TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce"

Transkript

1 TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Přehled Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymerasa Princip procesu PCR Optimalizace PCR Typy PCR Aplikace PCR a využití v praxi

2 Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dgmp) Koncept párování bazí je striktně konzervativní Cytosine Guanine From Dr. John C. Perez, Professor and Director of the Natural Toxins Research Initiative, Texas A&M

3 Deoxyribosa a fosfát dávají DNA řetězci směr 5 end 3 end konce dsdna nejsou stejné T A HO jednotlivé řetězce duplexu jsou k sobě komplementární 3 2 G C DNA rětězce duplexu mohou být denaturována a znovu spojena T A G C OH 3 end 5 end T m (melting temperature) je teplota při kteréje dsdna z poloviny denaturována Tm je závislá na: složení bazí rozpouštědle iontové síle ph délce DNA Singer, M., and P. Berg Genes and Genomes. University Science Books, Mill Valley, CA. p. 49

4 DNA replikace in vivo vyžaduje několik enzymů separace řetězců syntéza krátkých RNA primerů syntéza dvou nových DNA helixů podílí se enzymy: DNA primasa helikasa DNA polymerasa DNA ligasa SSB-proteiny Vlastnosti DNA polymerasy 1. POLYMERASOVÁ AKTIVITA Replikace probíhá vždy ve směru od 5 na 3 konec Nový nukleotid je přidáván tedy vždy na 3 OH konec. 2. 3'-5' exonukleasová aktivita -opravná funkce proofreading 3. 5 exonukleasová aktivita - odštěpuje RNA primer

5 DNA replikace in vitro vyžaduje pouze jeden enzym DNA Polymerasa 1957 Arthur Kornberg dokázal existenci DNA polymerasy - DNA polymerase I in vitro polymerasa vyžaduje pouze: 4 deoxynukleotidy trifosfáty dsdna templát primer - ssdna nebo RNA s volnou 3'-OH Syntéza obou řetězců specifické dsdna in vitro 5 3 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3 5 Forward primer dntps 5 3 TTGAGAAAGGAATAAGC DNA POL AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3 5

6 Syntéza obou řetězců specifické dsdna in vitro 5 3 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC DNA POL TCTTTAGCTCATATACG 3 5 dntps Reverse primer 5 3 GCATATACTCGATTTCT 5 3 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3 5 PCR: Co to je? Polymerase Chain Reaction: znamená amplifikace (mnohonásobná replikace) relativně krátkých úseků specifické DNA Základní nástroj molekulární biologie se vzrůstájícím významem i v dalších oborech (botanika, kriminalistika) The idea Ghobind Khorana 1971 Kary Mullis 1983 Nobelova cena 1993 poprvé provedená mnohonásobná in vitro replikacevezkumavce

7 Jak funguje PCR Řetězová reakce vychází z DNA replikace Spočívá v opakování cyklů denaturace (separace dsdna), navázání primerů a elongace primerů (syntéza nového vlákna DNA) pomocí změn teploty potřeba silného enzymu (polymerasy) který je schopen pracovat při vysokých teplotách termofilní organismy objeveny začátkem 70tých let Jak funguje PCR Polymerasa izolovaná z termofilní baktérie (Thermus aquaticus, Pyrococcus furiosus) zkr. TAQ, PFU Polymerasa až s objevem a použitím TERMOSTABILNÍ POLYMERASY získala PCR na významu

8 PCR komponenty Templátová DNA vzorek k amplifikaci Primery krátké specifické úseky DNA zaručující specifitu amplifikace datp, dttp, dctp, dgtp volné stavební jednotky DNA Thermostabilní DNA polymerasa (e.g., Taq, Pfu) Pufr a soli (KCl, MgCl2) Proces PCR Velký nadbytek primeru, dntps a Taq POL k DNA templátu

