Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Rozměr: px
Začít zobrazení ze stránky:

Download "Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha"

Transkript

1 Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh

2 Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem repets, SSR simple sequence repets TGCCTCGGTCCCCCCCCGTGCTTCGTGC TGCCTCGGTCCCCCCGTGCTTCGTGCGTG Pokud se detekovtelný polymorfismus nchází dosttečně blízko lokusu, ve kterém se vyskytuje kuzální mutce pro sledovnou chorobu, bude tento polymorfismus ve vzbě s mutovnou lelou ve většině přípdů bude součsně s ní předáván z rodičů n potomky (kosegregce) bude možné jej využít jko mrker i bez znlosti molekulární podstty dného onemocnění.

3 Úkol č. 2, str. 8 Polycystická chorob ledvin (D, p = 5cM) B C D ) Riziko postižení pro /3 i /4 je 50%.

4 Úkol č. 2, str. 8 Polycystická chorob ledvin (D, p = 5cM) B C D ) Riziko postižení pro /3 i /4 je 50%. b) Riziko postižení pro /3 je 95%. b) Riziko postižení pro /4 je 5%.

5 Nondisjunkce u Downov syndromu Tři rodokmeny rodin s dětmi postiženými Downovým syndromem (prostá trisomie). Výsledek nlýzy DN tetrnukleotidového polymorfismu n chromozómu 2 - je znázorněn pod rodokmeny. Od kterého z rodičů zdědilo dítě třetí kopii chromozómu 2? V kterém meiotickém dělení došlo k nondisjunkci?

6 Nondisjunkce u Downov syndromu? Meióz u otce nebo u mtky

7 Nondisjunkce u Downov syndromu? Meióz u otce nebo u mtky Meióz u mtky

8 Nondisjunkce u Downov syndromu? Meióz u otce nebo u mtky Meióz u mtky Meióz u mtky

9 Úkol č., str. 95, PKU Nemá PKU 2/3, /3 /2, /4, /4 Prentální dg. v té době nebyl možná. Riziko 25% umožňovlo rodičům požádt o ukončení těhotenství ze zdrvotních (genetických) důvodů. Screening po nrození dítěte by odhlil onemocnění, dietní optření by umožnil reltivně příznivý vývoj

10 Úkol č. 2, str. 95, PKU (incidence /0000) / /3 2/3 /2 /2 /50 x ½ x 2/3 x ½ = 2/600 = /300 q 2 = /0000 q = /00 2pq = 2 x 99/00 x /00 = /50 Riziko postižení nízké, zátěžové testy v přípdě PKU málo přesné, lze doporučit DN nlýzu. Je nutné mít dosttek čsu n provedení vyšetření DN v obou rodinách!! Jink není možné přistoupit k prentální dg.

11 Úkol č. 2b-, str. 95, PKU (incidence /0000) / /3 2/3 /2 /50 x ½ x = /00 q 2 = /0000 q = /00 2pq = 2 x 99/00 x /00 = /50

12 Úkol č. 2b-2, str. 95, PKU (incidence /0000) / /3 2/3 /2 /2 /50 x ½ x 2/3 x ½ = 2/600 = /300 q 2 = /0000 q = /00 2pq = 2 x 99/00 x /00 = /50

13 Úkol č. 3, str. 96, PKU ) NO, rodin je informtivní z hledisk genotypu dětí. b) ntrgenová sond, dcer tedy JE heterozygotní. c) ntrgenová sond, syn tedy JE dominntní homozygot. d) Jedná se o nepřímou dignostiku, NELZE využít mimo kontext dné rodiny. 5

14 Úkol č. 4, str. 96 Mutovná lel R408W R408W (Sty ) * 08 bp 37 bp Normální lel bp

15 Úkol č. 4, str ? / + + / + + / +

16 Úkol č. 5, str výsledky SSCP pro EXON č GENOTYP? 6mut / + +/ + 6mut / + 6mut / + 6mut / + Mutce v 6. exonu (6mut) +/ + +/ + + / + + / + + / + 9

17 Úkol č. 4c,d, str ? mut / + c) Bylo by lepší znát druhou mutci v rodině snoubenky, kterou musí mít /3 nejspíše i /3. Spojením s nepřímou dignostikou bychom mohli stnovit genotyp nenrozeného potomk snoubenců. Klinický genetik rozhodne, zd v této fázi prentální vyšetření nbídnout snoubencům. d) Pátrání po druhé mutci v rodině snoubenky (ETK - poučený souhls!)

