TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

Rozměr: px
Začít zobrazení ze stránky:

Download "TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce"

Transkript

1 TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Přehled Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymerasa Princip procesu PCR Optimalizace PCR Typy PCR Aplikace PCR a využití v praxi

2 Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dgmp) Koncept párování bazí je striktně konzervativní Cytosine Guanine From Dr. John C. Perez, Professor and Director of the Natural Toxins Research Initiative, Texas A&M

3 Deoxyribosa a fosfát dávají DNA řetězci směr 5 end 3 end konce dsdna nejsou stejné T A HO jednotlivé řetězce duplexu jsou k sobě komplementární 3 2 G C DNA rětězce duplexu mohou být denaturována a znovu spojena T A G C OH 3 end 5 end T m (melting temperature) je teplota při kteréje dsdna z poloviny denaturována Tm je závislá na: složení bazí rozpouštědle iontové síle ph délce DNA Singer, M., and P. Berg Genes and Genomes. University Science Books, Mill Valley, CA. p. 49

4 DNA replikace in vivo vyžaduje několik enzymů separace řetězců syntéza krátkých RNA primerů syntéza dvou nových DNA helixů podílí se enzymy: DNA primasa helikasa DNA polymerasa DNA ligasa SSB-proteiny Vlastnosti DNA polymerasy 1. POLYMERASOVÁ AKTIVITA Replikace probíhá vždy ve směru od 5 na 3 konec Nový nukleotid je přidáván tedy vždy na 3 OH konec. 2. 3'-5' exonukleasová aktivita -opravná funkce proofreading 3. 5 exonukleasová aktivita - odštěpuje RNA primer

5 DNA replikace in vitro vyžaduje pouze jeden enzym DNA Polymerasa 1957 Arthur Kornberg dokázal existenci DNA polymerasy - DNA polymerase I in vitro polymerasa vyžaduje pouze: 4 deoxynukleotidy trifosfáty dsdna templát primer - ssdna nebo RNA s volnou 3'-OH Syntéza obou řetězců specifické dsdna in vitro 5 3 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3 5 Forward primer dntps 5 3 TTGAGAAAGGAATAAGC DNA POL AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3 5

6 Syntéza obou řetězců specifické dsdna in vitro 5 3 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC DNA POL TCTTTAGCTCATATACG 3 5 dntps Reverse primer 5 3 GCATATACTCGATTTCT 5 3 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3 5 PCR: Co to je? Polymerase Chain Reaction: znamená amplifikace (mnohonásobná replikace) relativně krátkých úseků specifické DNA Základní nástroj molekulární biologie se vzrůstájícím významem i v dalších oborech (botanika, kriminalistika) The idea Ghobind Khorana 1971 Kary Mullis 1983 Nobelova cena 1993 poprvé provedená mnohonásobná in vitro replikacevezkumavce

7 Jak funguje PCR Řetězová reakce vychází z DNA replikace Spočívá v opakování cyklů denaturace (separace dsdna), navázání primerů a elongace primerů (syntéza nového vlákna DNA) pomocí změn teploty potřeba silného enzymu (polymerasy) který je schopen pracovat při vysokých teplotách termofilní organismy objeveny začátkem 70tých let Jak funguje PCR Polymerasa izolovaná z termofilní baktérie (Thermus aquaticus, Pyrococcus furiosus) zkr. TAQ, PFU Polymerasa až s objevem a použitím TERMOSTABILNÍ POLYMERASY získala PCR na významu

8 PCR komponenty Templátová DNA vzorek k amplifikaci Primery krátké specifické úseky DNA zaručující specifitu amplifikace datp, dttp, dctp, dgtp volné stavební jednotky DNA Thermostabilní DNA polymerasa (e.g., Taq, Pfu) Pufr a soli (KCl, MgCl2) Proces PCR Velký nadbytek primeru, dntps a Taq POL k DNA templátu