9 Problémy: PCR je velmi citlivá na kontaminace Častý problém - nespecifická amplifikace Polymerasa pracuje i při nízkých teplotách (e.g., během nastavování reakce) Hot start PCR je řešení (protilátka proti Taq) Amplifikace je často možná i pro ne zcela známou sekvenci primerů např. DNA jiného biologického druhu Degenerované primery (multiple verze s různými bázemi v klíčové pozici (tryptofan + methionin): stupeň degenerace: prettyfly protein má kód degenerovaný na 11 pozicích tzn. (4)(2)(4)(2)(4)(4)(2)(2)(2)(4)(2) = krát P R E T T Y F L Y CCA CGA GAA ACA ACA TAC TTC CTA TAC G G G G G T T G T C C C C C T T T T T A T Touchdown PCR s vyšší přesností v prvních cyklech Maximální velikost produktu +/-5000 bazí pro standardní PCR: Long PCR kits mohou amplifikovat až 35 kbazí Navrhování primerů Primery by měly být bazí dlouhé Nutná znalost alespoň části sekvence amplifikované DNA 3 konec primeru je důležitý: vhodné aby zde byla G nebo C báze Procentuální zastoupení G + C by mělo být 50-60% - ovlivňuje Tm (teplota kdy se váže primer na templát) Primery v jedné reakci by měli mít srovnatelné Tm Vyvarovat se repetitivním sekvencím Tm = (G+C)x4 + (A+T)x2 Vyvarovat se komplementaritě uvnitř čimeziprimery degenerované primery max. 20 bp ideální do degenerace 250x

10 Navrhování primerů Příklad navržení primerů: Konvence: DNA se vždy zapisuje ve směru od 5 ku 3 konci Cílová sekvence: (priming místo podtrženo): 5 TATAAGCCATAACGATATTGCTGAGTCAAGTCCACATATC ATATGGATGAGAAATGCTTGTGGAGCTGATGTTGATTTGG AGAGACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AAACCAGTTAAAGAGTGTGCCAGTAGAG 3 Forward Primer: 5 ATG GAT GAG AAA TGC TTG TG 3 Reverse Primer: 5 ACT GGC ACA CTC TTT AAC TGG 3 Praktické provedení PCR objem v mikrozkumavce: ųl složení: Templátová DNA ng Primery pmols 10mM Tris-CL ph 9.0, 50 mm KCl MgCl mm 50 ųm každého nukleotidu datp, dgtp, dttp, dctp 2 jednotky Taq polymerasy

11 Praktické provedení PCR Počáteční denaturace 94 o C 3-5 min denaturace 94 o C 30 sec annealing ~55 o C 30 sec prodlužování 72 o C 1min/kilobáze počet cyklů x Praktické provedení PCR agarozová elektroforéza

12 Praktické provedení PCR PCR se provádí v termocyklerech kovový blok z ušlechtilého kovu snadné programování vyhřívané víko PCR Optimalizace Složka AnnealingTeplota - Tm Nízká specificita Vysoká specificita MgCl 2 KCl Enzym, Primer ph Formamid nespecificky látky ovlivňující kvalitu PCR: formamid, DMSO, betain atd. Nespecifická amplifikace

13 Základní typy PCR RT PCR (reverse transcriptase PCR) vlastní PCR předchází syntéza cdna z mrna pomocí RT jako primer slouží GSP (gene specific primer) oligo dt random hexamer primer hledání nových genů tvorba cdna knihoven hledání mutací zjišťování síly exprese různých genů RACE PCR (rapid amplification of cdna ends) vychází z RT-PCR používá se k hledání celé sekvence nového genu nutná alespoň částečná znalost sekvence hledaného genu vhodné pro klonování genů a jeho následnou funkční expresi (GMO)

14 inverzní PCR Amplifikace neznámých segmentů DNA asymetrická PCR sekvenace DNA, příprava hybridizačních sond amplifikuje pouze jeden řetězec dsdna SEKVENCOVÁNÍ DNA SEKVENCOVÁNÍ DNA automatické sekvenátory využívající asymetrické PCR jednozkumavková reakce PCR s jedním primerem a dideoxyribonukleotidy (ddatp, ddgtp, ddctp, ddttp) dideoxyribonukleotidy značené 4 fluorescenčními markery velice citlivé elektroforetické rozdělení v kapiláře fluorometr s automatickým vyhodnocením

15 multiplex PCR více amplifikací v jedné zkumavce lékařská diagnostika nested PCR 2 po sobě jdoucí PCR zvyšování specificity PCR LA-PCR (long and accurate) amplifikace dlouhých úseků, polymerasové kokteily např. Taq + Pfu polymerasa (180:1) Pwo polymerasa z Pyroccocus woesei DeepVent polymerasa z Termococcus litoralis (hlubokomořská baktérie) DNA polymeráza 5-3 exonukleázová aktivita 3-5 exonukleázová aktivita délka produktu frekvence chyby Taq + 3 kb 10-4 Pfu + 3 kb 1.3 x 10-6 Pwo + 3 kb 3.3 x 10-6 DeepVent + 12 kb 3.0 x 10-5 long PCR koktejl kb 2.0 x 10-6 PROCESIVITA: jak dlouho se enzym udrží na vlákně STABILITA: kolik minut při denaturační teplotě např Taq 9 min při 97.5 C Pwo 2 hod při 100 C DeepVent 8hod při 100 C

