ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce"

Transkript

1 METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction) je metoda, která umožňuje z komplexní (celkové) DNA namnožit vybraný úsek, např. určitý exon analyzovaného genu, bez předchozího klonování ve vektorech (viz dále). Předpokladem je znalost pořadí basí na začátku a na konci požadované sekvence DNA pro syntézu krátkého (oligonukleotidového) jednovláknového úseku DNA; primeru dlouhého bp. Princip PCR je obdobou replikace nukleových kyselin. Během PCR reakce dochází k cyklickému opakování enzymové syntézy nových řetězců vybraných úseků dvouřetězcové DNA ve směru 5' 3', která je zprostředkovaná DNApolymerasou. Syntetizovaný úsek DNA je tepelně denaturován (při 95 o C) a se vzniklými dvěmi jednovláknovými molekulami DNA následně hybridizují primery (při o C). Napojm primerů je umožněna syntéza komplementárních vláken DNA (při o C), kterou zajišťuje DNA-dependentní-DNA-polymerasa Taq. Taq-polymerasa je izolovaná z bakterie vyskytující se v teplých pramenech a n proto inaktivována při vyšch teplotách v průběhu PCR reakce. DNA-polymerasa tvoří komplementární vlákna DNA podle matrice DNA jen od místa navázání primerů (navazováním nukleotidů k primeru - viz replikace). Časové omez PCR reakce určuje délku nově syntetizovaného vlákna DNA. Po 1. cyklu je replikovaný úsek DNA zdvojnásoben. Následuje dal denaturace a celý cyklus se opakuje. Množ vybraného úseku pokračuje geometrickou řadou. Po 30ti cyklech bývá DNA zmnožena řádově Tím, že PCR umožňuje získání relativně velkého množství DNA z velmi malých vzorků, nachází uplatnění v mnoha oblastech molekulární biologie. Metodu PCR schematicky znázorňuje následující obrázek. PCR je automatizovaný proces, který probíhá v přístroji označovaném thermocykler. Thermocykler je naprogramován tak, aby v jednotlivých teplotních krocích byly automaticky dodržované tepelné podmínky pro (a) denaturaci DNA, (b) pro připoj primerů a (c) tvorbu komplementárních vláken DNA. Reakční směs pro PCR obsahuje pufr (roztok, který udržuje stabilní ph), vzorek DNA, dostatečné množství všech čtyř typů nukleotidů (2'- deoxyribonukleosid-5'-trifosfáty dntp), primery a DNA-dependentní-DNA-polymerasu Taq. V reakční směsi jsou dále v optimalizované koncentraci přítomny hořečnaté ionty Mg 2+, ál elům m a dal řen

2 které tvoří rozpustný komplex s dntp, který rozpoznává DNA-polymerasa a chelační činidla (např. EDTA), která inhibují deoxyribonukleasy. PRINCIP METODY PCR (1 MOLEKULA) DENATURACE 1. CYKLUS PRIMERY Taq-POLYMERASA 2. CYKLUS CYKLUS 4. CYKLUS 5. CYKLUS (2 MOLEKULY) DENATURACE PRIMERY Taq-POLYMERASA (4 MOLEKULY) DENATURACE PRIMERY Taq-POLYMERASA (8 MOLEKUL) (16 MOLEKUL) ál elům m a dal řen (32 MOLEKUL)

3 Štěp DNA Restrikční endonukleasy Restrikční endonukleasy (restriktasy) jsou sekvenčně specifické bakteriální enzymy (endonukleasy), které chrání baktérii před vniknutím cizorodé DNA, například při infekci baktérie bakteriofágem. Cizí dvouvláknová DNA je restriktasou rozštěpena, vlastní DNA je proti působ enzymu chráněna (obvykle methylací některých basí). Restrikční endonukleasy mohou štěpit dvouvláknové molekuly DNA jakéhokoliv původu, pokud v nich existují pro ně specifická cílová místa štěp se specifickým pořadím basí pro určitou restriktasu. K rozštěp molekuly DNA dochází hydrolysou fosfodiesterových vazeb obou řetězců v restrikčním místě (místo štěp). Cílového místa jsou obvykle sekvence 4-6 bp. Štěp DNA může být uvnitř této cílové sekvence, případně před nebo za ní. Názvy restrikčních endonukleas jsou odvozovány od jména baktérie, ze které byly získány. V současné době je známo přes restriktas. Například restriktasa EcoR I byla získána z bakterie Escherichia coli, kmen RY 13. Cílová sekvence této restriktasy musí být na obou vláknech DNA shodná a štěp dvouvláknové molekuly DNA je od 5' konce. Pro restriktasu EcoR I to je mezi G a následující sekvencí AATTC od 5' konce (znázorněno značkou ), tzn. 5'-G AATTC-3'. Cílové sekvence tvoří velmi často palindrom (čt sekvence shodné z obou konců). Pokud dochází ke štěp DNA uprostřed palindromu, vznikají konce bez přesahů, tzv. tupé konce. Pokud nedochází ke štěp DNA uprostřed palindromu, vznikají přerušm fosfodiesterických vazeb DNA kohezní konce (lepivé konce, konce s přesahem), viz následující obrázek. 5'-AATGCTAATGCCTAGTCAAGCTTTCATCGAG AATTCCAGTCGAA-3' 3'-TTAGCTTTACGGATCAGTTCGAAAGTAGCTCTTAA GGTCAGCTT-5' 5'-AATGCTAATGCCTAGTCAAGCTTTCATCGAG 3'-TTAGCTTTACGGATCAGTTCGAAAGTAGCTCTTAA AATTCCAGTCGAA-3' GGTCAGCTT-5' ál elům m a dal řen