9 Problémy: PCR je velmi citlivá na kontaminace Častý problém - nespecifická amplifikace Polymerasa pracuje i při nízkých teplotách (e.g., během nastavování reakce) Hot start PCR je řešení (protilátka proti Taq) Amplifikace je často možná i pro ne zcela známou sekvenci primerů např. DNA jiného biologického druhu Degenerované primery (multiple verze s různými bázemi v klíčové pozici (tryptofan + methionin): stupeň degenerace: prettyfly protein má kód degenerovaný na 11 pozicích tzn. (4)(2)(4)(2)(4)(4)(2)(2)(2)(4)(2) = krát P R E T T Y F L Y CCA CGA GAA ACA ACA TAC TTC CTA TAC G G G G G T T G T C C C C C T T T T T A T Touchdown PCR s vyšší přesností v prvních cyklech Maximální velikost produktu +/-5000 bazí pro standardní PCR: Long PCR kits mohou amplifikovat až 35 kbazí Navrhování primerů Primery by měly být bazí dlouhé Nutná znalost alespoň části sekvence amplifikované DNA 3 konec primeru je důležitý: vhodné aby zde byla G nebo C báze Procentuální zastoupení G + C by mělo být 50-60% - ovlivňuje Tm (teplota kdy se váže primer na templát) Primery v jedné reakci by měli mít srovnatelné Tm Vyvarovat se repetitivním sekvencím Tm = (G+C)x4 + (A+T)x2 Vyvarovat se komplementaritě uvnitř čimeziprimery degenerované primery max. 20 bp ideální do degenerace 250x

10 Navrhování primerů Příklad navržení primerů: Konvence: DNA se vždy zapisuje ve směru od 5 ku 3 konci Cílová sekvence: (priming místo podtrženo): 5 TATAAGCCATAACGATATTGCTGAGTCAAGTCCACATATC ATATGGATGAGAAATGCTTGTGGAGCTGATGTTGATTTGG AGAGACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AAACCAGTTAAAGAGTGTGCCAGTAGAG 3 Forward Primer: 5 ATG GAT GAG AAA TGC TTG TG 3 Reverse Primer: 5 ACT GGC ACA CTC TTT AAC TGG 3 Praktické provedení PCR objem v mikrozkumavce: ųl složení: Templátová DNA ng Primery pmols 10mM Tris-CL ph 9.0, 50 mm KCl MgCl mm 50 ųm každého nukleotidu datp, dgtp, dttp, dctp 2 jednotky Taq polymerasy

11 Praktické provedení PCR Počáteční denaturace 94 o C 3-5 min denaturace 94 o C 30 sec annealing ~55 o C 30 sec prodlužování 72 o C 1min/kilobáze počet cyklů x Praktické provedení PCR agarozová elektroforéza

12 Praktické provedení PCR PCR se provádí v termocyklerech kovový blok z ušlechtilého kovu snadné programování vyhřívané víko PCR Optimalizace Složka AnnealingTeplota - Tm Nízká specificita Vysoká specificita MgCl 2 KCl Enzym, Primer ph Formamid nespecificky látky ovlivňující kvalitu PCR: formamid, DMSO, betain atd. Nespecifická amplifikace

13 Základní typy PCR RT PCR (reverse transcriptase PCR) vlastní PCR předchází syntéza cdna z mrna pomocí RT jako primer slouží GSP (gene specific primer) oligo dt random hexamer primer hledání nových genů tvorba cdna knihoven hledání mutací zjišťování síly exprese různých genů RACE PCR (rapid amplification of cdna ends) vychází z RT-PCR používá se k hledání celé sekvence nového genu nutná alespoň částečná znalost sekvence hledaného genu vhodné pro klonování genů a jeho následnou funkční expresi (GMO)