16 in situ RT PCR lokalizace translace a exprese genů real time PCR slouží k přesné kvantifikaci amplifikovaného produktu využití fluorescence interkalačních barviv (etbr) fluorimetr je součástí termocykleru main.cfm##

17 Využití REAL TIME PCR pro detekci jednobodové mutace (lékařská diagnostika) Aplikace PCR a využití v praxi

18 Aplikace PCR a využití v praxi DIAGNOSTIKA V MEDICÍNĚ 1. detekce virových a bakteriálních onemocnění Aplikace PCR a využití v praxi DIAGNOSTIKA V MEDICÍNĚ 2. detekce geneticky vrozených chorob (mutace DNA) - AS PCR alelicky specifická PCR primer navržen tak, že mutace odpovídá konci primeru fragmenty DNA s nespárovanými konci se pohybují v elektrickém poli pomaleji - Real time PCR pomocí fluorescenční sondy odpovídající mutaci Např. detekce cystické fibrózy, choroba je podmíněná třínukleotidovou delecí v genu CFTR cystic fibrosis transmembrane regulator

19 Aplikace PCR a využití v praxi KRIMINALISTIKA VNRT variable number of tandem repeat vyskytují se na různých lokusech chromozomů a v populací kolísají mezi jedinci v počtu opakování mezi 4-40x např. GTGTGTGT Aplikace PCR a využití v praxi ANALÝZA POTRAVIN molekulárně-genetické zhodnocení surovin živočišného a rostlinného původu, které byly vyprodukovány klasickým pěstováním (chovem) nebo s použitím genového inženýrství průkaz falšování potravin druhovou záměnou (rostlinného i živočišného původu) identifikace mikroorganismů kontaminující potraviny nebo geneticky změněných mikroorganismů používaných jako startovací nebo ochranné kultury v produkci potravin. EVOLUČNÍ BIOLOGIE ORNITOLOGIE skot ovce prase koza TEST

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dgmp) Koncept párování bazí je striktně konzervativní Cytosine

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková Metody detekce a identifikace MO se zaměřením na PCR a její variace Kamila Zdeňková Metody detekce a identifikace MO rozdělení metod pro mikrobiologické zkoušení potravin přehled rychlých metod detekce

Více

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Kamila Zdeňková Transgenní rostliny, tj. takové rostliny, do jejichž dědičného základu byly metodami genového inženýrství

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace Genetické markery Genetické markery

Více

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob PGD preimplantační genetická diagnostika zahrnuje soubor technik, které se používají pro zjištění

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová. KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová. KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2009 Metodika byla vypracována pracovníky

Více

Molekulární základ dědičnosti

Molekulární základ dědičnosti Molekulární základ dědičnosti Dědičná informace je zakódována v deoxyribonukleové kyselině, která je uložena v jádře buňky v chromozómech. Zlomovým objevem pro další rozvoj molekulární genetiky bylo odhalení

Více

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK Richard Prùša Richard Prùša Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK . Základy analytických metod v klinické molekulární biologii Richard Prùša Praha 1997 Základy analytických metod

Více

Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady

Více

Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA

Více

Využití PCR pro studium mikrobiologických biodegradačních procesů. Bc. Tereza Dobešová

Využití PCR pro studium mikrobiologických biodegradačních procesů. Bc. Tereza Dobešová Využití PCR pro studium mikrobiologických biodegradačních procesů Bc. Tereza Dobešová Diplomová práce 011 ABSTRAKT Cílem diplomové práce bylo ověřit funkčnost a optimalizovat podmínky primerů, jejichž

Více

Pavel Čermák. Thomayerova nemocnice Praha - Krč. 14.2.2013 výroční zasedání SLM

Pavel Čermák. Thomayerova nemocnice Praha - Krč. 14.2.2013 výroční zasedání SLM Pavel Čermák Thomayerova nemocnice Praha - Krč Úkoly na rok 2012 Vytvoření seznamu přístrojů Doplnění podkladů pro kalkulaci Možná úprava některých stávajících výkonů?? Revize pracovních časů u všech výkonů

Více

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci

Více

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)

