Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Molekulární genetika II. Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha"


1 Molekulární genetik Ústv biologie lékřské genetiky.lf UK VFN, Prh

2 Polymorfismy lidské DN vyu ívné ve vzebné nlýze, p ímé nep ímé dignostice Mikrostelity (syn. krátké tndemové repetice) STR short tndem repets, SSR simple sequence repets TGCCTCGGTCCCCCCCCGTGCTTCGTGC TGCCTCGGTCCCCCCGTGCTTCGTGCGTG Pokud se detekovtelný polymorfismus nchází dosttečně blízko lokusu, ve kterém se vyskytuje kuzální mutce pro sledovnou chorobu, bude tento polymorfismus ve vzbě s mutovnou lelou ve většině přípdů bude součsně s ní předáván z rodičů n potomky (kosegregce) bude možné jej využít jko mrker i bez znlosti molekulární podstty dného onemocnění.

3 Úkol č. 2, str. 8 Polycystická chorob ledvin (D, p = 5cM) B C D ) Riziko postižení pro /3 i /4 je 50%.

4 Úkol č. 2, str. 8 Polycystická chorob ledvin (D, p = 5cM) B C D ) Riziko postižení pro /3 i /4 je 50%. b) Riziko postižení pro /3 je 95%. b) Riziko postižení pro /4 je 5%.

5 Nondisjunkce u Downov syndromu Tři rodokmeny rodin s dětmi postiženými Downovým syndromem (prostá trisomie). Výsledek nlýzy DN tetrnukleotidového polymorfismu n chromozómu 2 - je znázorněn pod rodokmeny. Od kterého z rodičů zdědilo dítě třetí kopii chromozómu 2? V kterém meiotickém dělení došlo k nondisjunkci?

6 Nondisjunkce u Downov syndromu? Meióz u otce nebo u mtky

7 Nondisjunkce u Downov syndromu? Meióz u otce nebo u mtky Meióz u mtky

8 Nondisjunkce u Downov syndromu? Meióz u otce nebo u mtky Meióz u mtky Meióz u mtky

9 Úkol č., str. 95, PKU Nemá PKU 2/3, /3 /2, /4, /4 Prentální dg. v té době nebyl možná. Riziko 25% umožňovlo rodičům požádt o ukončení těhotenství ze zdrvotních (genetických) důvodů. Screening po nrození dítěte by odhlil onemocnění, dietní optření by umožnil reltivně příznivý vývoj

10 Úkol č. 2, str. 95, PKU (incidence /0000) / /3 2/3 /2 /2 /50 x ½ x 2/3 x ½ = 2/600 = /300 q 2 = /0000 q = /00 2pq = 2 x 99/00 x /00 = /50 Riziko postižení nízké, zátěžové testy v přípdě PKU málo přesné, lze doporučit DN nlýzu. Je nutné mít dosttek čsu n provedení vyšetření DN v obou rodinách!! Jink není možné přistoupit k prentální dg.

11 Úkol č. 2b-, str. 95, PKU (incidence /0000) / /3 2/3 /2 /50 x ½ x = /00 q 2 = /0000 q = /00 2pq = 2 x 99/00 x /00 = /50

12 Úkol č. 2b-2, str. 95, PKU (incidence /0000) / /3 2/3 /2 /2 /50 x ½ x 2/3 x ½ = 2/600 = /300 q 2 = /0000 q = /00 2pq = 2 x 99/00 x /00 = /50

13 Úkol č. 3, str. 96, PKU ) NO, rodin je informtivní z hledisk genotypu dětí. b) ntrgenová sond, dcer tedy JE heterozygotní. c) ntrgenová sond, syn tedy JE dominntní homozygot. d) Jedná se o nepřímou dignostiku, NELZE využít mimo kontext dné rodiny. 5

14 Úkol č. 4, str. 96 Mutovná lel R408W R408W (Sty ) * 08 bp 37 bp Normální lel bp

15 Úkol č. 4, str ? / + + / + + / +

16 Úkol č. 5, str výsledky SSCP pro EXON č GENOTYP? 6mut / + +/ + 6mut / + 6mut / + 6mut / + Mutce v 6. exonu (6mut) +/ + +/ + + / + + / + + / + 9

17 Úkol č. 4c,d, str ? mut / + c) Bylo by lepší znát druhou mutci v rodině snoubenky, kterou musí mít /3 nejspíše i /3. Spojením s nepřímou dignostikou bychom mohli stnovit genotyp nenrozeného potomk snoubenců. Klinický genetik rozhodne, zd v této fázi prentální vyšetření nbídnout snoubencům. d) Pátrání po druhé mutci v rodině snoubenky (ETK - poučený souhls!)

