Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha"

Transkript

1 Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh

2 Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem repets, SSR simple sequence repets TGCCTCGGTCCCCCCCCGTGCTTCGTGC TGCCTCGGTCCCCCCGTGCTTCGTGCGTG Pokud se detekovtelný polymorfismus nchází dosttečně blízko lokusu, ve kterém se vyskytuje kuzální mutce pro sledovnou chorobu, bude tento polymorfismus ve vzbě s mutovnou lelou ve většině přípdů bude součsně s ní předáván z rodičů n potomky (kosegregce) bude možné jej využít jko mrker i bez znlosti molekulární podstty dného onemocnění.

3 Úkol č. 2, str. 8 Polycystická chorob ledvin (D, p = 5cM) B C D ) Riziko postižení pro /3 i /4 je 50%.

4 Úkol č. 2, str. 8 Polycystická chorob ledvin (D, p = 5cM) B C D ) Riziko postižení pro /3 i /4 je 50%. b) Riziko postižení pro /3 je 95%. b) Riziko postižení pro /4 je 5%.

5 Nondisjunkce u Downov syndromu Tři rodokmeny rodin s dětmi postiženými Downovým syndromem (prostá trisomie). Výsledek nlýzy DN tetrnukleotidového polymorfismu n chromozómu 2 - je znázorněn pod rodokmeny. Od kterého z rodičů zdědilo dítě třetí kopii chromozómu 2? V kterém meiotickém dělení došlo k nondisjunkci?

6 Nondisjunkce u Downov syndromu? Meióz u otce nebo u mtky

7 Nondisjunkce u Downov syndromu? Meióz u otce nebo u mtky Meióz u mtky

8 Nondisjunkce u Downov syndromu? Meióz u otce nebo u mtky Meióz u mtky Meióz u mtky

9 Úkol č., str. 95, PKU Nemá PKU 2/3, /3 /2, /4, /4 Prentální dg. v té době nebyl možná. Riziko 25% umožňovlo rodičům požádt o ukončení těhotenství ze zdrvotních (genetických) důvodů. Screening po nrození dítěte by odhlil onemocnění, dietní optření by umožnil reltivně příznivý vývoj

10 Úkol č. 2, str. 95, PKU (incidence /0000) / /3 2/3 /2 /2 /50 x ½ x 2/3 x ½ = 2/600 = /300 q 2 = /0000 q = /00 2pq = 2 x 99/00 x /00 = /50 Riziko postižení nízké, zátěžové testy v přípdě PKU málo přesné, lze doporučit DN nlýzu. Je nutné mít dosttek čsu n provedení vyšetření DN v obou rodinách!! Jink není možné přistoupit k prentální dg.

11 Úkol č. 2b-, str. 95, PKU (incidence /0000) / /3 2/3 /2 /50 x ½ x = /00 q 2 = /0000 q = /00 2pq = 2 x 99/00 x /00 = /50

12 Úkol č. 2b-2, str. 95, PKU (incidence /0000) / /3 2/3 /2 /2 /50 x ½ x 2/3 x ½ = 2/600 = /300 q 2 = /0000 q = /00 2pq = 2 x 99/00 x /00 = /50

13 Úkol č. 3, str. 96, PKU ) NO, rodin je informtivní z hledisk genotypu dětí. b) ntrgenová sond, dcer tedy JE heterozygotní. c) ntrgenová sond, syn tedy JE dominntní homozygot. d) Jedná se o nepřímou dignostiku, NELZE využít mimo kontext dné rodiny. 5

14 Úkol č. 4, str. 96 Mutovná lel R408W R408W (Sty ) * 08 bp 37 bp Normální lel bp

15 Úkol č. 4, str ? / + + / + + / +

16 Úkol č. 5, str výsledky SSCP pro EXON č GENOTYP? 6mut / + +/ + 6mut / + 6mut / + 6mut / + Mutce v 6. exonu (6mut) +/ + +/ + + / + + / + + / + 9

17 Úkol č. 4c,d, str ? mut / + c) Bylo by lepší znát druhou mutci v rodině snoubenky, kterou musí mít /3 nejspíše i /3. Spojením s nepřímou dignostikou bychom mohli stnovit genotyp nenrozeného potomk snoubenců. Klinický genetik rozhodne, zd v této fázi prentální vyšetření nbídnout snoubencům. d) Pátrání po druhé mutci v rodině snoubenky (ETK - poučený souhls!)

18 Úkol č. 5, str výsledky SSCP pro EXON č GENOTYP? 6mut / + +/ + 6mut / + 6mut / + 6mut / + Mutce v 6. exonu (6mut) +/ + +/ + + / + + / + + / +

19 Úkol č. 5, str b) Biopsie trofoblstu (odběr týden grvidity), mniocyty po týdnu grvidity MOŽNÉ POSTUPY nepřímá DN nlýz (RFLP), po doplnění vyšetření v rodině snoubence, pokud bude informtivní přímá DN nlýz R408W, SSCP 6.exonu kombince obou předchozích bude-li v době grvidity určen 6mut přímá nlýz sekvenování Metodu volí specilist v lbortoři.