14 inverzní PCR Amplifikace neznámých segmentů DNA asymetrická PCR sekvenace DNA, příprava hybridizačních sond amplifikuje pouze jeden řetězec dsdna SEKVENCOVÁNÍ DNA SEKVENCOVÁNÍ DNA automatické sekvenátory využívající asymetrické PCR jednozkumavková reakce PCR s jedním primerem a dideoxyribonukleotidy (ddatp, ddgtp, ddctp, ddttp) dideoxyribonukleotidy značené 4 fluorescenčními markery velice citlivé elektroforetické rozdělení v kapiláře fluorometr s automatickým vyhodnocením

15 multiplex PCR více amplifikací v jedné zkumavce lékařská diagnostika nested PCR 2 po sobě jdoucí PCR zvyšování specificity PCR LA-PCR (long and accurate) amplifikace dlouhých úseků, polymerasové kokteily např. Taq + Pfu polymerasa (180:1) Pwo polymerasa z Pyroccocus woesei DeepVent polymerasa z Termococcus litoralis (hlubokomořská baktérie) DNA polymeráza 5-3 exonukleázová aktivita 3-5 exonukleázová aktivita délka produktu frekvence chyby Taq + 3 kb 10-4 Pfu + 3 kb 1.3 x 10-6 Pwo + 3 kb 3.3 x 10-6 DeepVent + 12 kb 3.0 x 10-5 long PCR koktejl kb 2.0 x 10-6 PROCESIVITA: jak dlouho se enzym udrží na vlákně STABILITA: kolik minut při denaturační teplotě např Taq 9 min při 97.5 C Pwo 2 hod při 100 C DeepVent 8hod při 100 C

16 in situ RT PCR lokalizace translace a exprese genů real time PCR slouží k přesné kvantifikaci amplifikovaného produktu využití fluorescence interkalačních barviv (etbr) fluorimetr je součástí termocykleru main.cfm##

17 Využití REAL TIME PCR pro detekci jednobodové mutace (lékařská diagnostika) Aplikace PCR a využití v praxi

18 Aplikace PCR a využití v praxi DIAGNOSTIKA V MEDICÍNĚ 1. detekce virových a bakteriálních onemocnění Aplikace PCR a využití v praxi DIAGNOSTIKA V MEDICÍNĚ 2. detekce geneticky vrozených chorob (mutace DNA) - AS PCR alelicky specifická PCR primer navržen tak, že mutace odpovídá konci primeru fragmenty DNA s nespárovanými konci se pohybují v elektrickém poli pomaleji - Real time PCR pomocí fluorescenční sondy odpovídající mutaci Např. detekce cystické fibrózy, choroba je podmíněná třínukleotidovou delecí v genu CFTR cystic fibrosis transmembrane regulator

19 Aplikace PCR a využití v praxi KRIMINALISTIKA VNRT variable number of tandem repeat vyskytují se na různých lokusech chromozomů a v populací kolísají mezi jedinci v počtu opakování mezi 4-40x např. GTGTGTGT Aplikace PCR a využití v praxi ANALÝZA POTRAVIN molekulárně-genetické zhodnocení surovin živočišného a rostlinného původu, které byly vyprodukovány klasickým pěstováním (chovem) nebo s použitím genového inženýrství průkaz falšování potravin druhovou záměnou (rostlinného i živočišného původu) identifikace mikroorganismů kontaminující potraviny nebo geneticky změněných mikroorganismů používaných jako startovací nebo ochranné kultury v produkci potravin. EVOLUČNÍ BIOLOGIE ORNITOLOGIE skot ovce prase koza TEST

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dgmp) Koncept párování bazí je striktně konzervativní Cytosine

Více

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR)

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION VYUŽITÍ AUTOMATICKÉHO SEKVENOVÁNÍ DNA PRO DETEKCI POLYMORFISMŮ KANDIDÁTNÍCH GENŮ U PRASAT Vykoukalová Z., Knoll A.,

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin

Více

UNIVERZITA KARLOVA V PRAZE Přírodovědecká fakulta. Studijní program: Biologie. Katedra antropologie a genetiky člověka.