18 Úkol č. 5, str výsledky SSCP pro EXON č GENOTYP? 6mut / + +/ + 6mut / + 6mut / + 6mut / + Mutce v 6. exonu (6mut) +/ + +/ + + / + + / + + / +

19 Úkol č. 5, str b) Biopsie trofoblstu (odběr týden grvidity), mniocyty po týdnu grvidity MOŽNÉ POSTUPY nepřímá DN nlýz (RFLP), po doplnění vyšetření v rodině snoubence, pokud bude informtivní přímá DN nlýz R408W, SSCP 6.exonu kombince obou předchozích bude-li v době grvidity určen 6mut přímá nlýz sekvenování Metodu volí specilist v lbortoři.

20 Úkol č. 5, str Poznámk: Dle součsných pltných právních etických norem: c) Odběr tkáně z účelem izolce vyšetření DN je vázán n poučený souhls pcient. U nezletilých o vyšetření rozhodují zákonní zástupci. d) Od okmžiku, kdy je známo, že snoubenci jsou heterozygotní, je možno n žádost ženy indikovt ukončení grvidity ze zdrvotních (genetických) příčin pro 25% (vysoké) riziko závžné vdy či choroby plodu. Teoreticky ž do 24. týdne grvidity.

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). Orphanet - Volně přístupné webové stránky s informacemi


Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových

Více Prevence vrozených vad z pohledu genetika MUDr. Vladimír Gregor, RNDr. Jiří Horáček odd. lékařské genetiky, Fakultní Thomayerova nemocnice v Praze Genetické poradenství Klinická genetika se zabývá diagnostikou


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Poznámky k nutrigenetice

Poznámky k nutrigenetice Poznámky k nutrigenetice Ondřej Šeda Institut klinické a experimentální medicíny, Praha Ústav biologie a lékařské genetiky 1.LF UK a VFN, Praha Research Centre CHUM, Montreal, Canada Nutrigenetika Jednotlivé


Virtuální svět genetiky 1

Virtuální svět genetiky 1 Chromozomy obshují mnoho genů pokud nejsou rozděleny crossing-overem, pk lely přítomné n mnoh lokusech kždého homologního chromozomu segregují jko jednotk během gmetogeneze. Rekombinntní gmety jsou důsledkem


Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;





Co to je genetický test?

Co to je genetický test? 12 Co to je genetický test? Vytvořeno podle informačních letáků vypracovaných nemocnicemi Guy's a St. Thomas' Hospital, Londýn. Tato práce byla podpořena projektem Eurogentest v rámci Evropského 6. RP;


Genetická diverzita masného skotu v ČR

Genetická diverzita masného skotu v ČR Genetická diverzita masného skotu v ČR Mgr. Jan Říha Výzkumný ústav pro chov skotu, s.r.o. Ing. Irena Vrtková 26. listopadu 2009 Genetická diverzita skotu pojem diverzity Genom skotu 30 chromozomu, genetická


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Downův syndrom. Renata Gaillyová OLG FN Brno

Downův syndrom. Renata Gaillyová OLG FN Brno Downův syndrom Renata Gaillyová OLG FN Brno Zastoupení genetických chorob a vývojových vad podle etiologie 0,6 %-0,7% populace má vrozenou chromosomovou aberaci incidence vážných monogenně podmíněných


Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky


Diagnostika genetických změn u papilárního karcinomu štítné žlázy

Diagnostika genetických změn u papilárního karcinomu štítné žlázy Diagnostika genetických změn u papilárního karcinomu štítné žlázy Vlasta Sýkorová Oddělení molekulární endokrinologie Endokrinologický ústav, Praha Nádory štítné žlázy folikulární buňka parafolikulární


Vrozené chromozomové aberace v České republice v období 1994 2013

Vrozené chromozomové aberace v České republice v období 1994 2013 Vrozené chromozomové aberace v České republice v období 1994 213 Vladimír Gregor 1,2.3, Antonín Šípek 1,2,4, Antonín Šípek jr. 1,5, Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské


Vrozené chromozomové aberace v České republice v období 1994 2013

Vrozené chromozomové aberace v České republice v období 1994 2013 Vrozené chromozomové aberace v České republice v období 1994 213 Vladimír Gregor 1,2.3, Antonín Šípek 1,2,4, Antonín Šípek jr. 1,5, Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské


Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie


Prenatální diagnostika Downova syndromu v ČR. Jsou rozdíly podle věku těhotné?