20 Úkol č. 5, str Poznámk: Dle součsných pltných právních etických norem: c) Odběr tkáně z účelem izolce vyšetření DN je vázán n poučený souhls pcient. U nezletilých o vyšetření rozhodují zákonní zástupci. d) Od okmžiku, kdy je známo, že snoubenci jsou heterozygotní, je možno n žádost ženy indikovt ukončení grvidity ze zdrvotních (genetických) příčin pro 25% (vysoké) riziko závžné vdy či choroby plodu. Teoreticky ž do 24. týdne grvidity.

Virtuální svět genetiky 1

Virtuální svět genetiky 1 Chromozomy obshují mnoho genů pokud nejsou rozděleny crossing-overem, pk lely přítomné n mnoh lokusech kždého homologního chromozomu segregují jko jednotk během gmetogeneze. Rekombinntní gmety jsou důsledkem

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

NUMERICKÉ ABERACE ÚBLG 1.LF UK

NUMERICKÉ ABERACE ÚBLG 1.LF UK NUMERICKÉ ABERACE ÚBLG 1.LF UK CHROMOSOMÁLN LNÍ ABERACE NUMERICKÉ ANEUPLOIDIE POLYPLOIDIE MONOSOMIE TRISOMIE TRIPLOIDIE TETRAPLOIDIE STRUKTURÁLN LNÍ MIXOPLOIDIE MOZAICISMUS CHIMÉRISMUS ZÁKLADNÍ SYNDROMY

Více

Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární

Více

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.

Více

Vrozené chromozomové aberace v České republice v období 1994 2013

Vrozené chromozomové aberace v České republice v období 1994 2013 Vrozené chromozomové aberace v České republice v období 1994 213 Vladimír Gregor 1,2.3, Antonín Šípek 1,2,4, Antonín Šípek jr. 1,5, Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské

Více

Vrozené chromozomové aberace v České republice v období 1994 2013

Vrozené chromozomové aberace v České republice v období 1994 2013 Vrozené chromozomové aberace v České republice v období 1994 213 Vladimír Gregor 1,2.3, Antonín Šípek 1,2,4, Antonín Šípek jr. 1,5, Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské

Více

Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) www.uhkt.cz/nrl/db Chromosomové změny Unique - Britská svépomocná skupina

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Zhoubný novotvar ledviny mimo pánvičku v ČR

Zhoubný novotvar ledviny mimo pánvičku v ČR Aktuální informce Ústvu zdrvotnických informcí sttistiky České repuliky Prh 8.1.2004 1 Zhouný novotvr ledviny mimo pánvičku v ČR Počet hlášených onemocnění zhouným novotvrem ledviny mimo pánvičku (dg.

Více

Smlouva o příspěvku na provoz školy (dále jen smlouva)

Smlouva o příspěvku na provoz školy (dále jen smlouva) v zstoupení : Ing. Hn Novotná, ředitelk jko strn oprávněná (dále jen oprávněná strn) I.2. studentk student denního studi oboru 23-45-L/005 Mechnik číslicově řízených strojů studentkou - studentem. v zstoupení

Více

Smlouva o příspěvku na provoz školy (dále jen smlouva)

Smlouva o příspěvku na provoz školy (dále jen smlouva) bnk. spojení : KB,.s. Brno-město, exp. Kuřim, č.ú. 201203621/0100 v zstoupení : Ing. Hn Novotná, ředitelk jko strn oprávněná I.2. studentk student denního studi oboru 26-41-L/01 Mechnik elektrotechnik

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

Věstník MINISTERSTVA ZDRAVOTNICTVÍ ČESKÉ REPUBLIKY OBSAH: 1. Oznámení o termínu konání zkoušky o odborné způsobilosti k výkonu odborného

Věstník MINISTERSTVA ZDRAVOTNICTVÍ ČESKÉ REPUBLIKY OBSAH: 1. Oznámení o termínu konání zkoušky o odborné způsobilosti k výkonu odborného Věstník Ročník 2009 MINISTERSTVA ZDRAVOTNICTVÍ ČESKÉ REPUBLIKY Částk 3 Vydáno: 20. KVĚTNA 2009 Cen: 101 Kč OBSAH: 1. Oznámení o termínu konání zkoušky o odborné způsobilosti k výkonu odborného dohledu

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska

Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska A. Šípek jr. (1), R. Mihalová (1), A. Panczak (1), L. Hrčková (1), P. Lonský (2), M. Janashia (1), M. Kohoutová

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor Moto: Nejvyšším štěstím každé rodiny je zdravé dítě Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor ČLK, 14. února 2013 Úvod Od poznání možností, které nám nabízí prenatální diagnostika, se embryo či později

Více

Podmínky externí spolupráce

Podmínky externí spolupráce Podmínky externí spolupráce mezi tlumočnicko překldtelskou genturou Grbmüller Jzykový servis předstvující sdružení dvou fyzických osob podniktelů: Mrek Grbmüller, IČO: 14901820, DIČ: CZ6512231154, místo