4 Několik příkladů běžných restrikčních endonukleas a jejich restrikčních míst je uvedeno v následující tabulce. Je uvedeno ze restrikční místo na jednom vlákně DNA ve směru 5' 3'. Bakteriální zdroj Název restriktázy Cílové místo štěp (dvouvláknová DNA) Arthrobacter luteus Alu I 5'-AG CT-3' (tupé konce) Bacillus amyloliquefaciens BamH I 5'-G GATCC-3' (kohezní konce) Escherichia coli RY 13 EcoR I 5'-G AATTC-3' (kohezní konce) Haemophilus influenzae Hind III 5'-A AGCTT-3' (kohezní konce) Moraxella sp. Msp I 5'-C CGG-3' (kohezní konce) Streptomyces albus Sal I 5'-G TCGAC-3' (kohezní konce) Staphylococcus aureus Sau 3A 5'- GATC-3' (kohezní konce) Thermus aquaticus Taq I 5'-T CGA-3' (kohezní konce) Restrikční mapy Působíme-li na izolovanou DNA určitou restriktasou, dojde k jejímu rozštěp na úseky (fragmenty) rozdílné délky podle umístění cílových sekvencí štěp v molekule DNA. Restrikční mapa ukazuje pomocí vzniklých fragmentů počet restrikčních míst v molekulách DNA a velikost fragmentů pro jednotlivé restrikčních endonukleasy. Informace jsou pak kompletovány pro molekuly DNA jednotlivých chromosomů. DNA rozdělená na jednotlivé fragmenty pak může být dále analyzována se zřetelem na polymorfismy v délce restrikčních fragmentů v populaci. Polymorfismy v délce fragmentů jsou podmíněné počtem párů basí mezi dvěma cílovými místy štěp. Jsou vyvolané např. mutací v cílovém místě štěp a tím jeho zrušm nebo různým počtem tandemových repetitivních sekvencí mezi dvěma místy štěp atp. Stanov polymorfismů genomů Detekce polymorfismů (rozdílů) se může týkat celé genomové, chromosomové nebo ál elům m a dal řen mitochondrální DNA, a nebo polymorfismů specifických genů nebo jejich specifických částí,

5 tzn. polymorfismů (rozdílů) v sekvenci (v pořadí nukleotidů) DNA. Rozdíly v sekvenci DNA mohou, ale nemusí ovlivnit určité fenotypové znaky. Identifikace a typizace určitých polymorfismů umožňuje rozliš jedinců např. s ohledem na preventivní opatř a léčbu choroby. Genotypové diagnostické metody (analýza DNA) jsou, na rozdíl od diagnózy podle fenotypových projevů, přesné. Pro stanov sekvenčního polymorfismu DNA mohou být žity přímé metody, kdy se stanovuje sekvence variabilní oblasti DNA (viz sekvencování) nebo nepřímé metody, založené na amplifikaci DNA nebo využívající restrikční endonukleasovou analýzu a selektivní hybridizaci restrikčních fragmentů se specifickými sondami. Dal techniky pro identifikaci polymorfismů využívají rozdílnou pohyblivost fragmentů DNA se standardní a mutantní formou genu při elektroforéze, která je odrazem konformačních polymorfismů nukleových kyselin. Vysoce rozlišovací techniky umožňují identifikaci i jednonukleotidových polymorfismů (SNP). Polymorfismus délky restrikčních fragmentů (RFLP) Působíme-li na izolovanou DNA jedince určitou restriktasou, dojde k jejímu rozštěp na úseky (fragmenty) rozdílné délky podle umístění cílových sekvencí štěp pro žitou restriktasu. DNA od různých jedinců stejného druhu pak může mít délku fragmentů (i jejich počet) buď shodnou, nebo rozdílnou. Pokud mezi jedinci téhož druhu při žití téže restriktázy nacházíme fragmenty rozdílné délky, pak hovoříme o polymorfismu v délce restrikčních fragmentů (RFLP Restriction Fragment Length Polymorphism). Vysvětlm vzniku polymorfismu délky restrikčních fragmentů může být například mutace některého nukleotidu v cílové sekvenci štěp (variabilní restrikční místo). Restriktasa pak v takto změněné cílové sekvenci neštěpí a vzniká fragment, jehož délka je součtem délek dvou sousedních původních fragmentů. Naopak je též možné, že mutací vznikne nová cílová sekvence a tak dojde ke zkrác délky restrikčního fragmentu. Jinou možností vzniku polymorfismu délky restrikčních fragmentů je včlenění, nebo vyčlenění, nukleotidů mezi dvěmi cílovými sekvencemi - variabilita krátkých tandemově opakujících se repetic. Pak jsou získány restrikční fragmenty del (respektive krat). Schematické znázornění shodných úseků DNA vykazujících rozdílné příčiny vzniku polymorfismu délky restrikčních fragmentů ukazuje následující schéma zobrazující situaci na jednom vlákně DNA. ál elům m a dal řen

6 a) dvě restrikční místa (3 fragmenty) 5' TAATGCCTTCTCAAGCTTTCATCGAG AATTCCAGTCGAAAGCTTTCATCGAG AATTCCAGT 3' b) první restrikční místo zrušeno záměnou nukleotidů A C; 2 fragmenty 5' TAATGCCTTCTCAAGCTTTCATCGAGACTTCCAGTCGAAAGCTTTCATCGAG AATTCCAGT 3' c) vznik nového (dalho) restrikčního místa záměnou nukleotidů CC AA; 4 fragmenty 5' TAATG AATTCTCAAGCTTTCATCGAG AATTCCAGTCGAAAGCTTTCATCGAG AATTCCAGT 3' d) variabilita krátkých repetitivních sekvencí, zde CGAT, vede v obou molekulách ke štěp na dva fragmenty, ale odlišné délky 5' CGAAAGCTTCGATCGATCGATCGATCGATCGATCGATCGATTCATCGAG AATTCC 3' 5' CGAAAGCTTCGATCGATCGATCGATCGATCGATCGATCGATCGATTCATCGAG AATTCC 3' Délka restrikčních fragmentů se dědí. Dědičnost se řídí pravidly Mendelovské genetiky (viz Monohybridismus). Velikosti restrikčních fragmentů můžeme hodnotit pomocí gelové elektroforézy. Fragmenty DNA mají záporný náboj, proto všechny fragmenty putují při jednosměrném proudu od záporné elektrody (-) k elektrodě kladné (+). Mezi nejžívaněj gelové nosiče patří agaróza a polyakrylamid, které působí molekulární síto (jsou porézní, velikost pórů určuje jejich hustota). Pomocí gelové elektroforézy můžeme rozdělit jednotlivé fragmenty DNA podle jejich velikosti. Malé molekuly (fragmenty) putují v gelu rychleji než velké. O rozlož jednotlivých restrikčních fragmentů v gelu se můžeme přesvědčit obarvm barvivem ethidiumbromidem. U eukaryotických genomů získáme z komplexní DNA vysoký počet fragmentů natolik velikostně rozdílných, že vytvářejí na elektroforetogramu souvislý pruh. V těchto případech žíváme pro identifikaci fragmentů, které potřebujeme pro dal analýzu, Southernovu metodu. ál elům m a dal řen