Prenatální diagnostika Downova syndromu v ČR. Jsou rozdíly podle věku těhotné? Prenatální diagnostika Downova syndromu v ČR. Jsou rozdíly podle věku těhotné? Antonín Šípek*, Vladimír Gregor*, Antonín Šípek jr.**, Ondřej Vencálek*** *Oddělení lékařské genetiky, Thomayerova nemocnice,





Chromosomové změny. Informace pro pacienty a rodiny

Chromosomové změny. Informace pro pacienty a rodiny 12 Databáze pracovišť poskytujících molekulárně genetická vyšetření velmi častých genetických onemocnění v České republice (CZDDNAL) Chromosomové změny Unique - Britská svépomocná skupina


KBI/GENE Mgr. Zbyněk Houdek

KBI/GENE Mgr. Zbyněk Houdek Genealogie KBI/GENE Mgr. Zbyněk Houdek Rodokmenové schéma Shromáždění informací o rodině je 1. důležitým krokem v genetickém poradenství. Rodokmenové schéma musí být srozumitelné a jednoznačné. Poskytuje


Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010

Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem. Milan Bartoš. Forum veterinarium, Brno 2010 Projekt FR-TI2/075 MPO příklad spolupráce farmaceutů s komerčním sektorem Milan Bartoš Forum veterinarium, Brno 2010 Vývoj farmakogenetické diagnostické soupravy pro stanovení genetických polymorfismů


CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder

CADASIL. H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder CADASIL analýza mutací v genu NOTCH3 H. Vlášková, M. Boučková Hnízdová, A. Loužecká, M. Hřebíček, R. Matěj, M. Elleder Ústav dědičných metabolických poruch 1. LF UK a VFN Oddělení patologie a nár. ref.



21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka


Smlouva o příspěvku na provoz školy (dále jen smlouva)

Smlouva o příspěvku na provoz školy (dále jen smlouva) v zstoupení : Ing. Hn Novotná, ředitelk jko strn oprávněná (dále jen oprávněná strn) I.2. studentk student denního studi oboru 23-45-L/005 Mechnik číslicově řízených strojů studentkou - studentem. v zstoupení


Chromosomové translokace

Chromosomové translokace 12 Unique - Britská svépomocná skupina pro vzácné chromosomové vady. Tel: + 44 (0) 1883 330766 Email: www.rarechromo Chromosomové translokace EuroGentest - Volně přístupné webové stránky


Včasná diagnostika (2014 2015)

Včasná diagnostika (2014 2015) Včasná diagnostika (2014 2015) 1 Projekt Včasná diagnostika 2 Projekt vzdělávání studentů Včasná diagnostika (2014 2015) V rámci plnění NAP RD, aktivita č. 4 (Zlepšení screeningu a diagnostiky u VO) ČAVO


ý č Í É Ě Í š Č č ý Ú ť š č ú š ý š ď č č ý Š Š č č Á ý ť ť Í ý ť č Ť É Ě Í š Č Č Ý ť Í ý ý č Ý É Ě Í č š ý ň č ý Í ď Í ú Ě Í č É Ě Í š č č Í ý ý úč č É Ě Í ý č ň š č ý ď ť ť ž ý č č É š Ě Í č š Ě š čď


Smlouva o příspěvku na provoz školy (dále jen smlouva)

Smlouva o příspěvku na provoz školy (dále jen smlouva) bnk. spojení : KB,.s. Brno-město, exp. Kuřim, č.ú. 201203621/0100 v zstoupení : Ing. Hn Novotná, ředitelk jko strn oprávněná I.2. studentk student denního studi oboru 26-41-L/01 Mechnik elektrotechnik


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění


Proč se někdy dělá biopsie choria a jindy amniocentéza?