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

úč úč ž ů ž Č Č č č ů ž úč č úč ť Ň č ú Ý č č Ú Ú ť ú č ď ů ž š úč ž úč úč ž ť ď ť ď ž ú č č úč š ž Ů č č ú úč ž ů ť úč ž ž ž Ů č ž ú č Š úč č Úč Č Č š ď š Š š Ó Ó ž ůč ú Ď ť ž ů ů č ů Č ů ž úč Ý č ž úč

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Vladana Skutilová, OLG FN Hradec Králové

Vladana Skutilová, OLG FN Hradec Králové Vladana Skutilová, OLG FN Hradec Králové Proč KBT v genetickém poradenství? skloubení medicínského a psychoterapeutického pohledu těhotenství obecně radostná doba, ve skutečnosti řada vyšetření přinášejících

Více

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

Zeptejte se svého lékaře

Zeptejte se svého lékaře Jednoduchý a bezpečný krevní test, který nabízí vysokou citlivost stanovení Neinvazivní test, který vyhodnocuje riziko onemocnění chromozomálního původu, jako je např. Downův syndrom, a nabízí také možnost

Více

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D.

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D. GENETICKÉ PORADENSTVÍ u pacientů s epidermolysis bullosa congenita MUDr. Renata Gaillyová, Ph.D. Homozygot jedinec, který zdědil po rodičích tutéž alelu. Jedinec nebo genotyp s identickými alelami v daném

Více

Příčiny a projevy abnormálního vývoje

Příčiny a projevy abnormálního vývoje Příčiny a projevy abnormálního vývoje Ústav histologie a embryologie 1. LF UK v Praze MUDr. Filip Wagner Předmět: Obecná histologie a obecná embryologie (B02241) 1 Vrozené vývojové vady vývojové poruchy

Více

Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený

Více

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci

Více

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013 Lékařská genetika a onkologie Renata Gaillyová OLG a LF MU Brno 2012/2013 *genetické souvislosti *onkogenetická vyšetření u onkologických onemocnění * genetické vyšetření u hereditárních nádorů *presymptomatické

Více

NAŘÍZENÍ KOMISE V PŘENESENÉ PRAVOMOCI (EU) č. /.. ze dne 30.4.2013,

NAŘÍZENÍ KOMISE V PŘENESENÉ PRAVOMOCI (EU) č. /.. ze dne 30.4.2013, EVROPSKÁ KOMISE V Bruselu dne 30.4.2013 C(2013) 2420 finl NAŘÍZENÍ KOMISE V PŘENESENÉ PRAVOMOCI (EU) č. /.. ze dne 30.4.2013, kterým se mění nřízení (ES) č. 809/2004, pokud jde o poždvky n zveřejňování

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Příloha č. 2a k rozhodnutí o změně registrace sp.zn. sukls184943/2010 a příloha k sp.zn.sukls44956/2010

Příloha č. 2a k rozhodnutí o změně registrace sp.zn. sukls184943/2010 a příloha k sp.zn.sukls44956/2010 Příloh č. 2 k rozhodnutí o změně registrce sp.zn. sukls184943/2010 příloh k sp.zn.sukls44956/2010 SOUHRN ÚDAJŮ O PŘÍPRAVKU 1. NÁZEV PŘÍPRAVKU Biclutmide Bluefish 50 mg pothovné tblety 2. KVALITATIVNÍ A

Více

APLIKACE METODY RIPRAN V SOFTWAROVÉM INŽENÝRSTVÍ

APLIKACE METODY RIPRAN V SOFTWAROVÉM INŽENÝRSTVÍ APLIKACE METODY RIPRAN V SOFTWAROVÉM INŽENÝRSTVÍ Brnislv Lcko VUT v Brně, Fkult strojního inženýrství, Ústv utomtizce informtiky, Technická 2, 616 69 Brno, lcko@ui.fme.vutbr.cz Abstrkt Příspěvek podává

Více

Genetická "oblast nejasnosti" u HCH: co to znamená? Genetický základ

Genetická oblast nejasnosti u HCH: co to znamená? Genetický základ Novinky ve výzkumu Huntingtonovy nemoci. Ve srozumitelném jazyce. Napsáno vědci. Určeno široké huntingtonské veřejnosti. Genetická "oblast nejasnosti" u HCH: co to znamená? Přechodní alely a alely s redukovanou

Více

Genetika člověka. Základním cílem genetiky člověka je studium genetické variability, kterou lze rozdělit na patologickou a nepatologickou.

Genetika člověka. Základním cílem genetiky člověka je studium genetické variability, kterou lze rozdělit na patologickou a nepatologickou. Genetika člověka Jednou z možností členění genetiky je její třídění podle druhu studovaných organismů (genetika virů, bakterií, rostlin, zvířat, člověka atd.). Genetiku člověka jsme se rozhodli zařadit

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

PÍSEMNÁ ZPRÁVA ZADAVATELE. "Poradenství a vzdělávání při zavádění moderních metod řízení pro. Město Klimkovice

PÍSEMNÁ ZPRÁVA ZADAVATELE. Poradenství a vzdělávání při zavádění moderních metod řízení pro. Město Klimkovice PÍSEMNÁ ZPRÁVA ZADAVATELE pro zjednodušené podlimitní řízení n služby v rámci projektu Hospodárné odpovědné město Klimkovice, reg. č. CZ.1.04/4.1.01/89.00121, který bude finncován ze zdrojů EU "Pordenství

Více

Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň

Genomia s.r.o. Genomia Janáčkova 51, 323 00 Plzeň Laboratoř uplatňuje flexibilní přístup k rozsahu akreditace upřesněný v dodatku. Aktuální seznam činností prováděných v rámci požadovaného flexibilního rozsahu je k dispozici na webových stránkách laboratoře

Více

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Co se děje v genetické laboratoři?