7 Southernův přenos Southernův přenos (blotting = "přepijákování") je metoda, která se žívá při zkoumání velikosti restrikčních fragmentů určitého úseku DNA. Principy Southernovy metody jsou následující: a) Pomocí vybrané restrikční endonukleasy je rozštěpena celková (komplexní) DNA získaná z jaderných buněk jedince. b) Získané fragmenty se rozdělí gelovou elektroforézou. c) Po denaturaci DNA jsou vzorky přeneseny na hybridizační membránu (nitrocelulóza nebo nylonová membrána). Gelové nosiče nejsou vhodné pro dal postupy protože jsou velmi křehké. d) Přenos (blotting) fragmentů z gelu na membránu se realizuje vzlínáním pufru z rezervoáru. e) Po přenes fragmentů nastupuje fixace fragmentů na podložku. f) Dalm krokem je hybridizace s radioaktivně značenou sondou (probou). Sondou bývá krátká sekvence DNA, která specificky hybridizuje s restrikčními fragmenty na základě komplementarity basí. Při diagnostice dědičných chorob je vybrána sonda, která je komplementární k fragmentu, na kterém leží vyšetřovaný gen (extragenová sonda) nebo je komplementární přímo s krátkou sekvencí vyšetřovaného genu (intragenová sonda). ál elům m a dal řen

8 g) Po opláchnutí nenavázané sondy se autoradiograficky hodnotí lokalizace fragmentů, u kterých došlo k hybridizaci sondy. Jako sondu lze např. žívat DNA z knihoven cdna (viz dále). cdna (komplementární DNA, copy DNA), je DNA získaná reversní transkripcí mrna. Takto získaná DNA nenese sekvence odpovídající intronům. V případě, že DNA analýzu nelze vyhodnotit ze pomocí délky nebo počtu restrikčních fragmentů, je možné využít dal metodu založenou na specifické hybridizaci vzorku DNA a to s tzv. alelově specifickou sondou. Alelově specifické sondy jsou oligonukleotidy o délce přibližně 20 bp, které hybridizují s neštěpenou denaturovanou DNA v místě, kde je úplná shoda všech komplementárních nukleotidů. Stačí tedy odchylka v jediném nukleotidu, aby k hybridizaci nedošlo. Alelově specifické sondy mohou tedy velmi citlivě stanovit i velmi malé genetické změny ve zkoumané DNA, pokud jsou lokalizovány v místě hybridizace sondy, nikoliv ale všechny mutace vyšetřovaného genu. Polymorfismus konformace jednořetězcových vláken DNA nebo RNA (SSCP) Polymorfismus jednořetězců nukleových kyselin ukazuje sekvenční rozdíly mezi alelami. Sekvenční rozdíly (i rozdíl jedné base) se odrazí na odlišné pohyblivosti vyšetřovaných jednořetězcových úseků DNA nebo RNA ( o velikosti pb) při nedenaturujících elektroforetických podmínkách. Polymorfismus konfirmace dvouřetězců (DSCP) Při pomalé renaturaci fragmentů DNA se vytvářejí duplexy DNA. Duplexy s úplnou komplementaritou basí (homoduplexy) mají v nedenaturujících gelech odlišnou (vyš) elektroforetickou pohyblivost než heteroduplexy, jejichž řetězce nemají úplnou komplementaritu basí. Heteroduplexy jsou důkazem bodových mutací v genomech. Sekvencování DNA Sekvencování DNA je stanov primární struktury, pořadí nukleotidů, v molekulách DNA. Cílem zkoumání je stanov pořadí nukleotidů celého genomu (např. projekt HUGO). Tato informace je základ pro exaktní genetickou diagnostiku a v perspektivě i pro kauzální genetickou terapii a odezvu jednotlivých pacientů na podání léčiva (farmakogenetika). K zjišťování pořadí (sekvence) basí v určitém úseku DNA se žívají různé metody sekvencování, často automatizované. ál elům m a dal řen

9 Jedna z žívaných metod je enzymová Sangerova metoda, která je založena na enzymově katalyzované terminaci syntézy DNA po zabudování dideoxyribonukleotidu (ddntp - 2',3'- dideoxyribonukleosid-5'-trifosfát) do nově vznikajícího komplementárního vlákna. Při sekvencování Sangerovou metodou je DNA, která má být sekvencována, žita matrice pro syntézu komplementárního vlákna. Dideoxyribonukleotidy se začleňují do vlákna syntetizované DNA náhodně na místo příslušného nukleotidu (2'-deoxyribonukleosid-5'- trifosfátu). Po zabudování dideoxyribonukleotidu, který postrádá 3'-OH skupinu, nemůže DNA-polymerasa k němu v důsledku nepřítomnosti 3'-OH skupiny připojit dal nukleotid a syntetizovaný řetězec DNA se nemůže dále prodlužovat. Výsledkem enzymové Sangerovy metody je vznik různě dlouhých fragmentů DNA, které nesou na konci určitý, fluorochromy nebo radioaktivně značený, dideoxyribonukleotid ddgtp, ddatp, ddttp, ddctp. Délka fragmentu a jeho koncový dideoxyribonukleotid informuje o sekvenci nukleotidů v analyzovaném vzorku DNA. Metoda je schematicky znázorněna na následujícím obrázku. Sekvencování je prováděno ve čtyřech vzorcích, kdy každý analyzovaný vzorek stanovuje pořadí jednoho ze čtyř nukleotidů. Každý analyzovaný vzorek obsahuje směs (i) čisté DNA, která má být sekvencována, (ii) značený primer, připojující se k vláknu analyzované DNA, (iii) směs všech čtyř nukleotidů (A, G, C, T) a v každém vzorku jeden ze čtyř ddntp, který je koncový inhibitor syntézy DNA a (iiii) DNA-polymerasu. ál elům m a dal řen

10 3' 5' Analyzovaná DNA (jednovláknová) 5' 3' Značený primer DNA-polymerasa, primer, nukleotidy - rozděl do čtyř zkumavek. Přidány jednotlivé ddntp: ddatp, ddctp, ddgtp, ddttp Následuje syntéza komplementárního vlákna (značeno barevně pro jednotlivé ddntp) ve směru 5' 3' podle analyzovaného vzorku jednovláknové DNA (černá čára; směr 3' 5') A C G T A C G T A C G T Elektroforéza A C G T - Sekvence nukleotidů je odečtena z gelu podle délky fragmentů s příslušnými koncovými ddntp Výsledná sekvence na syntetizovaném vlákně: 5'- C T A G T A G G T C C A - 3' Sekvence analyzované DNA (komplementarita párování basí): 3'- G A T C A T C C A G G T - 5' Automatické sekvencování Automatickém sekvencování je plně automatizovaný proces, který umožňuje rychlou analýzu vzorků. Při srovnání s výše uvedenou enzymovou metodou má tyto odlišnosti: (i) syntéza DNA je asymetrická polymerasová řetězová reakce, která probíhá v termocykleru za účasti Taq DNA-polymerasy; (ii) pro stanov produktů ončených specifickou basí se + ál elům m a dal řen