Proč se někdy dělá biopsie choria a jindy amniocentéza? K čemu slouží biopsie choria? Prenatálně diagnostický test, který detekuje chromozomální abnormlity u plodu. K vyšetření se používají klky, které tvoří tzv. chorion. Z choria se postupem času vytvoří placenta.


Zhoubný novotvar ledviny mimo pánvičku v ČR

Zhoubný novotvar ledviny mimo pánvičku v ČR Aktuální informce Ústvu zdrvotnických informcí sttistiky České repuliky Prh 8.1.2004 1 Zhouný novotvr ledviny mimo pánvičku v ČR Počet hlášených onemocnění zhouným novotvrem ledviny mimo pánvičku (dg.


Časná ultrazvuková diagnostika rozštěpových vad obličeje u plodu

Časná ultrazvuková diagnostika rozštěpových vad obličeje u plodu Časná ultrazvuková diagnostika rozštěpových vad obličeje u plodu MUDr. Vlašín P., MUDr. Pavková Š., Centrum prenatální diagnostiky Brno, Veveří 39, 60200, Brno Vyšetření


Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


Informovaný souhlas s neinvazivním prenatálním testem aneuploidií chromozomů 13, 18 a 21 testem CLARIGO TM

Informovaný souhlas s neinvazivním prenatálním testem aneuploidií chromozomů 13, 18 a 21 testem CLARIGO TM Informovaný souhlas s neinvazivním prenatálním testem aneuploidií chromozomů 13, 18 a 21 testem CLARIGO TM Jméno a příjmení vyšetřovaného:. číslo pojištěnce:. 1. Popis účelu odběru vzorků a genetického


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor

Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor Moto: Nejvyšším štěstím každé rodiny je zdravé dítě Jiří Šantavý, Ishraq Dhaifalah, Vladimír Gregor ČLK, 14. února 2013 Úvod Od poznání možností, které nám nabízí prenatální diagnostika, se embryo či později


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Vrozené chromosomové aberace v ČR v období 1993-2012

Vrozené chromosomové aberace v ČR v období 1993-2012 Vrozené chromosomové aberace v ČR v období 1993-212 Vladimír Gregor 1,2, 3, Antonín Šípek 1,2,4 Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské genetiky, Sanatorium PRONATAL,





Věstník MINISTERSTVA ZDRAVOTNICTVÍ ČESKÉ REPUBLIKY OBSAH: 1. Oznámení o termínu konání zkoušky o odborné způsobilosti k výkonu odborného

Věstník MINISTERSTVA ZDRAVOTNICTVÍ ČESKÉ REPUBLIKY OBSAH: 1. Oznámení o termínu konání zkoušky o odborné způsobilosti k výkonu odborného Věstník Ročník 2009 MINISTERSTVA ZDRAVOTNICTVÍ ČESKÉ REPUBLIKY Částk 3 Vydáno: 20. KVĚTNA 2009 Cen: 101 Kč OBSAH: 1. Oznámení o termínu konání zkoušky o odborné způsobilosti k výkonu odborného dohledu


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající



MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta MENDELOVA ZEMĚDĚLSKÁ A LESNICKÁ UNIVERZITA V BRNĚ Agronomická fakulta Ústav morfologie, fyziologie a genetiky zvířat Určování a ověřování paternity u koní. Bakalářská práce Brno 2006 Vedoucí bakalářské


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649



SMLOUVU O UZAVŘENÍ BUDOUCÍ SMLOUVY KUPNÍ Níže uvedeného dne, měsíce roku uzvřeli: 1. Eret Tomáš, r.č. 711107/1814 bytem: nám. Krále Jiřího z Poděbrd 1/14, 350 02 Cheb 2 jko budoucí prodávjící n strně jedné 2. mnželé xxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxx


Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska

Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska Variabilita heterochromatinové oblasti lidského chromosomu 9 z evolučního a klinického hlediska A. Šípek jr. (1), R. Mihalová (1), A. Panczak (1), L. Hrčková (1), P. Lonský (2), M. Janashia (1), M. Kohoutová


Zeptejte se svého lékaře

Zeptejte se svého lékaře Jednoduchý a bezpečný krevní test, který nabízí vysokou citlivost stanovení Neinvazivní test, který vyhodnocuje riziko onemocnění chromozomálního původu, jako je např. Downův syndrom, a nabízí také možnost