Co se děje v genetické laboratoři? 12 Co se děje v genetické laboratoři? Tento letáček byl vytvořen s pomocí Dr Iana M Fraylinga, Institute of Medical Genetics, University Hospital of Wales, Cardiff, UK; Dr Domenica Coviella, Laboratory

Více

S M L O U V A O S M L O U VĚ BUDOUCÍ. Níže uvedeného dne, měsíce a roku byla uzavřena mezi těmito smluvními stranami: obchodní společnost se sídlem:

S M L O U V A O S M L O U VĚ BUDOUCÍ. Níže uvedeného dne, měsíce a roku byla uzavřena mezi těmito smluvními stranami: obchodní společnost se sídlem: Níže uvedeného dne, měsíce roku byl uzvřen mezi těmito smluvními strnmi: obchodní společnost se sídlem: IČ: DIČ: zpsná zstoupen (dále jen jko budoucí strn prodávjící ) v obchodním rejstříku vedeném, oddíl,

Více

Bakalářská práce je přehledem literatury na dané téma literární rešerše

Bakalářská práce je přehledem literatury na dané téma literární rešerše Členění bakalářsk ské práce Bakalářská práce je přehledem literatury na dané téma literární rešerše - jsou sepisovány a kompilovány výsledky jiných, není vyžadována vlastní experimentální práce Pokyny

Více

SMLOUVU O UZAVŘENÍ BUDOUCÍ SMLOUVY KUPNÍ

SMLOUVU O UZAVŘENÍ BUDOUCÍ SMLOUVY KUPNÍ Níže uvedeného dne, měsíce roku uzvřeli: se sídlem: Koterovská 633/29, 326 00 Plzeň, ustnovený prvomocným Usnesením č.j. KSPL 54 INS 378/2012-A-19 ze dne 29.3.2012, insolvenčním správcem dlužník:. prvomocným

Více

Prenatální diagnostika Downova syndromu v ČR. Jsou rozdíly podle věku těhotné?

Prenatální diagnostika Downova syndromu v ČR. Jsou rozdíly podle věku těhotné? Prenatální diagnostika Downova syndromu v ČR. Jsou rozdíly podle věku těhotné? Antonín Šípek*, Vladimír Gregor*, Antonín Šípek jr.**, Ondřej Vencálek*** *Oddělení lékařské genetiky, Thomayerova nemocnice,

Více

Ke schválení technické způsobilosti vozidla je nutné doložit: Musí být doložen PROTOKOL O TECHNICKÉ KONTROLE? ANO NE 10)

Ke schválení technické způsobilosti vozidla je nutné doložit: Musí být doložen PROTOKOL O TECHNICKÉ KONTROLE? ANO NE 10) ÚTAV INIČNÍ A MĚTKÉ DPRAVY.s., Prh 4,Chodovec, Türkov 1001,PČ 149 00 člen skupiny DEKRA www.usmd.cz,/ Přehled zákldních vrint pltných pro dovoz jednotlivých vozidel dle zákon č.56/2001b. ve znění zákon

Více

MOŽNOSTI DIAGNOSTIKY INTOXIKACÍ ANTIDEPRESIVY. MARIE STAŇKOVÁ a, PETER ONDRA b a PETR KURKA a. Experimentální část

MOŽNOSTI DIAGNOSTIKY INTOXIKACÍ ANTIDEPRESIVY. MARIE STAŇKOVÁ a, PETER ONDRA b a PETR KURKA a. Experimentální část MOŽNOSTI DIAGNOSTIKY INTOXIKACÍ ANTIDEPRESIVY MARIE STAŇKOVÁ, PETER ONDRA b PETR KURKA Ústv soudního lékřství FN Ostrv, 17. listopdu 1790, 708 52 Ostrv-Porub, b Ústv soudního lékřství FN Olomouc, Hněvotínská

Více

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Vývojové vady a ortopedie. studijní opora pro kombinovanou formu studia

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Vývojové vady a ortopedie. studijní opora pro kombinovanou formu studia UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vývojové vady a ortopedie studijní opora pro kombinovanou formu studia Tělesná výchova a sport zdravotně postižených Doc.MUDr.Eva Kohlíková,

Více

Usnesení 54. schůze Rady města Kopřivnice, konané dne 25. 11. 2008

Usnesení 54. schůze Rady města Kopřivnice, konané dne 25. 11. 2008 Usnesení 54. schůze Rdy měst Kopřivnice, konné dne 2246 - Rd měst po projednání 1. d o p o r učuje zstupitelstvu měst s c h v á l i t 1.1. rozpočet měst Kopřivnice n rok 2009 v celkovém objemu 422 687,9