11 žívají čtyři odlišné fluorescenční značky; (iii) délka stanovené sekvence je mezi basemi. Detekce produktů sekvenčních reakcí probíhá v průběhu elektroforézy automaticky pomocí laserového detektoru napojeného na počítač, který z pořadí signálů přímo hodnotí sekvenci DNA. Obrázek ukazuje výsledek automatického sekvenování; převzato otevřená encyklopedie com). DNA čipy (expresní profilování), DNA microarrays DNA čipy jsou skleněné destičky, na které je umístěno velké množství cdna (desítky tisíc) nebo krátkých specifických sekvencí jednotlivých genů (mikromnožství pro každý vzorek). Hybridizace s fluorescenčním barvivem značenou sondou cdna, vytvořenou z mrna sledované tkáně, umožní stanovit, které geny jsou v této tkáni v daném období exprimovány (aktivní) a i intenzitu jejich transkripční aktivity. Vizualizace hybridizace se provádí v zaříz využívajícím počítačovou analýzu. Metoda expresního profilování na DNA čipech pomáhá stanovit v jednom vzorku souboru aktivitu velkého počtu genů, mnohdy i všech známých genů daného organismu. Hodnoc může být zaměřeno na různé situace je např. reakce organismu na působ nepříznivých vnějch podmínek nebo na expresi komplexu genů při různých onemocněních i s možností posoudit genovou expresi při jejich léčbě a to i se zřetelem k věku jedince (viz dále Prenatální vývoj a stárnutí organismu). V současné době n tato metoda využívána rutinně, je velmi nákladná. Vyžaduje oup drahého technického vybav a drahá je také syntéza primerů i proved PCR pro vytvoř DNA čipu. ál elům m a dal řen

12 Převzato otevřená encyklopedie com Genové inženýrství Kohezní konce jsou jednovláknové úseky DNA, které mohou na principu komplementarity bází hybridizovat s kohezním koncem i jiné DNA. Může tak dojít i k hybridizaci s cizí molekulou DNA, například plasmidu a eukaryotní buňky, pokud obě DNA byly štěpeny stejnou restriktasou. Použitím enzymu ligasy je možné vytvořit fosfodiesterovou vazbu a tak napojit úsek jedné DNA molekuly s úsekem jiné molekuly DNA. Tímto způsobem vzniká rekombinantní DNA. Pokud jde o kruhovou DNA plasmidu, musí hybridizaci předcházet linearizace molekuly DNA. Ke štěp a linearizaci je zvolena restriktasa, která DNA plasmidu štěpí ze v jednom místě a vytváří v místě štěp kohezní konce. Fragment lidské DNA (insert) má shodné kohezní konce linearizovaná DNA plasmidu, což umožňuje hybridizaci na koncích rozštěpené DNA plasmidu s fragmentem lidské DNA na základě komplementarity basí. Při hybridizaci se uplatňuje také, mimo jiné, enzym ligasa, který zajišťuje spoj vláken DNA. ál elům m a dal řen

13 působ restrikční endonukleasy na DNA plasmidu DNA plasmidu působ restrikční endonukleasy na lidskou DNA DNA plasmidu s inzertem lidské DNA Klonování lidské DNA Velikost genomu lidských buněk vyžaduje při molekulárně genetické analýze využití klonování DNA. Klonování DNA umožňuje např. štěp DNA restrikčními endonukleasami na fragmenty a vytvoř rekombinantní DNA s DNA vhodného vektoru (nosiče). Jako vektory se žívají bakteriální plasmidy, jinou možností je využití virového nosiče, jsou například bakteriofágy. Po vprav vektoru, například plasmidu do baktérie, je možné množit klony baktérií (tedy potomky jedné baktérie) s tímto vektorem a tím zapojit do procesu replikace zkoumaný úsek DNA. Touto metodou lze vytvořit genomové knihovny, tzn. různé klony baktérií s různými fragmenty DNA. Soubor klonů pak může představovat DNA celého eukaryotického genomu. Pro vytvář genomové knihovny savců je optimální délka fragmentů pro vprav do plasmidového vektoru okolo 40 kb. Jednotlivé fragmenty jsou připraveny tak, aby se jejich koncové sekvence navzájem překrývaly. Tím vznikají klony (knihovny genomové DNA), ve kterých fragmenty DNA vytvářejí informaci nejen o jednotlivých fragmentech, ale tím, že se vzájemně překrývají, i o jejich vzájemném sousedství (sledu) v komplexní DNA. Genomová DNA jednoho jedince je ve všech jeho buněčných typech stejná (s výjimkou buněk imunitního systému a nádorových buněk). Při konstrukci genomových knihoven se v současné době žívají i uměle vytvořené vektory. ál elům m a dal řen

14 cdna knihovny jsou vhodné pro zkoumání transkripčně aktivních genů. Principem je získání mrna z určitého typu buněk (určité tkáně, orgánu), které jsou specializované na tvorbu některého polypeptidu. Pomocí reverzní transkripce je pak získána cdna (komplementární), která je začleněna do vhodného vektoru a následně namnožena. cdna knihovny obsahují, na rozdíl od knihoven genomových, ze informaci o funkčních genech. Informace obsažená v cdna knihovnách je omezena ze na exony příslušného genu (viz úpravy mrna transkripce). Knihovny cdna buněk odlišných tkání nejsou identické, závisí na expresi genů v konkrétních buňkách určité tkáně. To znamená, že se bude lišit cdna knihovna např. buněk jater a svalové tkáně. DNA diagnostika Metody molekulární genetiky umožňují zpřesnění rizika onemocnění pro členy rodin s výskytem Mendelovsky děděných chorob. Metody DNA diagnostiky můžeme rozdělit na metody přímé a nepřímé. Přímé metody Pomocí metody PCR se amplifikují jednotlivé úseky genu, ve kterém je očekáván nález mutace, a jednotlivé části genu (fragmenty) se pak vyšetří na přítomnost mutace. (i) (ii) (iii) Metody SSCP a DSCP (viz výše), které využívají rozdíly ve fyzikálněchemickém chování molekul DNA nesoucích mutaci v porovnání se standardní molekulou DNA (bez mutace), kdy změna sekvence mění konformaci fragmentu DNA a tím i rychlost pohybu fragmentu v gelu. Přítomnost variabilního restrikčního místa (viz RFLP). V některých genech vzniká mutací nové restrikční místo pro určitou restriktasu (přítomnost variabilního restrikčního místa) nebo restrikční místo kauzální mutací zaniká. Přítomnost nebo nepřítomnost tohoto restrikčního místa je pak přímým důkazem mutace. Jako příklad takové situace uvádíme v na populaci nejfrekventovaněj mutaci v genu, který kóduje enzym fenylalaninhydroxylasu (PAH). Mutace vytváří nové restrikční místo pro restriktasu Sty I. Mutace v obou alelách genu PAH vede ke vzniku fenylketonurie. Sekvencování zachycuje konkrétní změnu v sekvenci nukleotidů. Tato metoda se v přímé diagnostice většinou využívá až když je ve sledovaném genu nalezena přibližná lokalizace mutace, například změnou pohyblivosti určitého fragmentu ál elům m a dal řen genu v elektoforéze. Sekvencovat celý gen je pracné a finančně nákladné.