UNIVERZITA KARLOVA V PRAZE Přírodovědecká fakulta. Studijní program: Biologie. Katedra antropologie a genetiky člověka. UNIVERZITA KARLOVA V PRAZE Přírodovědecká fakulta Studijní program: Biologie Katedra antropologie a genetiky člověka Lenka Dvořáková Využití metod PCR ve forenzní genetické analýze Use of PCR in forensic

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902

Více

Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin

Více

Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace

Více

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce

Více

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace

Více

REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK

REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK Molekulární základy dědičnosti - rozšiřující učivo REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK REPLIKACE deoxyribonukleové kyseliny (zdvojení DNA) je děj, při kterém se tvoří z jedné dvoušoubovice DNA dvě nová

Více

MODERNÍ BIOFYZIKÁLNÍ METODY:

MODERNÍ BIOFYZIKÁLNÍ METODY: MODERNÍ BIOFYZIKÁLNÍ METODY: POKROČILÉ PRAKTICKÉ VZDĚLÁVÁNÍ V EXPERIMENTÁLNÍ BIOLOGII Operační program Vzdělávání pro konkurenceschopnost Číslo projektu: CZ.1.07/2.3.00/09.0046 Praktický kurz pokročilých

Více

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)

Více

DY D NE N X Hana Vlastníková

DY D NE N X Hana Vlastníková DYNEX Hana Vlastníková Molekulární biologie: Vybavení laboratoře na klíč Přístrojová technika Kompatibilní diagnostické soupravy Profesionální přístup SOP Technická podpora Servis Přístrojové vybavení:

Více

Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

PP Master Mixy... 13 PPP Master Mix 14 Plain PP Master Mix 15 Combi PPP Master Mix 16 new Plain Combi PP Master Mix 17

PP Master Mixy... 13 PPP Master Mix 14 Plain PP Master Mix 15 Combi PPP Master Mix 16 new Plain Combi PP Master Mix 17 Obsah DNA polymerázy pro PCR a pufry............................... 5 Taq DNA polymeráza 6 Taq DNA polymeráza Unis 7 TaqPurple DNA polymeráza 8 Taq DNA polymeráza 1.1 9 Combi Taq DNA polymeráza 10 LA DNA

Více

Univerzita Palackého v Olomouci. Bakalářská práce

Univerzita Palackého v Olomouci. Bakalářská práce Univerzita Palackého v Olomouci Bakalářská práce Olomouc 2012 Eliška Růžičková Univerzita Palackého v Olomouci Přírodovědecká fakulta Katedra buněčné biologie a genetiky Real-time PCR a jeho využití pro

Více

TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně

Více

Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Laboratorní přístrojová technika

Laboratorní přístrojová technika Laboratorní přístrojová technika Co najdeme v laboratoři? Přístroje pro obecné použití centrifugy, třepačky, pipety, biohazard boxy Trocha teorie o DNA a PCR Analytické přístroje a příprava vzorků elektroforézy

Více

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková Metody detekce a identifikace MO se zaměřením na PCR a její variace Kamila Zdeňková Metody detekce a identifikace MO rozdělení metod pro mikrobiologické zkoušení potravin přehled rychlých metod detekce

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava

Více

Alelov specifická PCR

Alelov specifická PCR Pímá analýza muací jedné známé muace (SNP polymorfismy) MOLEKULÁRNÍ DIAGNOSTIKA PÍMOU ANALÝZOU Marin Beránek Pednáka pro magisry a UK PCR RLP viz pedelý seminá ARMS (ASA) Real-ime PCR viz aké pednáka dr

Více

Havarijní plán PřF UP

Havarijní plán PřF UP Havarijní plán PřF UP v němž se nakládá s geneticky modifikovanými organismy (GMO), zpracovaný podle 20, odst. 4 zákona č. 78/2004 Sb. pro pracoviště kateder Buněčné biologie a genetiky a Oddělení molekulární

