Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Rozměr: px
Začít zobrazení ze stránky:

Download "Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha"


1 Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh

2 Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem repets, SSR simple sequence repets TGCCTCGGTCCCCCCCCGTGCTTCGTGC TGCCTCGGTCCCCCCGTGCTTCGTGCGTG Pokud se detekovtelný polymorfismus nchází dosttečně blízko lokusu, ve kterém se vyskytuje kuzální mutce pro sledovnou chorobu, bude tento polymorfismus ve vzbě s mutovnou lelou ve většině přípdů bude součsně s ní předáván z rodičů n potomky (kosegregce) bude možné jej využít jko mrker i bez znlosti molekulární podstty dného onemocnění.

3 Úkol č. 2, str. 8 Polycystická chorob ledvin (D, p = 5cM) B C D ) Riziko postižení pro /3 i /4 je 50%.

4 Úkol č. 2, str. 8 Polycystická chorob ledvin (D, p = 5cM) B C D ) Riziko postižení pro /3 i /4 je 50%. b) Riziko postižení pro /3 je 95%. b) Riziko postižení pro /4 je 5%.

5 Nondisjunkce u Downov syndromu Tři rodokmeny rodin s dětmi postiženými Downovým syndromem (prostá trisomie). Výsledek nlýzy DN tetrnukleotidového polymorfismu n chromozómu 2 - je znázorněn pod rodokmeny. Od kterého z rodičů zdědilo dítě třetí kopii chromozómu 2? V kterém meiotickém dělení došlo k nondisjunkci?

6 Nondisjunkce u Downov syndromu? Meióz u otce nebo u mtky

7 Nondisjunkce u Downov syndromu? Meióz u otce nebo u mtky Meióz u mtky

8 Nondisjunkce u Downov syndromu? Meióz u otce nebo u mtky Meióz u mtky Meióz u mtky

9 Úkol č., str. 95, PKU Nemá PKU 2/3, /3 /2, /4, /4 Prentální dg. v té době nebyl možná. Riziko 25% umožňovlo rodičům požádt o ukončení těhotenství ze zdrvotních (genetických) důvodů. Screening po nrození dítěte by odhlil onemocnění, dietní optření by umožnil reltivně příznivý vývoj

10 Úkol č. 2, str. 95, PKU (incidence /0000) / /3 2/3 /2 /2 /50 x ½ x 2/3 x ½ = 2/600 = /300 q 2 = /0000 q = /00 2pq = 2 x 99/00 x /00 = /50 Riziko postižení nízké, zátěžové testy v přípdě PKU málo přesné, lze doporučit DN nlýzu. Je nutné mít dosttek čsu n provedení vyšetření DN v obou rodinách!! Jink není možné přistoupit k prentální dg.

11 Úkol č. 2b-, str. 95, PKU (incidence /0000) / /3 2/3 /2 /50 x ½ x = /00 q 2 = /0000 q = /00 2pq = 2 x 99/00 x /00 = /50

12 Úkol č. 2b-2, str. 95, PKU (incidence /0000) / /3 2/3 /2 /2 /50 x ½ x 2/3 x ½ = 2/600 = /300 q 2 = /0000 q = /00 2pq = 2 x 99/00 x /00 = /50

13 Úkol č. 3, str. 96, PKU ) NO, rodin je informtivní z hledisk genotypu dětí. b) ntrgenová sond, dcer tedy JE heterozygotní. c) ntrgenová sond, syn tedy JE dominntní homozygot. d) Jedná se o nepřímou dignostiku, NELZE využít mimo kontext dné rodiny. 5

14 Úkol č. 4, str. 96 Mutovná lel R408W R408W (Sty ) * 08 bp 37 bp Normální lel bp

15 Úkol č. 4, str ? / + + / + + / +

16 Úkol č. 5, str výsledky SSCP pro EXON č GENOTYP? 6mut / + +/ + 6mut / + 6mut / + 6mut / + Mutce v 6. exonu (6mut) +/ + +/ + + / + + / + + / + 9