Ó Á Ň Í Ž Č Í Ž ň Ž Ž ú Ž Ž Á Ž Í ú ú ú Í Í ť ť ď Í Í ú Í ď Ž Ř Í ň ď Č Í Č Č ď ď Ž Č ď Ž Ž ď Í Ž ú ď Ó ď ú Í Í ď ď ď ď ň Žď ú ú ť ď ď ď Ž Ž Á ď Ž Í Ž Ž Ž ď Ž Č Ž Ž ú Ž Í ú ň Ž ú ď ň ď Č Č ď ú Č ť Ó Í


ů ů Č ů ů Š ž ů žď ž ž ž žď ů ů ž ů ó Č Ý Š ú Ý Á Š ž ů ž ž ž ů Š ú Ž ů ú ž Ř ó ž ú ž ň ž Á Š ň ď ž ú Ý ť Č Ř ň Š Á Š ž Š Š ž ú Ý ť Ř žď Š ž Á ž Š ů ť ť ů ú Ý Č Ř Ň ť Á ž Š ú Ý ž ž ó ž Ř žď Ň ž ž ň Ť ó


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Příčiny a projevy abnormálního vývoje

Příčiny a projevy abnormálního vývoje Příčiny a projevy abnormálního vývoje Ústav histologie a embryologie 1. LF UK v Praze MUDr. Filip Wagner Předmět: Obecná histologie a obecná embryologie (B02241) 1 Vrozené vývojové vady vývojové poruchy


úč úč ž ů ž Č Č č č ů ž úč č úč ť Ň č ú Ý č č Ú Ú ť ú č ď ů ž š úč ž úč úč ž ť ď ť ď ž ú č č úč š ž Ů č č ú úč ž ů ť úč ž ž ž Ů č ž ú č Š úč č Úč Č Č š ď š Š š Ó Ó ž ůč ú Ď ť ž ů ů č ů Č ů ž úč Ý č ž úč


č ů š ň č č Ú č č č Ú ů Ú č ž ú š š ý č ú ó ó ž č ý ý ý č ž č ý ž ý č ý ž ž č ý ý ý ž ý ý ý ý š ý š ů ů č č ý ž č ý ů š ž ý Ú Ú úč š ů ž ů ů Úč ž č ý č š ý ů č š ý ý ý ů č č ž ů š ů ů š ý ý ů ů č č ž ú


Á Ě Í Ě Á Á ó č ž č ž č Í š úč é úč š ž č é ů č é č é é ů č ů č č ů é Ž š ů ů š č é Ž č é Ž č Í ž Ž Ž é é Ů é Ř ů ť š é é č é é é š č č é č č č č š č š é č é č ů č č š ú é č é š é Ž Ž é é ú č č é ů č š


uzavírají ve smyslu ust. 1746 odst. 2 zákona č. 89/2012 Sb., občanský zákoník tuto DOHODU O JISTOTNÍM ÚČTU,

uzavírají ve smyslu ust. 1746 odst. 2 zákona č. 89/2012 Sb., občanský zákoník tuto DOHODU O JISTOTNÍM ÚČTU, Reg. č. UniCredit Bnk Czech Republic nd Slovki,.s. sídlem Prh 4 Michle, Želetvská 1525/1, PSČ 140 92, IČ 64948242, zpsná v obchodním rejstříku vedeném Městským soudem v Prze, oddíl B, vložk 3608, zstoupená


Genetika dědičných neuropatií

Genetika dědičných neuropatií Genetika dědičných neuropatií P. Seeman Klinika dětské neurologie, DNA laboratoř, UK 2. LF a FN Motol Praha a CMT tým UK 2. LF a FNM CMT - dědičná choroba Známo již od Charcota, Marie a Tootha téměř 130


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika


34. celostátní konference gynekologů zabývajících se ultrazvukovou diagnostikou s mezinárodní účastí, 19.9-21.9.2013, Špindlerův Mlýn

34. celostátní konference gynekologů zabývajících se ultrazvukovou diagnostikou s mezinárodní účastí, 19.9-21.9.2013, Špindlerův Mlýn Vrozené chromosomové aberace v ČR v období 1993 - Vladimír Gregor 1,2, 3, Antonín Šípek 1,2,4 Oddělení lékařské genetiky, Thomayerova nemocnice, Praha 1 Oddělení lékařské genetiky, Sanatorium PRONATAL,


Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice

Doporučený postup č. 3. Genetické laboratorní vyšetření v reprodukční genetice Účinnost k 1. 12. 2014 Doporučený postup č. 3 Genetické laboratorní vyšetření v reprodukční genetice Stav změn: 1. vydání Základním předpokladem genetického laboratorního vyšetření v reprodukční genetice


1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,


Laboratorní vyšetření v těhotenství- screening vrozených vývojových vad RNDr. I. Klabenešová OKB FN BRNO Metodika screeningu Lékařský screening slouží k vyhledávání osob s významným rizikem výskytu určité


Obecná biologie a genetika B53 volitelný předmět pro 4. ročník

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Biologie. Mezipředmětové


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Trombofilie v těhotenství

Trombofilie v těhotenství v těhotenství Doc. MUDr. Antonín Pařízek, CSc. 24. dubna 2013, Praha Gynekologicko - porodnická klinika 1. LF UK a VFN v Praze = zvýšená dispozice pro trombózu (TEN) Na jejím vzniku se podílí vlivy: 1.


Vladana Skutilová, OLG FN Hradec Králové

Vladana Skutilová, OLG FN Hradec Králové Vladana Skutilová, OLG FN Hradec Králové Proč KBT v genetickém poradenství? skloubení medicínského a psychoterapeutického pohledu těhotenství obecně radostná doba, ve skutečnosti řada vyšetření přinášejících


1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013

Lékařská genetika a onkologie. Renata Gaillyová OLG a LF MU Brno 2012/2013 Lékařská genetika a onkologie Renata Gaillyová OLG a LF MU Brno 2012/2013 *genetické souvislosti *onkogenetická vyšetření u onkologických onemocnění * genetické vyšetření u hereditárních nádorů *presymptomatické


GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D.

GENETICKÉ PORADENSTVÍ. u pacientů s epidermolysis bullosa congenita. MUDr. Renata Gaillyová, Ph.D. GENETICKÉ PORADENSTVÍ u pacientů s epidermolysis bullosa congenita MUDr. Renata Gaillyová, Ph.D. Homozygot jedinec, který zdědil po rodičích tutéž alelu. Jedinec nebo genotyp s identickými alelami v daném


Podmínky externí spolupráce

Podmínky externí spolupráce Podmínky externí spolupráce mezi tlumočnicko překldtelskou genturou Grbmüller Jzykový servis předstvující sdružení dvou fyzických osob podniktelů: Mrek Grbmüller, IČO: 14901820, DIČ: CZ6512231154, místo


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc

Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie a myelodysplastický syndrom Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie (AL) Představují heterogenní skupinu chorob charakterizovaných kumulací klonu nevyzrálých, nádorově


NEWSLETTER. obsah. Preimplantační genetická diagnostika nová metoda screeningu 24 chromozomů metodou Array CGH...2

NEWSLETTER. obsah. Preimplantační genetická diagnostika nová metoda screeningu 24 chromozomů metodou Array CGH...2 Srpen 2012 8 obsah Preimplantační genetická diagnostika nová metoda screeningu 24 chromozomů metodou Array CGH...2 Zachování fertility nové možnosti v GENNETu...3 Hysteroskopie bez nutnosti celkové anestezie...4


Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů

Imunogenetika imunologie. imunity imunitních reakcí antigenů protilátek. imunogenetika. erytrocytárních antigenů histokompatibilitních antigenů Imunogenetika Vědní odvětví zabývající se imunitním systémem obratlovců, který je výrazně odlišuje od nižších organizmů se nazývá imunologie. Její náplní je zejména studium imunity mechanizmů stálosti


Současný stav prenatální diagnostiky MUDr. Marie Švarcová

Současný stav prenatální diagnostiky MUDr. Marie Švarcová Současný stav prenatální diagnostiky MUDr. Marie Švarcová 2014 2 Prenatální diagnostika GYNEKOLOGIE BIOCHEMIE USG 3 Základní reprodukční rizika Riziko, že manželství bude neplodné: 1:15 Riziko, že dítě