Více

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování

Více

Diagnostické metody v analýze potravin. Matej Pospiech, FVHE Brno

Diagnostické metody v analýze potravin. Matej Pospiech, FVHE Brno Diagnostické metody v analýze potravin Matej Pospiech, FVHE Brno Důvody diagnostiky potravin Dodržování legislativních požadavků Vlastní kontrola v provozu Národní legislativa Evropská a mezinárodní legislativa

Více

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Kamila Zdeňková Transgenní rostliny, tj. takové rostliny, do jejichž dědičného základu byly metodami genového inženýrství

Více

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp.

Biofyzikální ústav AV ČR, Laboratoř molekulární epigenetiky, Královopolská 135, 612 65 Brno, tel.: 541 517 230, e-mail: matyasek@ibp. BIOLOGICKÉ LISTY 68 (3): 207-211, 2003 Způsoby detekce polymorfismu homologních DNA a jejich využití při studiu změn ve struktuře rodičovských genomů u modelových allotetraploidních druhů rodu Nicotiana

Více

Metody studia genové exprese

Metody studia genové exprese Metody studia genové exprese Ing. Lucie Němcová, Ph.D. Laboratoř vývojové biologie nemcova@iapg.cas.cz Transkriptom Genová exprese: Geny jsou exprimovány tehdy, jsou-li přepsány do RNA (mrna). Rozdílná

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

VYSOKÉ UČENÍ TECHNICKÉ V BRNĚ BRNO UNIVERSITY OF TECHNOLOGY

VYSOKÉ UČENÍ TECHNICKÉ V BRNĚ BRNO UNIVERSITY OF TECHNOLOGY VYSOKÉ UČENÍ TECHNICKÉ V BRNĚ BRNO UNIVERSITY OF TECHNOLOGY FAKULTA CHEMICKÁ ÚSTAV CHEMIE POTRAVIN A BIOTECHNOLOGIÍ FACULTY OF CHEMISTRY INSTITUTE OF FOOD SCIENCE AND BIOTECHNOLOGYOGY IZOLACE DNA V KVALITĚ

Více

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová,

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová, Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová, METODIKA DETEKCE GENETICKY MODIFIKOVANÉHO TABÁKU VIRŽINSKÉHO (Nicotina tabacum L. cv. Samsun) S VNESENÝM KVASINKOVÝM MITOTICKÝM AKTIVÁTOREM (gen SpCdc25 z

Více

Jan Hodek, Jaroslava Ovesná, Lucie Pavlátová. METODIKA DETEKCE GENETICKY MODIFIKOVANÉ PAPÁJI LINIÍ 55-1 a 63-1 METODIKA PRO PRAXI

Jan Hodek, Jaroslava Ovesná, Lucie Pavlátová. METODIKA DETEKCE GENETICKY MODIFIKOVANÉ PAPÁJI LINIÍ 55-1 a 63-1 METODIKA PRO PRAXI Jan Hodek, Jaroslava Ovesná, Lucie Pavlátová METODIKA DETEKCE GENETICKY MODIFIKOVANÉ PAPÁJI LINIÍ 55-1 a 63-1 METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2008 Metodika byla vypracována pracovníky

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů

Více

5. Sekvenování, přečtení genetické informace, éra genomiky.

5. Sekvenování, přečtení genetické informace, éra genomiky. 5. Sekvenování, přečtení genetické informace, éra genomiky. Minulá přednáška nastínila zrod molekulární biologie a představila některé možnosti, jak pracovat s DNA - jak ji analyzovat na základě velikosti

Více

Schéma průběhu transkripce

Schéma průběhu transkripce Molekulární základy genetiky PROTEOSYNTÉZA A GENETICKÝ KÓD Proteosyntéza je složitý proces tvorby bílkovin, který zahrnuje proces přepisu genetické informace z DNA do kratšího zápisu v informační mrna