15 Nepřímá diagnostika Nepřímá metoda je metodou rodokmenovou, kdy je třeba získat DNA od postiženého jedince, jeho rodičů, sourozenců, případně dalch členů rodiny. Nepřímá metoda je založena na polymorfismu délky restrikčních fragmentů - RFLP (viz výše, dále Mendelovská dědičnost, Vazba genů). Dal součástí molekulárně genetické analýzy situace v rodině je žití vhodné sondy (próby), která hybridizuje s úsekem vyšetřovaného genu (vnitrogenová sonda) nebo v jeho blízkosti (mimogenová sonda) (viz Vazba genů, Metoda Southern-blot). Princip vyšetř spočívá v tom, že od jednotlivých osob získáme jaderné buňky, ze kterých izolujeme DNA. DNA je rozštěpena vhodnou restrikasou. Dal postup je založený na Southernově metodě (viz výše). Pomocí DNA postiženého jedince je možné stanovit lokalizaci alel sledovaného genu na fragmentu určité délky. Délka restrikčních fragmentů je děděna podle Mendelových pravidel. Na základě těchto pravidel je možné, při existenci polymorfismu délky restrikčních fragmentů v rodině, stanovit genotypy členů rodiny. Jestliže lze pomocí RFLP jednoznačně stanovit genotyp všech členů rodiny, je vyšetř plně informativní. V případě, kdy vyšetř n informativní nebo je informativní ze částečně, je nutné žít jinou restrikční endonukleasu, která by informativní výsledek poskytla. Následující obrázky uvádějí příklady konkrétní rodinné situace. Všimněte si rozdílu mezi situací, kdy gen je lokalizován na autosomu a na heterochromosomu X, kdy ženy mají dva chromosomy X a muži ze jeden X chromosom. Výskyt choroby je v obrázcích znázorněn genealogickými značkami. V dolní polovině obrázku jsou výsledky vyšetř RFLP. Jedná se o schematické znázornění výsledků elektroforézy, kdy jednotlivé osoby mají odpovídající elektroforetogram znázorněn čárou pod svou rodokmenovou značkou. Poznatky získané na základě metod molekulární genetiky jsou využívány ve farmaceutickém průmyslu a v prenatální i postnatální diagnostice monogenně děděných chorob. Výhodou molekulárně genetických technik je jejich relativně vysoká spolehlivost, rychlost získání výsledků. Je možné pracovat i s velmi malým množstvím tkáně, nebo s jadernými buňkami vzorků krve. Perspektivou je využití metod genového inženýrství při kauzální terapii genetických chorob. Pro procvič genetických zákonitostí uvádíme v následujících obrázcích schematicky diagnostiku metodou RFLP. ál elům m a dal řen

16 A) V rodině, ve které je matka a dcera postižena brachydaktylií (AD) bylo provedeno DNA vyšetř členů rodiny metodou RFLP. Výsledek vyšetř je graficky znázorněn (rodokmen a elektroforéza fragmentů DNA Southern-blot). a) Posuďte, zda je vyšetř informativní a pokud ano, jaký je genotyp plodu, u které se zatím choroba neprojevila. b) v případě, že vyšetř n informativní, vypočítejte pravděpodobnost, že plod bude postižen pomocí Mendlových zákonitostí o dědičnosti. Genotyp matky a dcery postižené brachydaktylií je Aa (viz AD děděné choroby), otec s normálně vyvinutými prsty rukou má genotyp aa. Pro prenatální diagnostiku plodu musí být provedeno vyšetř všech členů rodiny včetně plodu metodou RFLP. fragmenty a 2 1 A a a Aa Aa nebo aa Vyšetř n informativní. Genotyp plodu nelze určit. Vysvětl: Otec je heterozygot v délce restrikčních fragmenů a homozygot v alelách (aa). Matka je homozygotka v délce fragmenů a heterozygotka v alelách (Aa). Prvorozená dcera zdědila od matky dominantní alelu, která je ve vazbě s fragmentem 1, a od otce recesivní alelu vázanou na fragment 2. Plod zdědil od otce recesivní alelu, která je ve vazbě s fragmentem 1. Od matky jeden z fragmentů 1, ale nelze identifikovat zda ve vazbě s dominantní nebo recesivní alelou. V tomto případě podle Mendelových zákonitostí o dědičnosti můžeme ze ál elům m a dal řen konstatovat pravděpodobné riziko postiž, které u AD onemocnění je 50%.

17 B) Využití RFLP pro nepřímou diagnostiku (vazebná analýza) u autosomálně recesivního onemocnění (např. fenylketonurie, cystická fibróza) 2 A A A 1 aa a AA a a Vysvětl: Postižený chlapec je recesivní homozygot aa. Oba rodiče jsou heterozygoti Aa. Oba rodiče jsou zároveň i heterozygoti v délce restrikčních fragmentů; heterozygocie alel a restrikčních fragmentů jsou dva na sobě nezávislé jevy. Postižený syn je homozygot v délce fragmentů 1. To znamená, že od obou rodičů zdědil fragment 1, se kterým je ve vazbě recesivní alela sledovaného genu. Na homologních chromosomech u rodičů je tedy alela A ve vazbě s fragmentem 2 a alela a (mutovaná) s fragmentem 1. S fragmentem 2 u obou rodičů je ve vazbě dominantní alela A. Genotyp druhorozené dcery je AA, je homozygota pro fragmenty 2. Vyšetř plodu ukázalo, přítomnost fragment 1 a 2 (jedem byl zděděn od otce, druhý od matky. Genotyp plodu je Aa. Dítě bude zdravé. Vyšetř metodou RFLP je plně informativní. ál elům m a dal řen