18 Úkol č. 5, str výsledky SSCP pro EXON č GENOTYP? 6mut / + +/ + 6mut / + 6mut / + 6mut / + Mutce v 6. exonu (6mut) +/ + +/ + + / + + / + + / +

19 Úkol č. 5, str b) Biopsie trofoblstu (odběr týden grvidity), mniocyty po týdnu grvidity MOŽNÉ POSTUPY nepřímá DN nlýz (RFLP), po doplnění vyšetření v rodině snoubence, pokud bude informtivní přímá DN nlýz R408W, SSCP 6.exonu kombince obou předchozích bude-li v době grvidity určen 6mut přímá nlýz sekvenování Metodu volí specilist v lbortoři.

20 Úkol č. 5, str Poznámk: Dle součsných pltných právních etických norem: c) Odběr tkáně z účelem izolce vyšetření DN je vázán n poučený souhls pcient. U nezletilých o vyšetření rozhodují zákonní zástupci. d) Od okmžiku, kdy je známo, že snoubenci jsou heterozygotní, je možno n žádost ženy indikovt ukončení grvidity ze zdrvotních (genetických) příčin pro 25% (vysoké) riziko závžné vdy či choroby plodu. Teoreticky ž do 24. týdne grvidity.

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální

Více

Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi

Více

Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových

Více

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

http://www.vrozene-vady.cz

http://www.vrozene-vady.cz Prevence vrozených vad z pohledu genetika MUDr. Vladimír Gregor, RNDr. Jiří Horáček odd. lékařské genetiky, Fakultní Thomayerova nemocnice v Praze Genetické poradenství Klinická genetika se zabývá diagnostikou

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Poznámky k nutrigenetice

Poznámky k nutrigenetice Poznámky k nutrigenetice Ondřej Šeda Institut klinické a experimentální medicíny, Praha Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Research Centre CHUM, Montreal, Canada Nutrigenetika Jednotlivé

Více

Virtuální svět genetiky 1

Virtuální svět genetiky 1 Chromozomy obshují mnoho genů pokud nejsou rozděleny crossing-overem, pk lely přítomné n mnoh lokusech kždého homologního chromozomu segregují jko jednotk během gmetogeneze. Rekombinntní gmety jsou důsledkem

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

Co to je genetický test?

Co to je genetický test? 12 Co to je genetický test? Vytvořeno podle informačních letáků vypracovaných nemocnicemi Guy's a St. Thomas' Hospital, Londýn. Tato práce byla podpořena projektem Eurogentest v rámci Evropského 6. RP;

Více

NUMERICKÉ ABERACE ÚBLG 1.LF UK

NUMERICKÉ ABERACE ÚBLG 1.LF UK NUMERICKÉ ABERACE ÚBLG 1.LF UK CHROMOSOMÁLN LNÍ ABERACE NUMERICKÉ ANEUPLOIDIE POLYPLOIDIE MONOSOMIE TRISOMIE TRIPLOIDIE TETRAPLOIDIE STRUKTURÁLN LNÍ MIXOPLOIDIE MOZAICISMUS CHIMÉRISMUS ZÁKLADNÍ SYNDROMY

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Downův syndrom. Renata Gaillyová OLG FN Brno

Downův syndrom. Renata Gaillyová OLG FN Brno Downův syndrom Renata Gaillyová OLG FN Brno Zastoupení genetických chorob a vývojových vad podle etiologie 0,6 %-0,7% populace má vrozenou chromosomovou aberaci incidence vážných monogenně podmíněných

Více

Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická

Více

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka

Více

Prenatální diagnostika v roce 2008 předběžné výsledky

Prenatální diagnostika v roce 2008 předběžné výsledky Prenatální diagnostika v roce 28 předběžné výsledky V. Gregor 1, A. Šípek 1, 2 1 Oddělení lékařské genetiky, Fakultní Thomayerova nemocnice, Praha 2 3.Lékařská fakulta Univerzity Karlovy, Praha Pracovní

Více

Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární

Více

Prenatální diagnostika Downova syndromu v ČR. Jsou rozdíly podle věku těhotné?