Více

,, Cesta ke zdraví mužů

,, Cesta ke zdraví mužů PREZENTACE VÝSLEDKŮ ŘEŠENÍ PILOTNÍHO PROJEKTU PREVENTIVNÍ PÉČE PRO MUŢE,, Cesta ke zdraví mužů prim. MUDr. Monika Koudová GHC GENETICS, s.r.o.- NZZ, Praha Projekt byl realizován ve dvou etapách: I. etapa

Více

informace pro těhotné péče

informace pro těhotné péče informace pro těhotné prenatální péče V průběhu těhotenství je nezbytné podstoupit řadu vyšetření pro kontrolu správného vývoje plodu. Klinická a laboratorní vyšetření při poskytování prenatální péče rozdělujeme

Více

[ Souhrnná informace o činnosti Zlínského genetického centra za kalendářní rok 2014 ]

[ Souhrnná informace o činnosti Zlínského genetického centra za kalendářní rok 2014 ] [ Souhrnná informace o činnosti Zlínského genetického centra za kalendářní rok 2014 ] Čerpejte Vaše další výhody při provedení kombinovaného testu v našem centru Kombinovaný test screening v I. trimestru

Více

Á Í Ě č ě š č č ž ě ě š č ě ě ě š ů ě ě š ů č ě ě ě ě š ů ě š ě ě ě š ů ě Ž Í ě ž ň ů úč ě Č č ž š ě ě ž ň ů ů č ě ď č č č č ú š ě č č Í Š ě č ť ě ě ů š č ů č ů ů ů ů ě ů ů ě ě š ů úč č š ě č ě ě ň š ě

Více

MODERNÍ VÝUKA ONKOLOGIE JAKO SOUČÁST NÁRODNÍHO ONKOLOGICKÉHO PROGRAMU. J. Vorlíček Česká onkologická společnost ČLS JEP

MODERNÍ VÝUKA ONKOLOGIE JAKO SOUČÁST NÁRODNÍHO ONKOLOGICKÉHO PROGRAMU. J. Vorlíček Česká onkologická společnost ČLS JEP MODERNÍ VÝUKA ONKOLOGIE JAKO SOUČÁST NÁRODNÍHO ONKOLOGICKÉHO PROGRAMU J. Vorlíček Česká onkologická společnost ČLS JEP I. Proč je v současné onkologii tak potřebná výuka S čím dnes musí počítat řízení

Více

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické Gonozomáln lní dědičnost Mgr. Aleš RUDA Chromozomové určení pohlaví autozomy gonozomy člověk má 22 párůp autozomů a 1 pár p gonozomů označen ení pohlavních chromozomů: : X a Y. jsou možné celkem 3 kombinace:

Více

+ F1 F2 + TRANSPLANTAČNÍ PRAVIDLA. Inbrední kmen A. Inbrední kmen B. Genotyp aa. Genotyp bb. Genotype ab. ab x ab. aa ab ab bb Genotypy

+ F1 F2 + TRANSPLANTAČNÍ PRAVIDLA. Inbrední kmen A. Inbrední kmen B. Genotyp aa. Genotyp bb. Genotype ab. ab x ab. aa ab ab bb Genotypy IMUNOGENETIKA II TRANSPLANTAČNÍ PRAVIDLA Inbrední kmen A Inbrední kmen B - F1 - e x F2 y y TRANSPLANTAČNÍ PRAVIDLA Inbrední kmen A Inbrední kmen B - F1 - e 3 4 x 3 4 F2 - - y y Transplantace orgánů,, které

Více

Porucha srážlivosti krve Chorobná krvácivost Deficit faktoru VIII nebo IX, vzácně XI Celoživotní záležitost Geneticky podmíněné onemocnění

Porucha srážlivosti krve Chorobná krvácivost Deficit faktoru VIII nebo IX, vzácně XI Celoživotní záležitost Geneticky podmíněné onemocnění Život s hemofilií Hemofilie Porucha srážlivosti krve Chorobná krvácivost Deficit faktoru VIII nebo IX, vzácně XI Celoživotní záležitost Geneticky podmíněné onemocnění Genetika Chybná genetická informace

Více

NEBUNĚČNÁ ŽIVÁ HMOTA VIRY

NEBUNĚČNÁ ŽIVÁ HMOTA VIRY NEBUNĚČNÁ ŽIVÁ HMOTA VIRY Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje 11.3.2011 Mgr.Petra Siřínková Rozdělení živé přírody 1.nadříše.PROKARYOTA 1.říše:Nebuněční

Více

Usnesení z 25. schůze Rady města Cvikova 4. prosince 2012

Usnesení z 25. schůze Rady města Cvikova 4. prosince 2012 Město Cvikov Usnesení z 25. schůze Rdy měst Cvikov 4. prosince 2012 účst: ze 7 členů přítomno: 6 členů, 1 omluven Ing. Dostál 468/12 Středisko pro rnou péči Liberec s.r.o n zákldě žádosti schvluje příspěvek