18 C) Využití RFLP pro nepřímou diagnostiku (vazebná analýza) u gonosomálně recesivních onemocnění (např. hemofílie, barvoslepost). 2 X + X + X + X + 1 X - X - X - Vysvětl: X chromosom dědí synové od matky. Dcery dědí jeden chromosom X od matky, druhý chromosom X od otce. Ženy mohou být přenašečkami mutované alely (heterozygotky X + X - ). Mužové jsou buď zdraví (X + Y) nebo nemocní (X - Y). Při RFLP analýze bude u mužů detekován ze jeden restrikční fragment (jeden chromosom X), u žen dva (dva chromosomy X). Prvorozený syn je postižený (X - ). Postižený chlapec získal X chromosom s mutací (X - ) ve sledovaném genu od heterozygotní matky (X + X - ). Mutovaný gen je u matky ve vazbě s fragmentem 1. S fragmentem 2 je u matky ve vazbě nemutovaný gen ((X + ). Otec je zdráv (X + ); nemutovaný gen je ve vazbě s fragmentem 2. Dcera je heterozygotka v délce fragmentů. Její genotyp je X + X -. U plodu mužského pohlaví, které bylo stanoveno cytogenetickým vyšetřm buněk plodu, byl nalezen fragment 2 nesoucí nemutovaný gen. Tato situace představuje úspěšnou DNA diagnostiku. Vyšetř je informativní. ál elům m a dal řen

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

Molekulární základ dědičnosti

Molekulární základ dědičnosti Molekulární základ dědičnosti Dědičná informace je zakódována v deoxyribonukleové kyselině, která je uložena v jádře buňky v chromozómech. Zlomovým objevem pro další rozvoj molekulární genetiky bylo odhalení

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100% F8 - hemofilie A monogenní

Více

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem

Více

Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace Genetické markery Genetické markery

Více

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK Richard Prùša Richard Prùša Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK . Základy analytických metod v klinické molekulární biologii Richard Prùša Praha 1997 Základy analytických metod

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí Stárnutí organismu Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí poklesy funkcí se liší mezi orgánovými systémy Některé projevy stárnutí ovlivňuje výživa Diagnostické metody odlišují

Více

Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE

Více

DNA, komplementarita, dopsání komplementárního vlákna

DNA, komplementarita, dopsání komplementárního vlákna Příklady z genetiky Řešené příklady ze stránek http://genetika.wz.cz/priklady/. Jakákoli písemná publikace tohoto textu bez uvedení zdroje není povolena. DNA, komplementarita, dopsání komplementárního

Více

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D.

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D. GENETICKÉ PORADENSTVÍ u pacientů s epidermolysis bullosa congenita MUDr. Renata Gaillyová, Ph.D. Homozygot jedinec, který zdědil po rodičích tutéž alelu. Jedinec nebo genotyp s identickými alelami v daném

Více

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Kamila Zdeňková Transgenní rostliny, tj. takové rostliny, do jejichž dědičného základu byly metodami genového inženýrství

Více

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 10 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 26.06.2014 Ročník: 6AF, 6BF Anotace DUMu: Procesy následující bezprostředně po transkripci.

Více

O původu života na Zemi Václav Pačes

O původu života na Zemi Václav Pačes O původu života na Zemi Václav Pačes Ústav molekulární genetiky Akademie věd ČR centrální dogma replikace transkripce DNA RNA protein reverzní transkripce translace informace funkce Exon 1 Intron (413

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

Genetická "oblast nejasnosti" u HCH: co to znamená? Genetický základ

Genetická oblast nejasnosti u HCH: co to znamená? Genetický základ Novinky ve výzkumu Huntingtonovy nemoci. Ve srozumitelném jazyce. Napsáno vědci. Určeno široké huntingtonské veřejnosti. Genetická "oblast nejasnosti" u HCH: co to znamená? Přechodní alely a alely s redukovanou

Více

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA

Více

Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) www.uhkt.cz/nrl/db Chromosomové změny Unique - Britská svépomocná skupina

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?

Více

SLEDOVÁNÍ VÝSKYTU GENOTOXICKÝCH LÁTEK V POVODÍ ŘEKY SVRATKY V SOUVISLOSTI S URANOVÝM PRŮMYSLEM

SLEDOVÁNÍ VÝSKYTU GENOTOXICKÝCH LÁTEK V POVODÍ ŘEKY SVRATKY V SOUVISLOSTI S URANOVÝM PRŮMYSLEM SLEDOVÁNÍ VÝSKYTU GENOTOXICKÝCH LÁTEK V POVODÍ ŘEKY SVRATKY V SOUVISLOSTI S URANOVÝM PRŮMYSLEM Jana Badurová, Hana Hudcová, Radoslava Funková, Helena Mojžíšková, Jana Svobodová Toxikologická rizika spojená

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů

Více

doc. RNDr. Milan Bartoš, Ph.D.

doc. RNDr. Milan Bartoš, Ph.D. doc. RNDr. Milan Bartoš, Ph.D. Konference Klonování a geneticky modifikované organismy Parlament České republiky, Poslanecká sněmovna 7. května 2015, Praha Výroba léků rekombinantních léčiv Výroba diagnostických

Více

Diagnostické metody v lékařské mikrobiologii

Diagnostické metody v lékařské mikrobiologii Diagnostické metody v lékařské mikrobiologii Výuková prezentace z: Lékařské mikrobiologie Jan Smíšek ÚLM 3. LF UK 2009 Princip identifikace Soubor znaků s rozdílnou diskriminační hodnotou Základní problémy

Více

Studie zdravotního stavu dětí

Studie zdravotního stavu dětí Studie zdravotního stavu dětí z Radvanic a Bartovic Miroslav Dostál Ústav experimentální mediciny AV ČR, v.v.i., Praha 1 Zdravotní stav dětí Cíl porovnat zdravotní stav dětí žijících v Radvanicích & Bartovicích

Více

Vaše cesta ke zdravému dítěti

Vaše cesta ke zdravému dítěti Vážení klienti, Vaše cesta ke zdravému dítěti Preimplantační genetická diagnostika Sanatorium REPROMEDA patří již téměř 15 let mezi přední česká i evropská centra reprodukční medicíny. Již od počátku své

Více

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura

Více

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela

Více

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza Iveta Valášková ivalskova@fnbrno.cz Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza nejčastěji se vyskytující autozomálně recesivní dědičná metabolická porucha v zakavkazské