17 Úkol č. 4c,d, str ? mut / + c) Bylo by lepší znát druhou mutci v rodině snoubenky, kterou musí mít /3 nejspíše i /3. Spojením s nepřímou dignostikou bychom mohli stnovit genotyp nenrozeného potomk snoubenců. Klinický genetik rozhodne, zd v této fázi prentální vyšetření nbídnout snoubencům. d) Pátrání po druhé mutci v rodině snoubenky (ETK - poučený souhls!)

18 Úkol č. 5, str výsledky SSCP pro EXON č GENOTYP? 6mut / + +/ + 6mut / + 6mut / + 6mut / + Mutce v 6. exonu (6mut) +/ + +/ + + / + + / + + / +

19 Úkol č. 5, str b) Biopsie trofoblstu (odběr týden grvidity), mniocyty po týdnu grvidity MOŽNÉ POSTUPY nepřímá DN nlýz (RFLP), po doplnění vyšetření v rodině snoubence, pokud bude informtivní přímá DN nlýz R408W, SSCP 6.exonu kombince obou předchozích bude-li v době grvidity určen 6mut přímá nlýz sekvenování Metodu volí specilist v lbortoři.

20 Úkol č. 5, str Poznámk: Dle součsných pltných právních etických norem: c) Odběr tkáně z účelem izolce vyšetření DN je vázán n poučený souhls pcient. U nezletilých o vyšetření rozhodují zákonní zástupci. d) Od okmžiku, kdy je známo, že snoubenci jsou heterozygotní, je možno n žádost ženy indikovt ukončení grvidity ze zdrvotních (genetických) příčin pro 25% (vysoké) riziko závžné vdy či choroby plodu. Teoreticky ž do 24. týdne grvidity.

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Molekulární genetika II zimní semestr 4. výukový týden ( )

Molekulární genetika II zimní semestr 4. výukový týden ( ) Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Molekulární genetika II zimní semestr 4. výukový týden (27.10. 31.10.2008) prenatální DNA diagnostika presymptomatická Potvrzení diagnózy Diagnostika


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol

Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol Syndrom fragilního X chromosomu (syndrom Martinův-Bellové) Antonín Bahelka, Tereza Bartošková, Josef Zemek, Patrik Gogol 20.5.2015 Popis klinických příznaků, možnosti léčby Muži: střední až těžká mentální


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). Orphanet - Volně přístupné webové stránky s informacemi


49. výroční cytogenetická konference a XI. hradecký genetický den

49. výroční cytogenetická konference a XI. hradecký genetický den 1 1 Výsledky prenatální diagnostiky chromozomových aberací v ČR Vladimír Gregor 1,2, 3, Antonín Šípek 1,2,4, Antonín Šípek jr. 1,5, Jiří Horáček 1,6 Oddělení lékařské genetiky, Thomayerova nemocnice, Praha


Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní


Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více Prevence vrozených vad z pohledu genetika MUDr. Vladimír Gregor, RNDr. Jiří Horáček odd. lékařské genetiky, Fakultní Thomayerova nemocnice v Praze Genetické poradenství Klinická genetika se zabývá diagnostikou


- karyotyp: 47, XX, +18 nebo 47, XY, +18 = trizomie chromozomu 18 (po Downově syndromu druhou nejčatější trizomii)

- karyotyp: 47, XX, +18 nebo 47, XY, +18 = trizomie chromozomu 18 (po Downově syndromu druhou nejčatější trizomii) Edwardsův syndrom Edwardsův syndrom - karyotyp: 47, XX, +18 nebo 47, XY, +18 = trizomie chromozomu 18 (po Downově syndromu druhou nejčatější trizomii) - Prevalence v populaci: u narozených dětí cca 1:6500-1:8000,