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

PROVÁDĚNÍ VŠEOBECNÉHO PRENATÁLNÍHO SCREENINGU

PROVÁDĚNÍ VŠEOBECNÉHO PRENATÁLNÍHO SCREENINGU Doporučený postup č. 1: PROVÁDĚNÍ VŠEOBECNÉHO PRENATÁLNÍHO SCREENINGU VROZENÝCH VÝVOJOVÝCH VAD Účinnost k 15. 1. 2014 Stav změn: 1. vydání. Tento postup navazuje na snahu o vytvoření Metodického návodu

Více

Vaše cesta ke zdravému dítěti

Vaše cesta ke zdravému dítěti Vážení klienti, Vaše cesta ke zdravému dítěti Preimplantační genetická diagnostika Sanatorium REPROMEDA patří již téměř 15 let mezi přední česká i evropská centra reprodukční medicíny. Již od počátku své

Více

MĚSTO KOPŘIVNICE MĚSTSKÝ ÚŘAD KOPŘIVNICE

MĚSTO KOPŘIVNICE MĚSTSKÝ ÚŘAD KOPŘIVNICE MĚSTO KOPŘIVNICE MĚSTSKÝ ÚŘAD KOPŘIVNICE Zstupitelstvo měst Kopřivnice PŘÍLOHA č. 1 k č. j.: 41/2006/OPE&33934/2010/Šo ZPRACOVATEL: Kteřin Šodková ČÍSLA USNESENÍ: 575-597 Usnesení 26. zsedání Zstupitelstv

Více

MINISTERSTVO PRO MÍSTNÍ ROZVOJ Národní orgán pro koordinaci POKYN PRO TVORBU A OBSAH ZPRÁVY O REALIZACI OPERAČNÍHO PROGRAMU PRO MONITOROVACÍ VÝBOR

MINISTERSTVO PRO MÍSTNÍ ROZVOJ Národní orgán pro koordinaci POKYN PRO TVORBU A OBSAH ZPRÁVY O REALIZACI OPERAČNÍHO PROGRAMU PRO MONITOROVACÍ VÝBOR MINISTERSTVO PRO MÍSTNÍ ROZVOJ Národní orgán pro koordinci POKYN PRO TVORBU A OBSAH ZPRÁVY O REALIZACI OPERAČNÍHO PROGRAMU PRO MONITOROVACÍ VÝBOR ŘÍJEN 2014 MINISTERSTVO PRO MÍSTNÍ ROZVOJ Odbor řízení

Více

NAVRHOVÁNÍ BETONOVÝCH MOSTŮ PODLE EUROKÓDU 2 ČÁST 2 MOSTY Z PŘEDPJATÉHO BETONU

NAVRHOVÁNÍ BETONOVÝCH MOSTŮ PODLE EUROKÓDU 2 ČÁST 2 MOSTY Z PŘEDPJATÉHO BETONU POZVÁNKA A ZÁVAZNÁ PŘIHLÁŠKA DOPORUČENO PRO AUTORIZOVANÉ OSOBY SLEVY: AO ČKAIT 10 %, ČBS 20 %, AO+ČBS 30 % PŘI ÚČASTI NA 5. NEBO 6. BĚHU ŠKOLENÍ EC2-1 DALŠÍ SLEVA 5 % Ktedrou betonových zděných konstrukcí

Více

L.Prokopová. Interní hepatogastroenterologická klinika FN Brno - Bohunice Masarykova univerzita Brno

L.Prokopová. Interní hepatogastroenterologická klinika FN Brno - Bohunice Masarykova univerzita Brno L.Prokopová Interní hepatogastroenterologická klinika FN Brno - Bohunice Masarykova univerzita Brno udání hlášení INFORMACE vědomosti znalosti poučení sdělení LÉKAŘ x NEMOCNÝ IBD INFORMACE LIMITOVÁNY SOUČASNÝM

Více

Vrozené vady u narozených v roce 2010. Congenital malformations in births in year 2010

Vrozené vady u narozených v roce 2010. Congenital malformations in births in year 2010 Aktuální informace Ústavu zdravotnických informací a statistiky České republiky Praha 16. 10. 2012 51 Souhrn Vrozené vady u narozených v roce 2010 Congenital malformations in births in year 2010 V roce

Více

Klinické sledování. Screening kardiomyopatie na podkladě familiární transthyretinové amyloidózy. u pacientů s nejasnou polyneuropatií

Klinické sledování. Screening kardiomyopatie na podkladě familiární transthyretinové amyloidózy. u pacientů s nejasnou polyneuropatií Klinické sledování Screening kardiomyopatie na podkladě familiární transthyretinové amyloidózy u pacientů s nejasnou polyneuropatií Informace pro pacienta Vážená paní, vážený pane, Na základě dosud provedených

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

NAŘÍZENÍ EVROPSKÉHO PARLAMENTU A RADY (ES)

NAŘÍZENÍ EVROPSKÉHO PARLAMENTU A RADY (ES) NAŘÍZENÍ EVROPSKÉHO PARLAMENTU A RADY (ES) č. 178/2002 ze dne 28. ledn 2002, kterým se stnoví obecné zásdy poždvky potrvinového práv, zřizuje se Evropský úřd pro bezpečnost potrvin stnoví postupy týkjící