Více

Výuka genetiky na Přírodovědecké fakultě MU

Výuka genetiky na Přírodovědecké fakultě MU MASARYKOVA UNIVERZITA Přírodovědecká fakulta Výuka genetiky na Přírodovědecké fakultě MU Jiří Doškař Ústav experimentální biologie, Oddělení genetiky a molekulární biologie 1 V akademickém roce 1964/1965

Více

P ehled výsledk z Referen ní laborato e

P ehled výsledk z Referen ní laborato e P ehled výsledk z Referen ní laborato e 1,3 Hajdúch M, 1,3 Trojanec R, 2,3 Kolá Z, 1,3 Bouchalová K, 2,3 Sedláková E. 1 Laborato experimentální medicíny p i D tské klinice LF UP a FN Olomouc 2 Laborato

Více

Absorpční spektroskopie při biologické analýze molekul

Absorpční spektroskopie při biologické analýze molekul Absorpční spektroskopie při biologické analýze molekul Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 8.11.2007 7 1 UV spektroskopie DNA a proteinů Všechny atomy absorbují v UV oblasti

Více

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza Iveta Valášková ivalskova@fnbrno.cz Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza nejčastěji se vyskytující autozomálně recesivní dědičná metabolická porucha v zakavkazské

Více

Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR

Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR Aleš Vráblík, Jan Hodek, Jaroslava Ovesná Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2012 Metodika byla vypracována pracovníky

Více

Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE

Více

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR Mikrobiologický ústav AV ČR Příloha 6 Havarijní plán 1/5 Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR a) Adresa pracoviště Mikrobiologický ústav AV ČR

Více

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody Návod k použití souprav Wipe test Kontaminační kontrola Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody REF 7091 40 reakcí 1. Popis výrobku V posledních letech se

Více

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC 1 Výrobce Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC Tento návod k použití si důkladně přečtěte před použitím tohoto produktu. Uschovejte si tento návod k použití,

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

Jsme tak odlišní. Co nás spojuje..? Nukleové kyseliny

Jsme tak odlišní. Co nás spojuje..? Nukleové kyseliny Jsme tak odlišní Co nás spojuje..? ukleové kyseliny 1 UKLEVÉ KYSELIY = K anj = A ositelky genetických informací Základní význam pro všechny organismy V buňkách a virech Identifikace v buněčném jádře (nucleos)

Více

Nukleové kyseliny (polynukleotidy) Nukleové kyseliny a nadmolekulové komplexy polynukleotidů buněčných struktur

Nukleové kyseliny (polynukleotidy) Nukleové kyseliny a nadmolekulové komplexy polynukleotidů buněčných struktur Nukleové kyseliny (polynukleotidy) Nukleové kyseliny a nadmolekulové komplexy polynukleotidů buněčných struktur Objevitelem je Friedrich Miescher (1887) NK stojí v hierarchii látek potřebných k existenci

Více

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci

Více

FLUORESCENČNÍ MIKROSKOP

FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po

Více

O původu života na Zemi Václav Pačes

O původu života na Zemi Václav Pačes O původu života na Zemi Václav Pačes Ústav molekulární genetiky Akademie věd ČR centrální dogma replikace transkripce DNA RNA protein reverzní transkripce translace informace funkce Exon 1 Intron (413

Více

Falšování potravin. MVDr. Matej Pospiech, Ph.D.

Falšování potravin. MVDr. Matej Pospiech, Ph.D. Falšování potravin MVDr. Matej Pospiech, Ph.D. Mendelova univerzita, 31.10.2013 Obsah přednášky úvod, historie co považujeme za falšování specifika falšování potravin nejčastější způsoby falšování u jednotlivých

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

2. PROTEINOVÉ TECHNIKY

2. PROTEINOVÉ TECHNIKY OBSAH 1. DNA TECHNIKY (P. Kotrba, Z. Knejzlík) 1 1.1 Polymerasová řetězová reakce - klonování DNA in vitro 1 1.2 Polymorfismus DNA a jeho analýza 3 1.3 VNTR sekvence, jejich význam v kriminalistice a diagnostice

Více

Co se o sobě dovídáme z naší genetické informace

Co se o sobě dovídáme z naší genetické informace Genomika a bioinformatika Co se o sobě dovídáme z naší genetické informace Jan Pačes, Mgr, Ph.D Ústav molekulární genetiky AVČR, CZECH FOBIA (Free and Open Bioinformatics Association) hpaces@img.cas.cz