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Poznámky k nutrigenetice

Poznámky k nutrigenetice Poznámky k nutrigenetice Ondřej Šeda Institut klinické a experimentální medicíny, Praha Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Research Centre CHUM, Montreal, Canada Nutrigenetika Jednotlivé


Virtuální svět genetiky 1

Virtuální svět genetiky 1 Chromozomy obshují mnoho genů pokud nejsou rozděleny crossing-overem, pk lely přítomné n mnoh lokusech kždého homologního chromozomu segregují jko jednotk během gmetogeneze. Rekombinntní gmety jsou důsledkem


Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi


Co to je genetický test?

Co to je genetický test? 12 Co to je genetický test? Vytvořeno podle informačních letáků vypracovaných nemocnicemi Guy's a St. Thomas' Hospital, Londýn. Tato práce byla podpořena projektem Eurogentest v rámci Evropského 6. RP;





Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Downův syndrom. Renata Gaillyová OLG FN Brno

Downův syndrom. Renata Gaillyová OLG FN Brno Downův syndrom Renata Gaillyová OLG FN Brno Zastoupení genetických chorob a vývojových vad podle etiologie 0,6 %-0,7% populace má vrozenou chromosomovou aberaci incidence vážných monogenně podmíněných


Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická


Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky

Více Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Prenatální diagnostika Downova syndromu v ČR. Jsou rozdíly podle věku těhotné?

Prenatální diagnostika Downova syndromu v ČR. Jsou rozdíly podle věku těhotné? Prenatální diagnostika Downova syndromu v ČR. Jsou rozdíly podle věku těhotné? Antonín Šípek*, Vladimír Gregor*, Antonín Šípek jr.**, Ondřej Vencálek*** *Oddělení lékařské genetiky, Thomayerova nemocnice,


Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární


Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie


Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti

Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Mutace genu pro Connexin 26 jako významná příčina nedoslýchavosti Petr Lesný 1, Pavel Seeman 2, Daniel Groh 1 1 ORL klinika UK 2. LF a FN Motol Subkatedra dětské ORL IPVZ Přednosta doc. MUDr. Zdeněk Kabelka


Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) Chromosomové změny Unique - Britská svépomocná skupina


2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia

2 Inkompatibilita v systému Rhesus. Upraveno z A.D.A.M.'s health encyclopedia 2 Inkompatibilita v systému Rhesus Upraveno z A.D.A.M.'s health encyclopedia 3 Inkompatibilita v systému Rhesus Úkol 7, str.119 Které z uvedených genotypových kombinací Rh systému u manželů s sebou nesou





Prenatální diagnostika v roce 2008 předběžné výsledky

Prenatální diagnostika v roce 2008 předběžné výsledky Prenatální diagnostika v roce 28 předběžné výsledky V. Gregor 1, A. Šípek 1, 2 1 Oddělení lékařské genetiky, Fakultní Thomayerova nemocnice, Praha 2 3.Lékařská fakulta Univerzity Karlovy, Praha Pracovní


Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010 Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem Milan Bartoš Forum veterinarium, Brno 2010 Vývoj farmakogenetické diagnostické soupravy pro stanovení genetických polymorfismů


CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.


Smlouva o příspěvku na provoz školy (dále jen smlouva)

Smlouva o příspěvku na provoz školy (dále jen smlouva) v zstoupení : Ing. Hn Novotná, ředitelk jko strn oprávněná (dále jen oprávněná strn) I.2. studentk student denního studi oboru 23-45-L/005 Mechnik číslicově řízených strojů studentkou - studentem. v zstoupení



21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka


Chromosomové translokace

Chromosomové translokace 12 Unique - Britská svépomocná skupina pro vzácné chromosomové vady. Tel: + 44 (0) 1883 330766 Email: www.rarechromo Chromosomové translokace EuroGentest - Volně přístupné webové stránky