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

smlouvu o složení finanční částky do advokátní úschovy Níže uvedeného dne, měsíce a roku uzavřeli

smlouvu o složení finanční částky do advokátní úschovy Níže uvedeného dne, měsíce a roku uzavřeli Níže uvedeného dne, měsíce roku uzvřeli 1. Zdeněk Berntík, nr. 14.5.1954 Jrmil Berntíková, nr. 30.12.1956 ob bytem Stroveská 270/87, Ostrv-Proskovice ob jko Smluvní strn 1 2. Tělovýchovná jednot Petřvld

Více

Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc

Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie a myelodysplastický syndrom Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie (AL) Představují heterogenní skupinu chorob charakterizovaných kumulací klonu nevyzrálých, nádorově

Více

(1) přičemž všechny veličiny uvažujeme absolutně. Její úpravou získáme vztah + =, (2) Přímé zvětšení Z je dáno vztahem Z = =, a a

(1) přičemž všechny veličiny uvažujeme absolutně. Její úpravou získáme vztah + =, (2) Přímé zvětšení Z je dáno vztahem Z = =, a a Úloh č. 3 Měření ohniskové vzdálenosti tenkých čoček 1) Pomůcky: optická lvice, předmět s průhledným milimetrovým měřítkem, milimetrové měřítko, stínítko, tenká spojk, tenká rozptylk, zdroj světl. ) Teorie:

Více

Ask your provider Obsah této brožury slouží k podání informací

Ask your provider Obsah této brožury slouží k podání informací Jednoduchý A simple, safe a bezpečný blood test that s vysokou offers highly citlivostí sensitive stanovení. results An advanced non-invasive test Moderní neinvazivní krevní test for fetal trisomy assessment

Více

GENETICKÉ TESTOVÁNÍ. - příslib nebo hrozba? Editorial v British Medical Journal 14.února 1998:

GENETICKÉ TESTOVÁNÍ. - příslib nebo hrozba? Editorial v British Medical Journal 14.února 1998: GENETICKÉ TESTOVÁNÍ - příslib nebo hrozba? Editorial v British Medical Journal 14.února 1998: Pokroky v molekulární genetice: výhody: - porozumění mechanismu nemocí - nové klasifikace nemocí - cílená a

Více

14. 1. 2013. Popis využití: Výukový materiál s úkoly pro žáky s využitím dataprojektoru,

14. 1. 2013. Popis využití: Výukový materiál s úkoly pro žáky s využitím dataprojektoru, VY_32_INOVACE_PSYPS13260ZAP Výukový materiál v rámci projektu OPVK 1.5 Peníze středním školám Číslo projektu: CZ.1.07/1.5.00/34.0883 Název projektu: Rozvoj vzdělanosti Číslo šablony: III/2 Datum vytvoření:

Více

VSTUPNÍ DOTAZNÍK. EuroFertil CZ, a.s

VSTUPNÍ DOTAZNÍK. EuroFertil CZ, a.s Vyplňte pečlivě tento dotazník před Vaší první návštěvou v centru nebo v jejím rámci. Dotazy, kterým nerozumíte nebo odpověď neznáte, nevyplňujte. VSTUPNÍ DOTAZNÍK PACIENTKA Titul, jméno a příjmení: Datum

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Testování přenašečství

Testování přenašečství 16 Testování přenašečství Všechna jména v tomto letáčku byla změněna z důvodu ochrany osob, které poskytly interview. Vytvořila skupina Genetic Alliance UK. Překlad: Ústav biologie a lékařské genetiky

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

Ó Á Ň Í Ž Č Í Ž ň Ž Ž ú Ž Ž Á Ž Í ú ú ú Í Í ť ť ď Í Í ú Í ď Ž Ř Í ň ď Č Í Č Č ď ď Ž Č ď Ž Ž ď Í Ž ú ď Ó ď ú Í Í ď ď ď ď ň Žď ú ú ť ď ď ď Ž Ž Á ď Ž Í Ž Ž Ž ď Ž Č Ž Ž ú Ž Í ú ň Ž ú ď ň ď Č Č ď ú Č ť Ó Í

Více

SMLOUVU O UZAVŘENÍ BUDOUCÍ SMLOUVY KUPNÍ

SMLOUVU O UZAVŘENÍ BUDOUCÍ SMLOUVY KUPNÍ Níže uvedeného dne, měsíce roku uzvřeli: KOPPA, v.o.s., se sídlem Mozrtov 679/21, 460 01 Liberec, ustnovená prvomocným Usnesením č.j. KSUL 44 INS 5060/2014-A-13, ze dne 04. dubn 2014, insolvenčním správcem

Více

Laboratorní příručka

Laboratorní příručka IČ 00064165, tel. 224961111 VFN a 1. LF UK, Albertov 4 www.vfn.cz www.lf1.cuni.cz Strana 1 z 21 Verze 3 Zpracoval: MUDr. Romana Mihalová Ing. Jitka Štekrová Mgr. Marie Valeriánová, Ph.D. Odborný garant:

Více

Usnesení 57. schůze Rady města Kopřivnice, konané dne 20. 01. 2009

Usnesení 57. schůze Rady města Kopřivnice, konané dne 20. 01. 2009 Usnesení 57. schůze Rdy měst Kopřivnice, konné dne 2394 - Rd měst po projednání s c h v l u j e doplnění týmu CAF o DiS. Ivnu Rškovou, koordinátorku projektu Zdrvé město MA 21. 2395 - Rd měst po projednání

Více

Lékařská genetika. Koncepce oboru. - na vyhledávání nosičů genetických onemocnění v postižených rodinách

Lékařská genetika. Koncepce oboru. - na vyhledávání nosičů genetických onemocnění v postižených rodinách Lékařská genetika 208 Koncepce oboru 2. ODBORNÁ NÁPLŃ OBORU Lékařská genetika (LG) je samostatným vědním oborem v systému lékařských věd. Po stránce kvalifikační jde o nástavbový obor pro lékaře s nejméně

Více

Konstrukce balkonů a teras. Varianty 1-8

Konstrukce balkonů a teras. Varianty 1-8 Konstrukce blkonů ters Vrinty 1-8 Konstrukce blkonů ters Konstrukční skldb 1 Podlhová konstrukce se Schlüter -DITRA 25 Kontktní izolce seprce ve spojení vyrovnání tlku vodní páry nd nosným, vyspádovným

Více

Schizoafektivní porucha

Schizoafektivní porucha Schizoafektivní porucha Tomáš Novák Psychiatrické centrum Praha Historie konceptu SCHA poruchy 1933 Kasanin: akutní schizoafektivní psychóza Do 1975 v klasifikacích jako podtyp schizofrenie 1975 DSM III:

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v

Více

č. účel patro m 2 148 administrativa 1NP 36,98 150 administrativa 1NP 33,53

č. účel patro m 2 148 administrativa 1NP 36,98 150 administrativa 1NP 33,53 č. účel patro m 2 148 administrativa 1NP 36,98 150 administrativa 1NP 33,53 1.50 1.48 2.21 č. účel patro m 2 221 administrativa 2NP 23,14 222 administrativa 2NP 17,89 223 administrativa 2NP 49,00 224 administrativa

Více

ORTODONTICKÝ PRŮVODCE PRAKTICKÉHO ZUBNÍHO LÉKAŘE

ORTODONTICKÝ PRŮVODCE PRAKTICKÉHO ZUBNÍHO LÉKAŘE MUDr. Mgdlen Koťová, Ph.D. ORTODONTICKÝ PRŮVODCE PRAKTICKÉHO ZUBNÍHO LÉKAŘE Recenzent: Prof. MUDr. Jiří Mzánek, DrSc. Grd Pulishing,.s., 2006 Fotogrfie z rchivu utorky. Perokresy podle návrhů utorky nkreslil

Více

Současné trendy v epidemiologii nádorů se zaměřením na Liberecký kraj

Současné trendy v epidemiologii nádorů se zaměřením na Liberecký kraj Institut biostatistiky a analýz, Lékařská a přírodovědecká fakulta, Masarykova univerzita, Brno Současné trendy v epidemiologii nádorů se zaměřením na Mužík J. Epidemiologie nádorů v ČR Epidemiologická

Více

Konvence Integrovaného dopravního systému Libereckého kraje (IDOL) Účastníci Konvence:

Konvence Integrovaného dopravního systému Libereckého kraje (IDOL) Účastníci Konvence: Konvence Integrovného doprvního systému Libereckého krje (IDOL) Účstníci Konvence: KORID LK, spol. s r.o. Liberecký krj Město Česká Líp Město Jblonec nd Nisou Sttutární město Liberec Město Turnov České

Více

Sdílené genetické poradenství - nový trend v genetické ambulanci.

Sdílené genetické poradenství - nový trend v genetické ambulanci. Sdílené genetické poradenství - nový trend v genetické ambulanci. Filozofické pozadí nové genetiky a její sociální dopady. Paternalismus versus partnerství v medicíně a genetice zvlášť. Nedirektivní genetické

Více

10. Nebezpečné dotykové napětí a zásady volby ochran proti němu, ochrana živých částí.

10. Nebezpečné dotykové napětí a zásady volby ochran proti němu, ochrana živých částí. 10. Nebezpečné dotykové npětí zásdy volby ochrn proti němu, ochrn živých částí. Z hledisk ochrny před nebezpečným npětím rozeznáváme živé neživé části elektrického zřízení. Živá část je pod npětím i v

Více

Zpráva o výsledcích 2. části pilotního projektu VZP, který probíhal v r. 2010 v České republice za finanční podpory VZP.

Zpráva o výsledcích 2. části pilotního projektu VZP, který probíhal v r. 2010 v České republice za finanční podpory VZP. Zpráva o výsledcích 2. části pilotního projektu VZP, který probíhal v r. 2010 v České republice za finanční podpory VZP. Vyšetření poruch štítné žlázy u těhotných žen - r. 2010 Vzhledem k tomu, že druhá

Více