Více

Metody molekulární biologie v rostlinné ekologii a systematice

Metody molekulární biologie v rostlinné ekologii a systematice Protokoly a návody pro praktikum Metody molekulární biologie v rostlinné ekologii a systematice Laboratoř molekulární biologie rostlin, PřF JCU, Branišovská 31, České Budějovice 2008, Miroslava Herbstová,

Více

ZÁKLADNÍ PRINCIPY A VYUŽITÍ KVANTITATIVNÍ PCR S OHLEDEM NA ONKOLOGICKOU DIAGNOSTIKU

ZÁKLADNÍ PRINCIPY A VYUŽITÍ KVANTITATIVNÍ PCR S OHLEDEM NA ONKOLOGICKOU DIAGNOSTIKU Masarykova univerzita v Brně Přírodovědecká fakulta Katedra Biochemie ZÁKLADNÍ PRINCIPY A VYUŽITÍ KVANTITATIVNÍ PCR S OHLEDEM NA ONKOLOGICKOU DIAGNOSTIKU Bakalářská práce Magdaléna Dvořáková Brno 2007

Více

Centrální dogma molekulární biologie

Centrální dogma molekulární biologie řípravný kurz LF MU 2011/12 Centrální dogma molekulární biologie Nukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Mendel) 1869 objev nukleových kyselin (Miescher) 1944 genetická informace v nukleových

Více

Microfluidic systems, advantages and applications Monika Kremplová, Mgr.

Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Název: Školitel: Microfluidic systems, advantages and applications Monika Kremplová, Mgr. Datum: 21. 6. 2013 Reg.č.projektu: CZ.1.07/2.3.00/20.0148 Název projektu: Mezinárodní spolupráce v oblasti "in

Více

Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219.

Vzdělávací materiál. vytvořený v projektu OP VK CZ.1.07/1.5.00/34.0211. Anotace. Biosyntéza nukleových kyselin. VY_32_INOVACE_Ch0219. Vzdělávací materiál vytvořený v projektu OP VK Název školy: Gymnázium, Zábřeh, náměstí Osvobození 20 Číslo projektu: Název projektu: Číslo a název klíčové aktivity: CZ.1.07/1.5.00/34.0211 Zlepšení podmínek

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Využití metod molekulární biologie při zkoumání kvality potravin. Michaela Hlobilová

Využití metod molekulární biologie při zkoumání kvality potravin. Michaela Hlobilová Využití metod molekulární biologie při zkoumání kvality potravin Michaela Hlobilová Bakalářská práce 2007 ABSTRAKT Tato bakalářská práce, zpracována rešeršní formou, poskytuje přehled o metodách molekulární

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace Genetické markery Genetické markery

Více

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod.

DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. Od 1.1.2014 DYNEX jediným OFICIÁLNÍM (autorizovaným) distributorem společnosti

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie

Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie Izolace genomové DNA ze savčích buněk, stanovení koncentrace DNA pomocí absorpční spektrofotometrie IZOLACE GENOMOVÉ DNA Deoxyribonukleová kyselina (DNA) představuje základní genetický materiál většiny

Více

Věda v prostoru. Voda v pohybu. Buněční detektivové. Svědkové dávné minulosti Země

Věda v prostoru. Voda v pohybu. Buněční detektivové. Svědkové dávné minulosti Země 6+ Věda v prostoru Jak vědci pracují v laboratoři? Proč je zelená víc než jen obyčejná barva? Jak můžeme použít prášek do pečiva ke sfouknutí svíčky? Získejte odpovědi na všechny otázky v tomto vzrušujícím

Více

ANOTACE vytvořených/inovovaných materiálů

ANOTACE vytvořených/inovovaných materiálů ANOTACE vytvořených/inovovaných materiálů Číslo projektu Číslo a název šablony klíčové aktivity Tematická oblast Formát Druh učebního materiálu Druh interaktivity CZ.1.07/1.5.00/34.0722 III/2 Inovace a

Více

Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie

Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie Centrální dogma molekulární biologie ukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Transkripce D R Translace rotein Mendel) Replikace 1869 objev nukleových kyselin (Miescher) 1944 nukleové kyseliny

Více

Kde se NK vyskytují?