Vrozené chromozomové aberace v České republice v období 1994 2013

Vrozené chromozomové aberace v České republice v období 1994 2013 Vrozené chromozomové aberace v České republice v období 1994 213 Vladimír Gregor 1,2.3, Antonín Šípek 1,2,4, Antonín Šípek jr. 1,5, Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské


Vrozené chromozomové aberace v České republice v období 1994 2013

Vrozené chromozomové aberace v České republice v období 1994 2013 Vrozené chromozomové aberace v České republice v období 1994 213 Vladimír Gregor 1,2.3, Antonín Šípek 1,2,4, Antonín Šípek jr. 1,5, Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské


ý č Í É Ě Í š Č č ý Ú ť š č ú š ý š ď č č ý Š Š č č Á ý ť ť Í ý ť č Ť É Ě Í š Č Č Ý ť Í ý ý č Ý É Ě Í č š ý ň č ý Í ď Í ú Ě Í č É Ě Í š č č Í ý ý úč č É Ě Í ý č ň š č ý ď ť ť ž ý č č É š Ě Í č š Ě š čď



PRENATÁLNÍ DIAGNOSTIKA VROZENÝCH VAD V ČESKÉ REPUBLICE AKTUÁLNÍ DATA PRENATÁLNÍ DIAGNOSTIKA VROZENÝCH VAD V ČESKÉ REPUBLICE AKTUÁLNÍ DATA Vladimír Gregor 1,2, 3, Antonín Šípek 1,2,4 Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské genetiky, Sanatorium


Neinvazivní test nejčastějších chromosomálních vad plodu z volné DNA

Neinvazivní test nejčastějších chromosomálních vad plodu z volné DNA PRENATÁLN Í TEST PANORA M A TM Neinvazivní test nejčastějších chromosomálních vad plodu z volné DNA Panorama TM test TM test je vyšetření je vyšetření DNA, DNA, které které Vám Vám poskytne poskytne důležité


KBI/GENE Mgr. Zbyněk Houdek

KBI/GENE Mgr. Zbyněk Houdek Genealogie KBI/GENE Mgr. Zbyněk Houdek Rodokmenové schéma Shromáždění informací o rodině je 1. důležitým krokem v genetickém poradenství. Rodokmenové schéma musí být srozumitelné a jednoznačné. Poskytuje


Včasná diagnostika (2014 2015)

Včasná diagnostika (2014 2015) Včasná diagnostika (2014 2015) 1 Projekt Včasná diagnostika 2 Projekt vzdělávání studentů Včasná diagnostika (2014 2015) V rámci plnění NAP RD, aktivita č. 4 (Zlepšení screeningu a diagnostiky u VO) ČAVO


rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické


Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár

Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár Sterilita: stav, kdy se páru nedaří spontánně otěhotnět i přes pravidelný nechráněný pohlavní styk po dobu jednoho roku Infertilita: stav, kdy je pár schopen spontánní koncepce, ale žena není schopna donosit


GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních



TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy


Smlouva o příspěvku na provoz školy (dále jen smlouva)

Smlouva o příspěvku na provoz školy (dále jen smlouva) bnk. spojení : KB,.s. Brno-město, exp. Kuřim, č.ú. 201203621/0100 v zstoupení : Ing. Hn Novotná, ředitelk jko strn oprávněná I.2. studentk student denního studi oboru 26-41-L/01 Mechnik elektrotechnik


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Proč se někdy dělá biopsie choria a jindy amniocentéza?

Proč se někdy dělá biopsie choria a jindy amniocentéza? K čemu slouží biopsie choria? Prenatálně diagnostický test, který detekuje chromozomální abnormlity u plodu. K vyšetření se používají klky, které tvoří tzv. chorion. Z choria se postupem času vytvoří placenta.


Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění





Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


Zhoubný novotvar ledviny mimo pánvičku v ČR

Zhoubný novotvar ledviny mimo pánvičku v ČR Aktuální informce Ústvu zdrvotnických informcí sttistiky České repuliky Prh 8.1.2004 1 Zhouný novotvr ledviny mimo pánvičku v ČR Počet hlášených onemocnění zhouným novotvrem ledviny mimo pánvičku (dg.





Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


JEDINEČNÁ INFORMACE. Jediný prenatální krevní test, který analyzuje všechny chromozomy vašeho miminka

JEDINEČNÁ INFORMACE. Jediný prenatální krevní test, který analyzuje všechny chromozomy vašeho miminka JEDINEČNÁ INFORMACE Jediný prenatální krevní test, který analyzuje všechny chromozomy vašeho miminka MaterniT GENOME test nabízí více informací o chromozomech vašeho miminka než kterýkoliv jiný prenatální


Informovaný souhlas s neinvazivním prenatálním testem aneuploidií chromozomů 13, 18 a 21 testem CLARIGO TM

Informovaný souhlas s neinvazivním prenatálním testem aneuploidií chromozomů 13, 18 a 21 testem CLARIGO TM Informovaný souhlas s neinvazivním prenatálním testem aneuploidií chromozomů 13, 18 a 21 testem CLARIGO TM Jméno a příjmení vyšetřovaného:. číslo pojištěnce:. 1. Popis účelu odběru vzorků a genetického


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí,

Využití molekulárních markerů v systematice a populační biologii rostlin. 12. Shrnutí, Využití molekulárních markerů v systematice a populační biologii rostlin 12. Shrnutí, Přehled molekulárních markerů 1. proteiny isozymy 2. DNA markery RFLP (Restriction Fragment Length Polymorphism) založené



MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Určování a ověřování paternity u koní. Bakalářská práce Brno 2006 Vedoucí bakalářské


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár


Vrozené chromosomové aberace v ČR v období 1993-2012

Vrozené chromosomové aberace v ČR v období 1993-2012 Vrozené chromosomové aberace v ČR v období 1993-212 Vladimír Gregor 1,2, 3, Antonín Šípek 1,2,4 Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské genetiky, Sanatorium PRONATAL,


Spinální svalová atrofie. Vypracovali: Kateřina Teplá Monika Madrová Anna Dobrovolná Mária Čižmárová Dominika Štrbová Juraj Štipka

Spinální svalová atrofie. Vypracovali: Kateřina Teplá Monika Madrová Anna Dobrovolná Mária Čižmárová Dominika Štrbová Juraj Štipka Spinální svalová atrofie Vypracovali: Kateřina Teplá Monika Madrová Anna Dobrovolná Mária Čižmárová Dominika Štrbová Juraj Štipka Klinický popis - relativně vzácná nemoc, nicméně se jedná o nejčastější


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Výzva k podání nabídky a k prokázání kvalifikace pro VZ malého rozsahu

Výzva k podání nabídky a k prokázání kvalifikace pro VZ malého rozsahu Výzv k podání nbídky k prokázání kvlifikce pro VZ mlého rozshu Název veřejné zkázky: Servisní podpor NN zřízení LNS Brno Identifikce zdvtele: Zdvtel: Řízení letového provozu České republiky, s.p. Se sídlem:


Časná ultrazvuková diagnostika rozštěpových vad obličeje u plodu

Časná ultrazvuková diagnostika rozštěpových vad obličeje u plodu Časná ultrazvuková diagnostika rozštěpových vad obličeje u plodu MUDr. Vlašín P., MUDr. Pavková Š., Centrum prenatální diagnostiky Brno, Veveří 39, 60200, Brno Vyšetření


1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


Věstník MINISTERSTVA ZDRAVOTNICTVÍ ČESKÉ REPUBLIKY OBSAH: 1. Oznámení o termínu konání zkoušky o odborné způsobilosti k výkonu odborného