Prenatální diagnostika Downova syndromu v ČR. Jsou rozdíly podle věku těhotné? Prenatální diagnostika Downova syndromu v ČR. Jsou rozdíly podle věku těhotné? Antonín Šípek*, Vladimír Gregor*, Antonín Šípek jr.**, Ondřej Vencálek*** *Oddělení lékařské genetiky, Thomayerova nemocnice,

Více

Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie

Více

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou

Více

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH RÁMCOVÝ VZDĚLÁVACÍ PROGRAM PRO ZÍSKÁNÍ SPECIALIZOVANÉ ZPŮSOBILOSTI v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH 1. Cíl specializačního vzdělávání Cílem specializačního vzdělávání

Více

Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) www.uhkt.cz/nrl/db Chromosomové změny Unique - Britská svépomocná skupina

Více

Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár

Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár schopen spontánní koncepce, ale žena není schopna donosit

Více

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010 Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem Milan Bartoš Forum veterinarium, Brno 2010 Vývoj farmakogenetické diagnostické soupravy pro stanovení genetických polymorfismů

Více

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.

Více

Smlouva o příspěvku na provoz školy (dále jen smlouva)

Smlouva o příspěvku na provoz školy (dále jen smlouva) v zstoupení : Ing. Hn Novotná, ředitelk jko strn oprávněná (dále jen oprávněná strn) I.2. studentk student denního studi oboru 23-45-L/005 Mechnik číslicově řízených strojů studentkou - studentem. v zstoupení

Více

21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST

21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka

Více

Chromosomové translokace

Chromosomové translokace 12 Unique - Britská svépomocná skupina pro vzácné chromosomové vady. Tel: + 44 (0) 1883 330766 Email: info@rarechromo.org www.rarechromo Chromosomové translokace EuroGentest - Volně přístupné webové stránky

Více

Vrozené chromozomové aberace v České republice v období 1994 2013

Vrozené chromozomové aberace v České republice v období 1994 2013 Vrozené chromozomové aberace v České republice v období 1994 213 Vladimír Gregor 1,2.3, Antonín Šípek 1,2,4, Antonín Šípek jr. 1,5, Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské

Více

Vrozené chromozomové aberace v České republice v období 1994 2013

Vrozené chromozomové aberace v České republice v období 1994 2013 Vrozené chromozomové aberace v České republice v období 1994 213 Vladimír Gregor 1,2.3, Antonín Šípek 1,2,4, Antonín Šípek jr. 1,5, Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské

Více

ý č Í É Ě Í š Č č ý Ú ť š č ú š ý š ď č č ý Š Š č č Á ý ť ť Í ý ť č Ť É Ě Í š Č Č Ý ť Í ý ý č Ý É Ě Í č š ý ň č ý Í ď Í ú Ě Í č É Ě Í š č č Í ý ý úč č É Ě Í ý č ň š č ý ď ť ť ž ý č č É š Ě Í č š Ě š čď

Více

Včasná diagnostika (2014 2015)

Včasná diagnostika (2014 2015) Včasná diagnostika (2014 2015) 1 Projekt Včasná diagnostika 2 Projekt vzdělávání studentů Včasná diagnostika (2014 2015) V rámci plnění NAP RD, aktivita č. 4 (Zlepšení screeningu a diagnostiky u VO) ČAVO

Více

Neinvazivní test nejčastějších chromosomálních vad plodu z volné DNA

Neinvazivní test nejčastějších chromosomálních vad plodu z volné DNA PRENATÁLN Í TEST PANORA M A TM Neinvazivní test nejčastějších chromosomálních vad plodu z volné DNA Panorama TM test TM test je vyšetření je vyšetření DNA, DNA, které které Vám Vám poskytne poskytne důležité

Více

PRENATÁLNÍ DIAGNOSTIKA VROZENÝCH VAD V ČESKÉ REPUBLICE AKTUÁLNÍ DATA

PRENATÁLNÍ DIAGNOSTIKA VROZENÝCH VAD V ČESKÉ REPUBLICE AKTUÁLNÍ DATA PRENATÁLNÍ DIAGNOSTIKA VROZENÝCH VAD V ČESKÉ REPUBLICE AKTUÁLNÍ DATA Vladimír Gregor 1,2, 3, Antonín Šípek 1,2,4 Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské genetiky, Sanatorium

Více

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické

Více

KBI/GENE Mgr. Zbyněk Houdek

KBI/GENE Mgr. Zbyněk Houdek Genealogie KBI/GENE Mgr. Zbyněk Houdek Rodokmenové schéma Shromáždění informací o rodině je 1. důležitým krokem v genetickém poradenství. Rodokmenové schéma musí být srozumitelné a jednoznačné. Poskytuje