Kde se NK vyskytují? ukleové kyseliny Kde se K vyskytují? Struktura ukleotid H 2 - H báze Zbytek kyseliny fosforečné H Cukerná složka H H H H H H H H H H H ribosa β-d-ribofuranosa H H H H H H H H H H deoxyribosa 2-deoxy-β-D-ribofuranosa

Více

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení

Více

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob PGD preimplantační genetická diagnostika zahrnuje soubor technik, které se používají pro zjištění

Více

NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin:

NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin: NUKLEOVÉ KYSELINY Deoxyribonukleová kyselina (DNA, odvozeno z anglického názvu deoxyribonucleic acid) Ribonukleová kyselina (RNA, odvozeno z anglického názvu ribonucleic acid) Definice a zařazení: Nukleové

Více

Elektroforéza Sekvenování

Elektroforéza Sekvenování Elektroforéza Sekvenování Výsledek PCR Elektroforéza V molekulární biologii se používá k separaci nukleových kyselin a bílkovin Principem je pohyb nabitých molekul v elektrickém poli Gelová, polyakrylamidová

Více

Využití metagenomiky při hodnocení sanace chlorovaných ethylenů in situ Výsledky pilotních testů

Využití metagenomiky při hodnocení sanace chlorovaných ethylenů in situ Výsledky pilotních testů Využití metagenomiky při hodnocení sanace chlorovaných ethylenů in situ Výsledky pilotních testů Stavělová M.,* Macháčková J.*, Rídl J.,** Pačes J.** * Earth Tech CZ, s.r.o ** ÚMG AV ČR PROČ METAGENOMIKA?

Více

6. Nukleové kyseliny

6. Nukleové kyseliny 6. ukleové kyseliny ukleové kyseliny jsou spolu s proteiny základní a nezbytnou složkou živé hmoty. lavní jejich funkce je uchování genetické informace a její přenos do dceřinné buňky. ukleové kyseliny

Více

Mikrobiologické diagnostické metody. MUDr. Pavel Čermák, CSc.

Mikrobiologické diagnostické metody. MUDr. Pavel Čermák, CSc. Mikrobiologické diagnostické metody MUDr. Pavel Čermák, CSc. Princip identifikace soubor ZNAKŮ s rozdílnou separační hodnotou S HODNOTA S: S 1 S 2 S 3 Základní problémy Minimum morfologických znaků Podobná

Více

1. ÚVOD A PROBLEMATIKA

1. ÚVOD A PROBLEMATIKA 1. ÚVOD A PROBLEMATIKA 1.1. CYTOCHROMY P450 Cytochromy P450 (CYP) jsou biotransformační enzymy odpovědné za detoxikaci a eliminaci organických cizorodých látek (xenobiotik). Jsou zahrnuty v oxidativním

Více

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK Richard Prùša Richard Prùša Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK . Základy analytických metod v klinické molekulární biologii Richard Prùša Praha 1997 Základy analytických metod

Více

Detekce živých a mrtvých buněk

Detekce živých a mrtvých buněk UNIVERZITA PARDUBICE FAKULTA CHEMICKO-TECHNOLOGICKÁ Detekce živých a mrtvých buněk Markéta Kovárníková Bakalářská práce 2012 Prohlašuji: Tuto práci jsem vypracovala samostatně. Veškeré literární prameny

Více

Identifikace mikroorganismů pomocí sekvence jejich genu pro 16S rrna

Identifikace mikroorganismů pomocí sekvence jejich genu pro 16S rrna Praktická úloha Identifikace mikroorganismů pomocí sekvence jejich genu pro 16S rrna Pro spolehlivou identifikaci mikroorganismů pomocí genetických metod se velmi často využívá stanovení nukleotidové sekvence