Věstník MINISTERSTVA ZDRAVOTNICTVÍ ČESKÉ REPUBLIKY OBSAH: 1. Oznámení o termínu konání zkoušky o odborné způsobilosti k výkonu odborného Věstník Ročník 2009 MINISTERSTVA ZDRAVOTNICTVÍ ČESKÉ REPUBLIKY Částk 3 Vydáno: 20. KVĚTNA 2009 Cen: 101 Kč OBSAH: 1. Oznámení o termínu konání zkoušky o odborné způsobilosti k výkonu odborného dohledu


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


ů ů Č ů ů Š ž ů žď ž ž ž žď ů ů ž ů ó Č Ý Š ú Ý Á Š ž ů ž ž ž ů Š ú Ž ů ú ž Ř ó ž ú ž ň ž Á Š ň ď ž ú Ý ť Č Ř ň Š Á Š ž Š Š ž ú Ý ť Ř žď Š ž Á ž Š ů ť ť ů ú Ý Č Ř Ň ť Á ž Š ú Ý ž ž ó ž Ř žď Ň ž ž ň Ť ó


Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající



SMLOUVU O UZAVŘENÍ BUDOUCÍ SMLOUVY KUPNÍ Níže uvedeného dne, měsíce roku uzvřeli: 1. Eret Tomáš, r.č. 711107/1814 bytem: nám. Krále Jiřího z Poděbrd 1/14, 350 02 Cheb 2 jko budoucí prodávjící n strně jedné 2. mnželé xxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxx


Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce


Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska

Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska A. Šípek jr. (1), R. Mihalová (1), A. Panczak (1), L. Hrčková (1), P. Lonský (2), M. Janashia (1), M. Kohoutová


Zeptejte se svého lékaře

Zeptejte se svého lékaře Jednoduchý a bezpečný krevní test, který nabízí vysokou citlivost stanovení Neinvazivní test, který vyhodnocuje riziko onemocnění chromozomálního původu, jako je např. Downův syndrom, a nabízí také možnost



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti


Screening VVV v ČR v roce 2011

Screening VVV v ČR v roce 2011 Screening VVV v ČR v roce 2011 D. Springer, T. Zima ÚLBLD VFN a 1. LF UK Praha XXXIII.IAD Ústí nad Labem 1.- 3.4.2012 Cíl péče o těhotnou Nekomplikovaný porod zdravého dítěte zdravé matce ve správný čas


Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace Mutace Klasifikace mutací Z hlediska lokalizace mutací v genotypu Genové mutace Chromozomální mutace Genomové mutace Vznik genových mutací Tranzice pyrim. za pyrim. C na T T na C purin za purin A na G


úč úč ž ů ž Č Č č č ů ž úč č úč ť Ň č ú Ý č č Ú Ú ť ú č ď ů ž š úč ž úč úč ž ť ď ť ď ž ú č č úč š ž Ů č č ú úč ž ů ť úč ž ž ž Ů č ž ú č Š úč č Úč Č Č š ď š Š š Ó Ó ž ůč ú Ď ť ž ů ů č ů Č ů ž úč Ý č ž úč


č ů š ň č č Ú č č č Ú ů Ú č ž ú š š ý č ú ó ó ž č ý ý ý č ž č ý ž ý č ý ž ž č ý ý ý ž ý ý ý ý š ý š ů ů č č ý ž č ý ů š ž ý Ú Ú úč š ů ž ů ů Úč ž č ý č š ý ů č š ý ý ý ů č č ž ů š ů ů š ý ý ů ů č č ž ú


Á Ě Í Ě Á Á ó č ž č ž č Í š úč é úč š ž č é ů č é č é é ů č ů č č ů é Ž š ů ů š č é Ž č é Ž č Í ž Ž Ž é é Ů é Ř ů ť š é é č é é é š č č é č č č č š č š é č é č ů č č š ú é č é š é Ž Ž é é ú č č é ů č š


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika
