaryotického genomu. Pro vytvář genomové knihovny savců je optimální délka fragmentů pro vprav do plasmidového vektoru okolo 40 kb. Jednotlivé fragmenty jsou připraveny tak, aby se jejich koncové sekvence navzájem překrývaly. Tím vznikají klony (knihovny genomové DNA), ve kterých fragmenty DNA vytvářejí informaci nejen o jednotlivých fragmentech, ale tím, že se vzájemně překrývají, i o jejich vzájemném sousedství (sledu) v komplexní DNA. Genomová DNA jednoho jedince je ve všech jeho buněčných typech stejná (s výjimkou buněk imunitního systému a nádorových buněk). Při konstrukci genomových knihoven se v současné době žívají i uměle vytvořené vektory. ál elům m a dal řen

14 cdna knihovny jsou vhodné pro zkoumání transkripčně aktivních genů. Principem je získání mrna z určitého typu buněk (určité tkáně, orgánu), které jsou specializované na tvorbu některého polypeptidu. Pomocí reverzní transkripce je pak získána cdna (komplementární), která je začleněna do vhodného vektoru a následně namnožena. cdna knihovny obsahují, na rozdíl od knihoven genomových, ze informaci o funkčních genech. Informace obsažená v cdna knihovnách je omezena ze na exony příslušného genu (viz úpravy mrna transkripce). Knihovny cdna buněk odlišných tkání nejsou identické, závisí na expresi genů v konkrétních buňkách určité tkáně. To znamená, že se bude lišit cdna knihovna např. buněk jater a svalové tkáně. DNA diagnostika Metody molekulární genetiky umožňují zpřesnění rizika onemocnění pro členy rodin s výskytem Mendelovsky děděných chorob. Metody DNA diagnostiky můžeme rozdělit na metody přímé a nepřímé. Přímé metody Pomocí metody PCR se amplifikují jednotlivé úseky genu, ve kterém je očekáván nález mutace, a jednotlivé části genu (fragmenty) se pak vyšetří na přítomnost mutace. (i) (ii) (iii) Metody SSCP a DSCP (viz výše), které využívají rozdíly ve fyzikálněchemickém chování molekul DNA nesoucích mutaci v porovnání se standardní molekulou DNA (bez mutace), kdy změna sekvence mění konformaci fragmentu DNA a tím i rychlost pohybu fragmentu v gelu. Přítomnost variabilního restrikčního místa (viz RFLP). V některých genech vzniká mutací nové restrikční místo pro určitou restriktasu (přítomnost variabilního restrikčního místa) nebo restrikční místo kauzální mutací zaniká. Přítomnost nebo nepřítomnost tohoto restrikčního místa je pak přímým důkazem mutace. Jako příklad takové situace uvádíme v na populaci nejfrekventovaněj mutaci v genu, který kóduje enzym fenylalaninhydroxylasu (PAH). Mutace vytváří nové restrikční místo pro restriktasu Sty I. Mutace v obou alelách genu PAH vede ke vzniku fenylketonurie. Sekvencování zachycuje konkrétní změnu v sekvenci nukleotidů. Tato metoda se v přímé diagnostice většinou využívá až když je ve sledovaném genu nalezena přibližná lokalizace mutace, například změnou pohyblivosti určitého fragmentu ál elům m a dal řen genu v elektoforéze. Sekvencovat celý gen je pracné a finančně nákladné.

15 Nepřímá diagnostika Nepřímá metoda je metodou rodokmenovou, kdy je třeba získat DNA od postiženého jedince, jeho rodičů, sourozenců, případně dalch členů rodiny. Nepřímá metoda je založena na polymorfismu délky restrikčních fragmentů - RFLP (viz výše, dále Mendelovská dědičnost, Vazba genů). Dal součástí molekulárně genetické analýzy situace v rodině je žití vhodné sondy (próby), která hybridizuje s úsekem vyšetřovaného genu (vnitrogenová sonda) nebo v jeho blízkosti (mimogenová sonda) (viz Vazba genů, Metoda Southern-blot). Princip vyšetř spočívá v tom, že od jednotlivých osob získáme jaderné buňky, ze kterých izolujeme DNA. DNA je rozštěpena vhodnou restrikasou. Dal postup je založený na Southernově metodě (viz výše). Pomocí DNA postiženého jedince je možné stanovit lokalizaci alel sledovaného genu na fragmentu určité délky. Délka restrikčních fragmentů je děděna podle Mendelových pravidel. Na základě těchto pravidel je možné, při existenci polymorfismu délky restrikčních fragmentů v rodině, stanovit genotypy členů rodiny. Jestliže lze pomocí RFLP jednoznačně stanovit genotyp všech členů rodiny, je vyšetř plně informativní. V případě, kdy vyšetř n informativní nebo je informativní ze částečně, je nutné žít jinou restrikční endonukleasu, která by informativní výsledek poskytla. Následující obrázky uvádějí příklady konkrétní rodinné situace. Všimněte si rozdílu mezi situací, kdy gen je lokalizován na autosomu a na heterochromosomu X, kdy ženy mají dva chromosomy X a muži ze jeden X chromosom. Výskyt choroby je v obrázcích znázorněn genealogickými značkami. V dolní polovině obrázku jsou výsledky vyšetř RFLP. Jedná se o schematické znázornění výsledků elektroforézy, kdy jednotlivé osoby mají odpovídající elektroforetogram znázorněn čárou pod svou rodokmenovou značkou. Poznatky získané na základě metod molekulární genetiky jsou využívány ve farmaceutickém průmyslu a v prenatální i postnatální diagnostice monogenně děděných chorob. Výhodou molekulárně genetických technik je jejich relativně vysoká spolehlivost, rychlost získání výsledků. Je možné pracovat i s velmi malým množstvím tkáně, nebo s jadernými buňkami vzorků krve. Perspektivou je využití metod genového inženýrství při kauzální terapii genetických chorob. Pro procvič genetických zákonitostí uvádíme v následujících obrázcích schematicky diagnostiku metodou RFLP. ál elům m a dal řen

16 A) V rodině, ve které je matka a dcera postižena brachydaktylií (AD) bylo provedeno DNA vyšetř členů rodiny metodou RFLP. Výsledek vyšetř je graficky znázorněn (rodokmen a elektroforéza fragmentů DNA Southern-blot). a) Posuďte, zda je vyšetř informativní a pokud ano, jaký je genotyp plodu, u které se zatím choroba neprojevila. b) v případě, že vyšetř n informativní, vypočítejte pravděpodobnost, že plod bude postižen pomocí Mendlových zákonitostí o dědičnosti. Genotyp matky a dcery postižené brachydaktylií je Aa (viz AD děděné choroby), otec s normálně vyvinutými prsty rukou má genotyp aa. Pro prenatální diagnostiku plodu musí být provedeno vyšetř všech členů rodiny včetně plodu metodou RFLP. fragmenty a 2 1 A a a Aa Aa nebo aa Vyšetř n informativní. Genotyp plodu nelze určit. Vysvětl: Otec je heterozygot v délce restrikčních fragmenů a homozygot v alelách (aa). Matka je homozygotka v délce fragmenů a heterozygotka v alelách (Aa). Prvorozená dcera zdědila od matky dominantní alelu, která je ve vazbě s fragmentem 1, a od otce recesivní alelu vázanou na fragment 2. Plod zdědil od otce recesivní alelu, která je ve vazbě s fragmentem 1. Od matky jeden z fragmentů 1, ale nelze identifikovat zda ve vazbě s dominantní nebo recesivní alelou. V tomto případě podle Mendelových zákonitostí o dědičnosti můžeme ze ál elům m a dal řen konstatovat pravděpodobné riziko postiž, které u AD onemocnění je 50%.

17 B) Využití RFLP pro nepřímou diagnostiku (vazebná analýza) u autosomálně recesivního onemocnění (např. fenylketonurie, cystická fibróza) 2 A A A 1 aa a AA a a Vysvětl: Postižený chlapec je recesivní homozygot aa. Oba rodiče jsou heterozygoti Aa. Oba rodiče jsou zároveň i heterozygoti v délce restrikčních fragmentů; heterozygocie alel a restrikčních fragmentů jsou dva na sobě nezávislé jevy. Postižený syn je homozygot v délce fragmentů 1. To znamená, že od obou rodičů zdědil fragment 1, se kterým je ve vazbě recesivní alela sledovaného genu. Na homologních chromosomech u rodičů je tedy alela A ve vazbě s fragmentem 2 a alela a (mutovaná) s fragmentem 1. S fragmentem 2 u obou rodičů je ve vazbě dominantní alela A. Genotyp druhorozené dcery je AA, je homozygota pro fragmenty 2. Vyšetř plodu ukázalo, přítomnost fragment 1 a 2 (jedem byl zděděn od otce, druhý od matky. Genotyp plodu je Aa. Dítě bude zdravé. Vyšetř metodou RFLP je plně informativní. ál elům m a dal řen

18 C) Využití RFLP pro nepřímou diagnostiku (vazebná analýza) u gonosomálně recesivních onemocnění (např. hemofílie, barvoslepost). 2 X + X + X + X + 1 X - X - X - Vysvětl: X chromosom dědí synové od matky. Dcery dědí jeden chromosom X od matky, druhý chromosom X od otce. Ženy mohou být přenašečkami mutované alely (heterozygotky X + X - ). Mužové jsou buď zdraví (X + Y) nebo nemocní (X - Y). Při RFLP analýze bude u mužů detekován ze jeden restrikční fragment (jeden chromosom X), u žen dva (dva chromosomy X). Prvorozený syn je postižený (X - ). Postižený chlapec získal X chromosom s mutací (X - ) ve sledovaném genu od heterozygotní matky (X + X - ). Mutovaný gen je u matky ve vazbě s fragmentem 1. S fragmentem 2 je u matky ve vazbě nemutovaný gen ((X + ). Otec je zdráv (X + ); nemutovaný gen je ve vazbě s fragmentem 2. Dcera je heterozygotka v délce fragmentů. Její genotyp je X + X -. U plodu mužského pohlaví, které bylo stanoveno cytogenetickým vyšetřm buněk plodu, byl nalezen fragment 2 nesoucí nemutovaný gen. Tato situace představuje úspěšnou DNA diagnostiku. Vyšetř je informativní. ál elům m a dal řen

Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin

Více

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR)

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek

Více

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi

Více

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace

Více

Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi

Více

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION VYUŽITÍ AUTOMATICKÉHO SEKVENOVÁNÍ DNA PRO DETEKCI POLYMORFISMŮ KANDIDÁTNÍCH GENŮ U PRASAT Vykoukalová Z., Knoll A.,

Více

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava

Více

Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna

Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna Obsah přednášky 1) Klonování složených eukaryotických genů 2) Úprava rekombinantních genů 3) Produkce rekombinantních proteinů v expresních systémech 4) Promotory 5) Vektory 6) Reportérové geny Zdrojem

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Biologie. Mezipředmětové

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

Molekulární základ dědičnosti

Molekulární základ dědičnosti Molekulární základ dědičnosti Dědičná informace je zakódována v deoxyribonukleové kyselině, která je uložena v jádře buňky v chromozómech. Zlomovým objevem pro další rozvoj molekulární genetiky bylo odhalení

Více

ZÁKLADY BAKTERIÁLNÍ GENETIKY

ZÁKLADY BAKTERIÁLNÍ GENETIKY Zdroj rozmanitosti mikrorganismů ZÁKLADY BAKTERIÁLNÍ GENETIKY Různé sekvence nukleotidů v DNA kódují různé proteiny Různé proteiny vedou k různým organismům s různými vlastnostmi Exprese genetické informace

Více

REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK

REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK Molekulární základy dědičnosti - rozšiřující učivo REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK REPLIKACE deoxyribonukleové kyseliny (zdvojení DNA) je děj, při kterém se tvoří z jedné dvoušoubovice DNA dvě nová

Více

Centrální dogma molekulární biologie

Centrální dogma molekulární biologie řípravný kurz LF MU 2011/12 Centrální dogma molekulární biologie Nukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Mendel) 1869 objev nukleových kyselin (Miescher) 1944 genetická informace v nukleových

Více

Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký

Kapitola 3 Biomolecular Design and Biotechnology. Překlad: Jaroslav Krucký Kapitola 3 Biomolecular Design and Biotechnology Překlad: Jaroslav Krucký Problémy chemie a biologie mohou být velmi nápomocné, jestliže se naše schopnost vidět to, co děláme, a dělat věci na atomární

Více

Exprese rekombinantních proteinů

Exprese rekombinantních proteinů Exprese rekombinantních proteinů Exprese rekombinantních proteinů je proces, při kterém můžeme pomocí různých expresních systémů vytvořit protein odvozený od konkrétního genu, nebo části genu. Tento protein

Více

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci

Více

Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie

Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie Centrální dogma molekulární biologie ukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Transkripce D R Translace rotein Mendel) Replikace 1869 objev nukleových kyselin (Miescher) 1944 nukleové kyseliny

Více

Mikročipy v mikrobiologii

Mikročipy v mikrobiologii Mikročipy v mikrobiologii doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 Obsah přednášky 1) Charakteristika biočipů, DNA microarrays a DNA chip 2) Výroba čipů, charakteristika

Více

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická

Více

MOLEKULÁRNÍ TAXONOMIE - 4

MOLEKULÁRNÍ TAXONOMIE - 4 MOLEKULÁRNÍ TAXONOMIE - 4 V této přednášce si představíme metody, které získávají molekulární znaky bez použití sekvenace. Všechny tyto metody je teoreticky možné sekvenací nahradit. Oproti sekvenaci celých

Více

Elektroforéza Sekvenování

Elektroforéza Sekvenování Elektroforéza Sekvenování Výsledek PCR Elektroforéza V molekulární biologii se používá k separaci nukleových kyselin a bílkovin Principem je pohyb nabitých molekul v elektrickém poli Gelová, polyakrylamidová

Více

6. Nukleové kyseliny

6. Nukleové kyseliny 6. ukleové kyseliny ukleové kyseliny jsou spolu s proteiny základní a nezbytnou složkou živé hmoty. lavní jejich funkce je uchování genetické informace a její přenos do dceřinné buňky. ukleové kyseliny

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží

Více

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika 1/6 3.2.11.18 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010 Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem Milan Bartoš Forum veterinarium, Brno 2010 Vývoj farmakogenetické diagnostické soupravy pro stanovení genetických polymorfismů

Více

Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):

Více

Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100% F8 - hemofilie A monogenní

Více

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního

Více

ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN

ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN Fragmenty nukleových kyselin lze dle jejich velikosti rozdělit elektroforézou. Elektroforéza využívá rozdílné pohyblivosti jednotlivých fragmentů, danou právě

Více

Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry

Více

Laboratorní přístrojová technika

Laboratorní přístrojová technika Laboratorní přístrojová technika Co najdeme v laboratoři? Přístroje pro obecné použití centrifugy, třepačky, pipety, biohazard boxy Trocha teorie o DNA a PCR Analytické přístroje a příprava vzorků elektroforézy

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010

Více

MODERNÍ BIOFYZIKÁLNÍ METODY:

MODERNÍ BIOFYZIKÁLNÍ METODY: MODERNÍ BIOFYZIKÁLNÍ METODY: POKROČILÉ PRAKTICKÉ VZDĚLÁVÁNÍ V EXPERIMENTÁLNÍ BIOLOGII Operační program Vzdělávání pro konkurenceschopnost Číslo projektu: CZ.1.07/2.3.00/09.0046 Praktický kurz pokročilých

Více

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE POHLED Z LABORATOŘE Petra Hedvičákov ková ÚBLG FN Motol Odd. lékal kařské molekulárn rní genetiky MZO 00064203 23.-24.5.2008

Více

KBI/GENE Mgr. Zbyněk Houdek

KBI/GENE Mgr. Zbyněk Houdek Genealogie KBI/GENE Mgr. Zbyněk Houdek Rodokmenové schéma Shromáždění informací o rodině je 1. důležitým krokem v genetickém poradenství. Rodokmenové schéma musí být srozumitelné a jednoznačné. Poskytuje

Více

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 10 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 26.06.2014 Ročník: 6AF, 6BF Anotace DUMu: Procesy následující bezprostředně po transkripci.

Více

5. Sekvenování, přečtení genetické informace, éra genomiky.

5. Sekvenování, přečtení genetické informace, éra genomiky. 5. Sekvenování, přečtení genetické informace, éra genomiky. Minulá přednáška nastínila zrod molekulární biologie a představila některé možnosti, jak pracovat s DNA - jak ji analyzovat na základě velikosti

Více

NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin:

NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin: NUKLEOVÉ KYSELINY Deoxyribonukleová kyselina (DNA, odvozeno z anglického názvu deoxyribonucleic acid) Ribonukleová kyselina (RNA, odvozeno z anglického názvu ribonucleic acid) Definice a zařazení: Nukleové

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky

Více

ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a

Více

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00

Více

TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Dle čl. 7 odst. 2 Směrnice děkana pro realizaci bakalářských

Více

Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická

Více

25.2.2014. Genomika. Obor genetiky, který se snaží. stanovit úplnou genetickou informaci. organismu a interpretovat ji v. termínech životních pochodů.