Více

Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění

Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění Klin. Biochem. Metab., 14 (35), 2006, No. 2, p. 89 95. Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění Gojová L., Kozák L. Centrum molekulární biologie a genové terapie, Fakultní

Více

Speciace neboli vznik druhů. KBI/GENE Mgr. Zbyněk Houdek

Speciace neboli vznik druhů. KBI/GENE Mgr. Zbyněk Houdek Speciace neboli vznik druhů KBI/GENE Mgr. Zbyněk Houdek Co je to druh? Druh skupina org., které mají společné určité znaky. V klasické taxonomii se jedná pouze o fenotypové znaky. V evoluční g. je druh

Více

Absorpční spektroskopie při biologické analýze molekul

Absorpční spektroskopie při biologické analýze molekul Absorpční spektroskopie při biologické analýze molekul Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 8.11.2007 7 1 UV spektroskopie DNA a proteinů Všechny atomy absorbují v UV oblasti

Více

Co se o sobě dovídáme z naší genetické informace

Co se o sobě dovídáme z naší genetické informace Genomika a bioinformatika Co se o sobě dovídáme z naší genetické informace Jan Pačes, Mgr, Ph.D Ústav molekulární genetiky AVČR, CZECH FOBIA (Free and Open Bioinformatics Association) hpaces@img.cas.cz

Více

Genetika - slovníček pojmů

Genetika - slovníček pojmů Genetika - slovníček pojmů Autor: Antonín Šípek A Adenin 6-aminopurin; purinová báze, přítomná v DNA i RNA AIDS Acquired immunodeficiency syndrome - syndrom získané imunodeficience, způsobený virem HIV

Více

Jsme tak odlišní. Co nás spojuje..? Nukleové kyseliny

Jsme tak odlišní. Co nás spojuje..? Nukleové kyseliny Jsme tak odlišní Co nás spojuje..? ukleové kyseliny 1 UKLEVÉ KYSELIY = K anj = A ositelky genetických informací Základní význam pro všechny organismy V buňkách a virech Identifikace v buněčném jádře (nucleos)

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady

Více

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob PGD preimplantační genetická diagnostika zahrnuje soubor technik, které se používají pro zjištění

Více

Nukleové kyseliny (polynukleotidy) Nukleové kyseliny a nadmolekulové komplexy polynukleotidů buněčných struktur

Nukleové kyseliny (polynukleotidy) Nukleové kyseliny a nadmolekulové komplexy polynukleotidů buněčných struktur Nukleové kyseliny (polynukleotidy) Nukleové kyseliny a nadmolekulové komplexy polynukleotidů buněčných struktur Objevitelem je Friedrich Miescher (1887) NK stojí v hierarchii látek potřebných k existenci

Více

VY_32_INOVACE_003. VÝUKOVÝ MATERIÁL zpracovaný v rámci projektu EU peníze školám

VY_32_INOVACE_003. VÝUKOVÝ MATERIÁL zpracovaný v rámci projektu EU peníze školám VY_32_INOVACE_003 VÝUKOVÝ MATERIÁL zpracovaný v rámci projektu EU peníze školám Registrační číslo projektu: CZ. 1.07. /1. 5. 00 / 34. 0696 Šablona: III/2 Název: Základní znaky života Vyučovací předmět:

Více

Co se děje v genetické laboratoři?

Co se děje v genetické laboratoři? 12 Co se děje v genetické laboratoři? Tento letáček byl vytvořen s pomocí Dr Iana M Fraylinga, Institute of Medical Genetics, University Hospital of Wales, Cardiff, UK; Dr Domenica Coviella, Laboratory

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

analýza dat a interpretace výsledků

analýza dat a interpretace výsledků Genetická transformace bakterií III analýza dat a interpretace výsledků Předmět: Biologie ŠVP: Prokaryotní organismy, genetika Doporučený věk žáků: 16-18 let Doba trvání: 45 minut Specifické cíle: analyzovat

Více

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková Metody detekce a identifikace MO se zaměřením na PCR a její variace Kamila Zdeňková Metody detekce a identifikace MO rozdělení metod pro mikrobiologické zkoušení potravin přehled rychlých metod detekce

Více

V organismu se bílkoviny nedají nahradit žádnými jinými sloučeninami, jen jako zdroj energie je mohou nahradit sacharidy a lipidy.

V organismu se bílkoviny nedají nahradit žádnými jinými sloučeninami, jen jako zdroj energie je mohou nahradit sacharidy a lipidy. BÍLKOVINY Bílkoviny jsou biomakromolekulární látky, které se skládají z velkého počtu aminokyselinových zbytků. Vytvářejí látkový základ života všech organismů. V tkáních vyšších organismů a člověka je

Více

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013 Lékařská genetika a onkologie Renata Gaillyová OLG a LF MU Brno 2012/2013 *genetické souvislosti *onkogenetická vyšetření u onkologických onemocnění * genetické vyšetření u hereditárních nádorů *presymptomatické

Více

DEN OTEVŘENÝCH DVEŘÍ NA ÚMG

DEN OTEVŘENÝCH DVEŘÍ NA ÚMG DEN OTEVŘENÝCH DVEŘÍ NA ÚMG Místo konání: Datum a doba konání: Budova F, Vídeňská 1083, 142 20 Praha 4-Krč 31. 10. 2014 od 9:00 do 16:00 hod. Kontakt pro styk s veřejností: Organizační záležitosti: Leona

Více

MOLEKULÁRNÍ ZÁKLADY DĚDIČNOSTI

MOLEKULÁRNÍ ZÁKLADY DĚDIČNOSTI Maturitní téma č. 33 MOLEKULÁRNÍ ZÁKLADY DĚDIČNOSTI NUKLEOVÉ KYSELINY - jsou to makromolekuly tvořené řetězci vzájemně spojených nukleotidů. Molekula nukleotidu sestává z : - pětiuhlíkatého monosacharidu

Více

Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární

Více

+ F1 F2 + TRANSPLANTAČNÍ PRAVIDLA. Inbrední kmen A. Inbrední kmen B. Genotyp aa. Genotyp bb. Genotype ab. ab x ab. aa ab ab bb Genotypy

+ F1 F2 + TRANSPLANTAČNÍ PRAVIDLA. Inbrední kmen A. Inbrední kmen B. Genotyp aa. Genotyp bb. Genotype ab. ab x ab. aa ab ab bb Genotypy IMUNOGENETIKA II TRANSPLANTAČNÍ PRAVIDLA Inbrední kmen A Inbrední kmen B - F1 - e x F2 y y TRANSPLANTAČNÍ PRAVIDLA Inbrední kmen A Inbrední kmen B - F1 - e 3 4 x 3 4 F2 - - y y Transplantace orgánů,, které