Datamining a AA (Above Average) kvantifikátor

Datamining a AA (Above Average) kvantifikátor Dtmining AA (Above Averge) kvntifikátor Jn Burin Lbortory of Intelligent Systems, Fculty of Informtics nd Sttistics, University of Economics, W. Churchill Sq. 4, 13067 Prgue, Czech Republic,


obsah Úvodník ředitele...2 Akademický rok začíná...3 Ústavu biologie a lékařské genetiky 1. LF UK a VFN...7

obsah Úvodník ředitele...2 Akademický rok začíná...3 Ústavu biologie a lékařské genetiky 1. LF UK a VFN...7 obsah Úvodník ředitele...2 Akademický rok začíná...3 Ústav biochemie a lékařské genetiky 1. LF UK a VFN...4 Možnosti genetického vyšetření na oddělení lékařské genetiky. Ústavu biologie a lékařské genetiky


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


55/2011 Sb. VYHLÁŠKA. ze dne 1. března 2011. o činnostech zdravotnických pracovníků a jiných odborných pracovníků

55/2011 Sb. VYHLÁŠKA. ze dne 1. března 2011. o činnostech zdravotnických pracovníků a jiných odborných pracovníků 55/2011 Sb. VYHLÁŠKA ze dne 1. březn 2011 o činnostech zdrvotnických prcovníků jiných odborných prcovníků Ministerstvo zdrvotnictví stnoví podle 90 odst. 2 písm. e) zákon č. 96/2004 Sb., o podmínkách získávání


ý úř ý ř ř ř š ř ř ř ú ý ů ý ů ř úř ř š ř ř ý Ť ř ř ř š ú ú ř ř ř ř Ů Ů ž ý ý ř ů ý ž ž ů ý ú ž ý ž ý ř ů ř ř ý ť š ř ý ÚČ ř ů ů ů ů ý ů ů ť ů ř ú ž ř ú ď ň ř ý ů ý ý ý ý ř Ť ý ř ú ú ú ř ř ř ř Ž ý š ř


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Stanovení pohlaví plodu z fetální DNA volně kolující v krvi matky

Stanovení pohlaví plodu z fetální DNA volně kolující v krvi matky Stanovení pohlaví plodu z fetální DNA volně kolující v krvi matky Na základě nedávného objevu volné cirkulující DNA v mateřské krvi je možné stanovit pohlaví plodu (bez nutnosti odběru plodové vody či



EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence


Metodická příručka pro žadatele o příspěvky na vybrané myslivecké činnosti

Metodická příručka pro žadatele o příspěvky na vybrané myslivecké činnosti Metodická příručk pro ždtele o příspěvky n vyrné myslivecké činnosti Prvidl poskytování finnčních příspěvků n vyrné činnosti mysliveckého hospodření v roce 04 způsou kontroly jejich využití dle Nřízení


Výzva k podání nabídky a k prokázání kvalifikace pro VZ malého rozsahu

Výzva k podání nabídky a k prokázání kvalifikace pro VZ malého rozsahu Výzv k podání nbídky k prokázání kvlifikce pro VZ mlého rozshu Název veřejné zkázky: Servisní podpor NN zřízení LNS Brno Identifikce zdvtele: Zdvtel: Řízení letového provozu České republiky, s.p. Se sídlem:


UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Vývojové vady a ortopedie. studijní opora pro kombinovanou formu studia

UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu. Vývojové vady a ortopedie. studijní opora pro kombinovanou formu studia UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vývojové vady a ortopedie studijní opora pro kombinovanou formu studia Tělesná výchova a sport zdravotně postižených Doc.MUDr.Eva Kohlíková,


Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni

Hemofilie. Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Hemofilie Alena Štambachová, Jitka Šlechtová hematologický úsek ÚKBH FN v Plzni Definice hemofilie Nevyléčitelná vrozená krvácivá choroba s nedostatkem plazmatických faktorů FVIII hemofile A FIX hemofile


Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci


Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený


Duchenneova/Beckerova svalová dystrofie a Parent Project

Duchenneova/Beckerova svalová dystrofie a Parent Project Duchenneova/Beckerova svalová dystrofie a Parent Project Oddělení lékařské genetiky FN Brno Renata Gaillyová Vzácné nemoci V EU se nemoc považuje za vzácnou, jestliže postihuje méně než 5 osob z každých