Více

Smlouva o příspěvku na provoz školy (dále jen smlouva)

Smlouva o příspěvku na provoz školy (dále jen smlouva) bnk. spojení : KB,.s. Brno-město, exp. Kuřim, č.ú. 201203621/0100 v zstoupení : Ing. Hn Novotná, ředitelk jko strn oprávněná I.2. studentk student denního studi oboru 26-41-L/01 Mechnik elektrotechnik

Více

JEDINEČNÁ INFORMACE. Jediný prenatální krevní test, který analyzuje všechny chromozomy vašeho miminka

JEDINEČNÁ INFORMACE. Jediný prenatální krevní test, který analyzuje všechny chromozomy vašeho miminka JEDINEČNÁ INFORMACE Jediný prenatální krevní test, který analyzuje všechny chromozomy vašeho miminka MaterniT GENOME test nabízí více informací o chromozomech vašeho miminka než kterýkoliv jiný prenatální

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Proč se někdy dělá biopsie choria a jindy amniocentéza?

Proč se někdy dělá biopsie choria a jindy amniocentéza? K čemu slouží biopsie choria? Prenatálně diagnostický test, který detekuje chromozomální abnormlity u plodu. K vyšetření se používají klky, které tvoří tzv. chorion. Z choria se postupem času vytvoří placenta.

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u

Více

Časná ultrazvuková diagnostika rozštěpových vad obličeje u plodu

Časná ultrazvuková diagnostika rozštěpových vad obličeje u plodu Časná ultrazvuková diagnostika rozštěpových vad obličeje u plodu MUDr. Vlašín P., MUDr. Pavková Š., Centrum prenatální diagnostiky Brno, Veveří 39, 60200, Brno www.prenatal.cz cpd@prenatal.cz Vyšetření

Více

Zhoubný novotvar ledviny mimo pánvičku v ČR

Zhoubný novotvar ledviny mimo pánvičku v ČR Aktuální informce Ústvu zdrvotnických informcí sttistiky České repuliky Prh 8.1.2004 1 Zhouný novotvr ledviny mimo pánvičku v ČR Počet hlášených onemocnění zhouným novotvrem ledviny mimo pánvičku (dg.

Více

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika 1/6 3.2.11.18 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost

Více

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto

Více

KONTROLA KVALITY VAZBA HLA S CHOROBAMI

KONTROLA KVALITY VAZBA HLA S CHOROBAMI KONTROLA KVALITY VAZBA HLA S CHOROBAMI VÝSLEDKY 1. KOLA 2016 Eva Ratajová, Milena Vraná Oddělení HLA, Národní referenční laboratoř pro DNA diagnostiku, ÚHKT, Praha WWW.UHKT.CZ NABÍZENÉ VARIANTY VARIANTA

Více

Informovaný souhlas s neinvazivním prenatálním testem aneuploidií chromozomů 13, 18 a 21 testem CLARIGO TM

Informovaný souhlas s neinvazivním prenatálním testem aneuploidií chromozomů 13, 18 a 21 testem CLARIGO TM Informovaný souhlas s neinvazivním prenatálním testem aneuploidií chromozomů 13, 18 a 21 testem CLARIGO TM Jméno a příjmení vyšetřovaného:. číslo pojištěnce:. 1. Popis účelu odběru vzorků a genetického

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta

MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Určování a ověřování paternity u koní. Bakalářská práce Brno 2006 Vedoucí bakalářské

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele

http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár

Více

Vrozené chromosomové aberace v ČR v období 1993-2012

Vrozené chromosomové aberace v ČR v období 1993-2012 Vrozené chromosomové aberace v ČR v období 1993-212 Vladimír Gregor 1,2, 3, Antonín Šípek 1,2,4 Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské genetiky, Sanatorium PRONATAL,

Více

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor Moto: Nejvyšším štěstím každé rodiny je zdravé dítě Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor ČLK, 14. února 2013 Úvod Od poznání možností, které nám nabízí prenatální diagnostika, se embryo či později

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Výzva k podání nabídky a k prokázání kvalifikace pro VZ malého rozsahu

Výzva k podání nabídky a k prokázání kvalifikace pro VZ malého rozsahu Výzv k podání nbídky k prokázání kvlifikce pro VZ mlého rozshu Název veřejné zkázky: Servisní podpor NN zřízení LNS Brno Identifikce zdvtele: Zdvtel: Řízení letového provozu České republiky, s.p. Se sídlem:

Více

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE

GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE GENETIKA A MOLEKULÁRNĚ GENETICKÁ DIAGNOSTIKA DUCHENNEOVY MUSKULÁRNÍ DYSTROFIE POHLED Z LABORATOŘE Petra Hedvičákov ková ÚBLG FN Motol Odd. lékal kařské molekulárn rní genetiky MZO 00064203 23.-24.5.2008

Více

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto

Více

Věstník MINISTERSTVA ZDRAVOTNICTVÍ ČESKÉ REPUBLIKY OBSAH: 1. Oznámení o termínu konání zkoušky o odborné způsobilosti k výkonu odborného

Věstník MINISTERSTVA ZDRAVOTNICTVÍ ČESKÉ REPUBLIKY OBSAH: 1. Oznámení o termínu konání zkoušky o odborné způsobilosti k výkonu odborného Věstník Ročník 2009 MINISTERSTVA ZDRAVOTNICTVÍ ČESKÉ REPUBLIKY Částk 3 Vydáno: 20. KVĚTNA 2009 Cen: 101 Kč OBSAH: 1. Oznámení o termínu konání zkoušky o odborné způsobilosti k výkonu odborného dohledu

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

SMLOUVU O UZAVŘENÍ BUDOUCÍ SMLOUVY KUPNÍ

SMLOUVU O UZAVŘENÍ BUDOUCÍ SMLOUVY KUPNÍ Níže uvedeného dne, měsíce roku uzvřeli: 1. Eret Tomáš, r.č. 711107/1814 bytem: nám. Krále Jiřího z Poděbrd 1/14, 350 02 Cheb 2 jko budoucí prodávjící n strně jedné 2. mnželé xxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxx

Více

Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska

Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska A. Šípek jr. (1), R. Mihalová (1), A. Panczak (1), L. Hrčková (1), P. Lonský (2), M. Janashia (1), M. Kohoutová

Více

Ó Á Ň Í Ž Č Í Ž ň Ž Ž ú Ž Ž Á Ž Í ú ú ú Í Í ť ť ď Í Í ú Í ď Ž Ř Í ň ď Č Í Č Č ď ď Ž Č ď Ž Ž ď Í Ž ú ď Ó ď ú Í Í ď ď ď ď ň Žď ú ú ť ď ď ď Ž Ž Á ď Ž Í Ž Ž Ž ď Ž Č Ž Ž ú Ž Í ú ň Ž ú ď ň ď Č Č ď ú Č ť Ó Í

Více

ů ů Č ů ů Š ž ů žď ž ž ž žď ů ů ž ů ó Č Ý Š ú Ý Á Š ž ů ž ž ž ů Š ú Ž ů ú ž Ř ó ž ú ž ň ž Á Š ň ď ž ú Ý ť Č Ř ň Š Á Š ž Š Š ž ú Ý ť Ř žď Š ž Á ž Š ů ť ť ů ú Ý Č Ř Ň ť Á ž Š ú Ý ž ž ó ž Ř žď Ň ž ž ň Ť ó

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,

Více

Zeptejte se svého lékaře

Zeptejte se svého lékaře Jednoduchý a bezpečný krevní test, který nabízí vysokou citlivost stanovení Neinvazivní test, který vyhodnocuje riziko onemocnění chromozomálního původu, jako je např. Downův syndrom, a nabízí také možnost

Více

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace Mutace Klasifikace mutací Z hlediska lokalizace mutací v genotypu Genové mutace Chromozomální mutace Genomové mutace Vznik genových mutací Tranzice pyrim. za pyrim. C na T T na C purin za purin A na G

Více

Screening VVV v ČR v roce 2011

Screening VVV v ČR v roce 2011 Screening VVV v ČR v roce 2011 D. Springer, T. Zima ÚLBLD VFN a 1. LF UK Praha XXXIII.IAD Ústí nad Labem 1.- 3.4.2012 Cíl péče o těhotnou Nekomplikovaný porod zdravého dítěte zdravé matce ve správný čas

Více

úč úč ž ů ž Č Č č č ů ž úč č úč ť Ň č ú Ý č č Ú Ú ť ú č ď ů ž š úč ž úč úč ž ť ď ť ď ž ú č č úč š ž Ů č č ú úč ž ů ť úč ž ž ž Ů č ž ú č Š úč č Úč Č Č š ď š Š š Ó Ó ž ůč ú Ď ť ž ů ů č ů Č ů ž úč Ý č ž úč

Více

č ů š ň č č Ú č č č Ú ů Ú č ž ú š š ý č ú ó ó ž č ý ý ý č ž č ý ž ý č ý ž ž č ý ý ý ž ý ý ý ý š ý š ů ů č č ý ž č ý ů š ž ý Ú Ú úč š ů ž ů ů Úč ž č ý č š ý ů č š ý ý ý ů č č ž ů š ů ů š ý ý ů ů č č ž ú

Více

Á Ě Í Ě Á Á ó č ž č ž č Í š úč é úč š ž č é ů č é č é é ů č ů č č ů é Ž š ů ů š č é Ž č é Ž č Í ž Ž Ž é é Ů é Ř ů ť š é é č é é é š č č é č č č č š č š é č é č ů č č š ú é č é š é Ž Ž é é ú č č é ů č š

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

uzavírají ve smyslu ust. 1746 odst. 2 zákona č. 89/2012 Sb., občanský zákoník tuto DOHODU O JISTOTNÍM ÚČTU,

uzavírají ve smyslu ust. 1746 odst. 2 zákona č. 89/2012 Sb., občanský zákoník tuto DOHODU O JISTOTNÍM ÚČTU, Reg. č. UniCredit Bnk Czech Republic nd Slovki,.s. sídlem Prh 4 Michle, Želetvská 1525/1, PSČ 140 92, IČ 64948242, zpsná v obchodním rejstříku vedeném Městským soudem v Prze, oddíl B, vložk 3608, zstoupená

Více

Příčiny a projevy abnormálního vývoje

Příčiny a projevy abnormálního vývoje Příčiny a projevy abnormálního vývoje Ústav histologie a embryologie 1. LF UK v Praze MUDr. Filip Wagner Předmět: Obecná histologie a obecná embryologie (B02241) 1 Vrozené vývojové vady vývojové poruchy

Více

34. celostátní konference gynekologů zabývajících se ultrazvukovou diagnostikou s mezinárodní účastí, 19.9-21.9.2013, Špindlerův Mlýn

34. celostátní konference gynekologů zabývajících se ultrazvukovou diagnostikou s mezinárodní účastí, 19.9-21.9.2013, Špindlerův Mlýn Vrozené chromosomové aberace v ČR v období 1993 - Vladimír Gregor 1,2, 3, Antonín Šípek 1,2,4 Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské genetiky, Sanatorium PRONATAL,

Více

Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice

Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice Účinnost k 1. 12. 2014 Doporučený postup č. 3 Genetické laboratorní vyšetření v reprodukční genetice Stav změn: 1. vydání Základním předpokladem genetického laboratorního vyšetření v reprodukční genetice

Více

Laboratorní vyšetření v těhotenství- screening vrozených vývojových vad RNDr. I. Klabenešová OKB FN BRNO Metodika screeningu Lékařský screening slouží k vyhledávání osob s významným rizikem výskytu určité

Více

Trombofilie v těhotenství

Trombofilie v těhotenství v těhotenství Doc. MUDr. Antonín Pařízek, CSc. 24. dubna 2013, Praha Gynekologicko - porodnická klinika 1. LF UK a VFN v Praze = zvýšená dispozice pro trombózu (TEN) Na jejím vzniku se podílí vlivy: 1.

Více

Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Biologie. Mezipředmětové

Více

1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,

Více

VÝSLEDKY, KTERÝM MŮŽETE DŮVĚŘOVAT

VÝSLEDKY, KTERÝM MŮŽETE DŮVĚŘOVAT VÝSLEDKY, KTERÝM MŮŽETE DŮVĚŘOVAT Neinvazivní prenatální test detekuje: Aneuploidie Mikrodeleční syndromy Pohlaví plodu Trisomie 3,8,2 Trisomie pohlavních chromosomů (XXX,XXY, XYY) Monosomie X ( Turnerův

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Vladana Skutilová, OLG FN Hradec Králové

Vladana Skutilová, OLG FN Hradec Králové Vladana Skutilová, OLG FN Hradec Králové Proč KBT v genetickém poradenství? skloubení medicínského a psychoterapeutického pohledu těhotenství obecně radostná doba, ve skutečnosti řada vyšetření přinášejících

Více

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více