Více

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD Shrnutí webináře Dystrofin 101: vše, co jste kdy chtěli vědět o dystrofinu (a nebáli jste se zeptat) Francesco Muntoni (University College of London), John Porter (PPMD) Dystrofinopatie: DMD versus BMD

Více

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením

Více

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dgmp) Koncept párování bazí je striktně konzervativní Cytosine

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci

Více

Posouzení citlivosti, specifity a přesnosti identifikace nefermentujících Gram-negativních tyčinek pomocí PCR-HRMA

Posouzení citlivosti, specifity a přesnosti identifikace nefermentujících Gram-negativních tyčinek pomocí PCR-HRMA Univerzita Palackého v Olomouci Přírodovědecká fakulta Katedra buněčné biologie a genetiky Posouzení citlivosti, specifity a přesnosti identifikace nefermentujících Gram-negativních tyčinek pomocí PCR-HRMA

Více

FLUORESCENČNÍ MIKROSKOP

FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po

Více

ŠKOLNÍ VZDĚLÁVACÍ PROGRAM DR. J. PEKAŘE V MLADÉ BOLESLAVI

ŠKOLNÍ VZDĚLÁVACÍ PROGRAM DR. J. PEKAŘE V MLADÉ BOLESLAVI školní vzdělávací program ŠKOLNÍ VZDĚLÁVACÍ PROGRAM DR. J. PEKAŘE V MLADÉ BOLESLAVI PLACE HERE ŠKOLNÍ VZDĚLÁVACÍ PROGRAM DR. J. PEKAŘE V MLADÉ BOLESLAVI Název školy Adresa Palackého 211, Mladá Boleslav

Více

Program na podporu zdravotnického aplikovaného výzkumu na léta 2015 2022

Program na podporu zdravotnického aplikovaného výzkumu na léta 2015 2022 Program na podporu zdravotnického aplikovaného výzkumu na léta 2015 2022 Ukončení příjmů projektů: 30. 6. 2015 Délka trvání řešení projektů: 45 měsíců Místo realizace: Celá ČR Oblast působení: Výzkum a

Více

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR Mikrobiologický ústav AV ČR Příloha 6 Havarijní plán 1/5 Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR a) Adresa pracoviště Mikrobiologický ústav AV ČR

Více

Biochemie Ch52 volitelný předmět pro 4. ročník

Biochemie Ch52 volitelný předmět pro 4. ročník Biochemie Ch52 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Chemie. Mezipředmětové přesahy a

Více

SEZNAM LABORATORNÍCH VYŠETŘENÍ

SEZNAM LABORATORNÍCH VYŠETŘENÍ Laboratoř morfologická SME 8/001/01/VERZE 01 SEZNAM LABORATORNÍCH VYŠETŘENÍ Cytologické vyšetření nátěru kostní dřeně Patologické změny krevního obrazu, klinická symptomatologie s možností hematologického

Více

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Využití houbových organismů v genovém inženýrství MIKROORGANISMY - bakterie, kvasinky a houby využíval

Více

Zkušenosti s diagnostikou sepse pomocí testu SeptiFast Test M GRADE. Zdeňka Doubková Klinická mikrobiologie a ATB centrum VFN Praha

Zkušenosti s diagnostikou sepse pomocí testu SeptiFast Test M GRADE. Zdeňka Doubková Klinická mikrobiologie a ATB centrum VFN Praha Zkušenosti s diagnostikou sepse pomocí testu SeptiFast Test M GRADE Zdeňka Doubková Klinická mikrobiologie a ATB centrum VFN Praha Definice: Sepse je definována jako syndrom systémové zánětlivé odpovědi

Více

2. PROTEINOVÉ TECHNIKY

2. PROTEINOVÉ TECHNIKY OBSAH 1. DNA TECHNIKY (P. Kotrba, Z. Knejzlík) 1 1.1 Polymerasová řetězová reakce - klonování DNA in vitro 1 1.2 Polymorfismus DNA a jeho analýza 3 1.3 VNTR sekvence, jejich význam v kriminalistice a diagnostice

Více

Genetika populací a. Gentika populací. Autogamická populace

Genetika populací a. Gentika populací. Autogamická populace Genetika populací a člověka Mgr. Aleš RUDA Gentika populací Populace = všichni jedinci téhož druhu, kteří obývají vdaném čase stejné území GENOFOND soubor alel v gametách všech členů populace GENETIKA

Více

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC 1 Výrobce Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC Tento návod k použití si důkladně přečtěte před použitím tohoto produktu. Uschovejte si tento návod k použití,

Více

Vakcíny z nádorových buněk

Vakcíny z nádorových buněk Protinádorové terapeutické vakcíny Vakcíny z nádorových buněk V. Vonka, ÚHKT, Praha Výhody vakcín z nádorových buněk 1.Nabízejí imunitnímu systému pacienta celé spektrum nádorových antigenů. 2. Jejich

Více

Buněčné kultury. Kontinuální kultury

Buněčné kultury. Kontinuální kultury Buněčné kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace

Více

Metodické listy OPVK. Molekulární metody hodnocení genotypů Marker Assisted Breeding 14.

Metodické listy OPVK. Molekulární metody hodnocení genotypů Marker Assisted Breeding 14. Metodické listy OPVK Molekulární metody hodnocení genotypů Marker Assisted Breeding 14. Molekulární metody hodnocení genotypů 14.1. Izolace DNA V aplikacích zaměřených na analýzu rostlinného genomu je

Více

Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření

Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření Laboratoř Metalomiky a Nanotechnologií Praktický kurz Monitorování hladiny metalothioneinu po působení iontů těžkých kovů Vyhodnocení měření Vyučující: Ing. et Ing. David Hynek, Ph.D., Prof. Ing. René

Více

5.3.4. Vzdělávací oblast: Člověk a příroda Vzdělávací obor (předmět): Přírodopis - ročník: TERCIE

5.3.4. Vzdělávací oblast: Člověk a příroda Vzdělávací obor (předmět): Přírodopis - ročník: TERCIE 5.3.4. Vzdělávací oblast: Člověk a příroda Vzdělávací obor (předmět): Přírodopis - ročník: TERCIE Téma Učivo Výstupy Kódy Dle RVP Školní (ročníkové) PT K Obratlovci kmen: Strunatci podkmen: Obratlovci

Více