25.2.2014. Genomika. Obor genetiky, který se snaží. stanovit úplnou genetickou informaci. organismu a interpretovat ji v. termínech životních pochodů. Genomika Obor genetiky, který se snaží stanovit úplnou genetickou informaci organismu a interpretovat ji v termínech životních pochodů. 1 Strukturní genomika stanovení sledu nukleotidů genomu organismu,

Více

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto

Více

Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách

Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách Molekulární biotechnologie č.8 Produkce heterologního proteinu v eukaryontních buňkách Eukaryontní buňky se využívají v případě, když Eukaryontní proteiny syntetizované v baktériích postrádají biologickou

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace Genetické markery Genetické markery

Více

BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc.

BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. BAKTERIÁLNÍ GENETIKA Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. -dědičnost u baktérií principiálně stejná jako u komplexnějších organismů -genom haploidní a značně menší Bakteriální genom

Více

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK Richard Prùša Richard Prùša Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK . Základy analytických metod v klinické molekulární biologii Richard Prùša Praha 1997 Základy analytických metod

Více

Genové terapie po 20 letech = více otázek než odpovědí

Genové terapie po 20 letech = více otázek než odpovědí Genové terapie po 20 letech = více otázek než odpovědí Jiří Heřmánek Genzyme 25.11.2008 Disclosure statement Ač vzděláním biochemik, nejsem odborník na genové terapie, tzn. považujte mne prosím za poučeného

Více

DNA, komplementarita, dopsání komplementárního vlákna

DNA, komplementarita, dopsání komplementárního vlákna Příklady z genetiky Řešené příklady ze stránek http://genetika.wz.cz/priklady/. Jakákoli písemná publikace tohoto textu bez uvedení zdroje není povolena. DNA, komplementarita, dopsání komplementárního

Více

Buňky, tkáně, orgány, soustavy

Buňky, tkáně, orgány, soustavy Lidská buňka buněčné organely a struktury: Jádro Endoplazmatické retikulum Goldiho aparát Mitochondrie Lysozomy Centrioly Cytoskelet Cytoplazma Cytoplazmatická membrána Buněčné jádro Jadérko Karyoplazma

Více

Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219.

Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219. Vzdělávací materiál vytvořený v projektu OP VK Název školy: Gymnázium, Zábřeh, náměstí Osvobození 20 Číslo projektu: Název projektu: Číslo a název klíčové aktivity: CZ.1.07/1.5.00/34.0211 Zlepšení podmínek

Více

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI INDUKOVANÉ PŮSOBENÍM ORGANICKÝCH LÁTEK Z PRACHOVÝCH ČÁSTIC V OVZDUŠÍ Kateřina Hanzalová Oddělení genetické ekotoxikologie Ústav experimentální medicíny AV ČR v.v.i.

Více

Okruhy otázek ke zkoušce

Okruhy otázek ke zkoušce Okruhy otázek ke zkoušce 1. Úvod do biologie. Vznik života na Zemi. Evoluční vývoj organizmů. Taxonomie organizmů. Původ a vývoj člověka, průběh hominizace a sapientace u předků člověka vyšších primátů.

Více

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH RÁMCOVÝ VZDĚLÁVACÍ PROGRAM PRO ZÍSKÁNÍ SPECIALIZOVANÉ ZPŮSOBILOSTI v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH 1. Cíl specializačního vzdělávání Cílem specializačního vzdělávání

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Hemofilie Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Definice hemofilie Nevyléčitelná vrozená krvácivá choroba s nedostatkem plazmatických faktorů FVIII hemofile A FIX hemofile

Více

Mutační změny genotypu

Mutační změny genotypu Mutační změny genotypu - změny genotypu: segregace, kombinace + MUTACE - náhodné změny Mutace - genové - spontánní - chromozómové - indukované (uměle vyvolané) - genomové A) Genové mutace - změna (ztráta)

Více

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí Stárnutí organismu Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí poklesy funkcí se liší mezi orgánovými systémy Některé projevy stárnutí ovlivňuje výživa Diagnostické metody odlišují

Více