Více

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Dle čl. 7 odst. 2 Směrnice děkana pro realizaci bakalářských

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Studijní materiály pro bioinformatickou část ViBuChu. úloha II. Jan Komárek, Gabriel Demo

Studijní materiály pro bioinformatickou část ViBuChu. úloha II. Jan Komárek, Gabriel Demo Studijní materiály pro bioinformatickou část ViBuChu úloha II Jan Komárek, Gabriel Demo Adenin Struktura DNA Thymin 5 konec 3 konec DNA tvořena dvěmi řetězci orientovanými antiparalelně (liší se orientací

Více

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci

Více

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00

Více

BioArray Molecular. Graham Smallridge, Immucor Prague November 2013

BioArray Molecular. Graham Smallridge, Immucor Prague November 2013 BioArray Molecular Immunohaematology Graham Smallridge, Immucor Prague November 2013 1 BioArray Solutions BioArray Solutions Ltd. Bylo založeno ve městě Warren, New Jersey, (USA) v roce 1997 skupinou vědeckých

Více

Základy biochemie KBC/BCH. Nukleové kyseliny. Inovace studia biochemie prostřednictvím e-learningu CZ.04.1.03/3.2.15.3/0407

Základy biochemie KBC/BCH. Nukleové kyseliny. Inovace studia biochemie prostřednictvím e-learningu CZ.04.1.03/3.2.15.3/0407 Základy biochemie KBC/BC Nukleové kyseliny Inovace studia biochemie prostřednictvím e-learningu CZ.04.1.03/3.2.15.3/0407 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem

Více

Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI

Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI Výborný přístroj, výborné výsledky Fragmentační analyzátor je automatizovaný kapilárový systém s CE značkou

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská

Více

Molekulární základ dědičnosti

Molekulární základ dědičnosti Molekulární základ dědičnosti Dědičná informace je zakódována v deoxyribonukleové kyselině, která je uložena v jádře buňky v chromozómech. Zlomovým objevem pro další rozvoj molekulární genetiky bylo odhalení

Více

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová. KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová. KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2009 Metodika byla vypracována pracovníky

Více

Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách

Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách Molekulární biotechnologie č.8 Produkce heterologního proteinu v eukaryontních buňkách Eukaryontní buňky se využívají v případě, když Eukaryontní proteiny syntetizované v baktériích postrádají biologickou

Více

Lékařská fakulta Univerzity Palackého v Olomouci

Lékařská fakulta Univerzity Palackého v Olomouci Lékařská fakulta Univerzity Palackého v Olomouci OPTIMALIZACE POLYMERÁZOVÉ ŘETĚZOVÉ REAKCE PRO ZÍSKÁNÍ GENOTYPIZAČNÍCH DAT ZA VYHRANĚNÝCH PODMÍNEK Habilitační práce Mgr. Jiří Drábek, PhD. Olomouc 2007

Více

variabilita genomu bottleneck Nature Science

variabilita genomu bottleneck Nature Science variabilita genomu Nature Science genetická diverzita člověka na úrovni SNP je nízká: asi 0.1% cca. 90% variace je uvnitř populací cca. 10% mezi populacemi (kontinenty) bottleneck personal genomes James

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin

Část. Molekulární biologie a imunologie. Základy dědičnosti. Struktura nukleových kyselin Část Molekulární biologie a imunologie 6. Základy dědičnosti Mendelovská dědičnost (autozomálně recesivní, autozomálně dominantní a X-vázaný přenos mutací). Nemendelovská dědičnost (uniparentální disomie,

Více

PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER

PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER PCR IN DETECTION OF FUNGAL CONTAMINATIONS IN POWDERED PEPPER Trojan V., Hanáček P., Havel L. Department of Plant Biology, Faculty of Agronomy, Mendel University of Agriculture and Forestry in Brno, Zemedelska

Více