Více

nastavení real-time PCR cykleru Rotor Gene 3000

nastavení real-time PCR cykleru Rotor Gene 3000 Verze: 1.4 Datum poslední revize: 25. 3. 2015 nastavení real-time PCR cykleru Rotor Gene 3000 (Corbett Research) generi biotech OBSAH: 1. Nastavení teplotního profilu a spuštění cykleru... 3 2. Zadání

Více

Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený

Více

Validace a verifikace molekulárně biologických metod založených na analýze extrahumánního genomu

Validace a verifikace molekulárně biologických metod založených na analýze extrahumánního genomu Validace a verifikace molekulárně biologických metod založených na analýze extrahumánního genomu Doplněk k doporučení výboru České společnosti klinické biochemie o validaci a verifikaci analytických metod

Více

Diagnostické metody v lékařské mikrobiologii

Diagnostické metody v lékařské mikrobiologii Diagnostické metody v lékařské mikrobiologii Výuková prezentace z: Lékařské mikrobiologie Jan Smíšek ÚLM 3. LF UK 2009 Princip identifikace Soubor znaků s rozdílnou diskriminační hodnotou Základní problémy

Více

Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry

Více

doc. RNDr. Milan Bartoš, Ph.D.

doc. RNDr. Milan Bartoš, Ph.D. doc. RNDr. Milan Bartoš, Ph.D. Konference Klonování a geneticky modifikované organismy Parlament České republiky, Poslanecká sněmovna 7. května 2015, Praha Výroba léků rekombinantních léčiv Výroba diagnostických

Více

Univerzita Pardubice Chemicko-technologická fakulta Katedra analytické chemie

Univerzita Pardubice Chemicko-technologická fakulta Katedra analytické chemie Univerzita Pardubice Chemicko-technologická fakulta Katedra analytické chemie 12. licenční studium PYTHAGORAS Statistické zpracování dat Kalibrace a limity její přesnosti Semestrální práce 2009 RNDr. Markéta

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

Biochemie. ochrana životního prostředí analytická chemie chemická technologie Forma vzdělávání: Platnost: od 1. 9. 2009 do 31. 8.

Biochemie. ochrana životního prostředí analytická chemie chemická technologie Forma vzdělávání: Platnost: od 1. 9. 2009 do 31. 8. Studijní obor: Aplikovaná chemie Učební osnova předmětu Biochemie Zaměření: ochrana životního prostředí analytická chemie chemická technologie Forma vzdělávání: denní Celkový počet vyučovacích hodin za

Více

Vývoj metod založených na PCR a jejich aplikace v onkologickém výzkumu a praxi

Vývoj metod založených na PCR a jejich aplikace v onkologickém výzkumu a praxi Vývoj metod založených na PCR a jejich aplikace v onkologickém výzkumu a praxi Development of PCR Methods and Their Applications in Oncological Research and Practice Hrstka R., Kolářová T., Michalová E.,

Více

36-47-M/01 Chovatelství

36-47-M/01 Chovatelství Střední škola technická, Most, příspěvková organizace Dělnická 21, 434 01 Most PROFILOVÁ ČÁST MATURITNÍ ZKOUŠKY V JARNÍM I PODZIMNÍM OBDOBÍ ŠKOLNÍ ROK 2014/2015 Obor vzdělání 36-47-M/01 Chovatelství ŠVP

Více

Posouzení citlivosti, specifity a přesnosti identifikace nefermentujících Gram-negativních tyčinek pomocí PCR-HRMA

Posouzení citlivosti, specifity a přesnosti identifikace nefermentujících Gram-negativních tyčinek pomocí PCR-HRMA Univerzita Palackého v Olomouci Přírodovědecká fakulta Katedra buněčné biologie a genetiky Posouzení citlivosti, specifity a přesnosti identifikace nefermentujících Gram-negativních tyčinek pomocí PCR-HRMA

Více

ZADÁVACÍ PODMÍNKY. Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT) Sídlo: U Nemocnice 2094/1, 128 20 Praha 2 IČ / DIČ

ZADÁVACÍ PODMÍNKY. Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT) Sídlo: U Nemocnice 2094/1, 128 20 Praha 2 IČ / DIČ VÝZVA K PODÁNÍ NABÍDEK DO VÝBĚROVÉHO ŘÍZENÍ NA ZADÁVACÍ PODMÍNKY Název zakázky: Systém Real-Time PCR 1. Identifikační údaje zadavatele Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT)

Více

Sandwichová metoda. x druhů mikrokuliček rozlišených různou kombinací barev (spektrální kód)

Sandwichová metoda. x druhů mikrokuliček rozlišených různou kombinací barev (spektrální kód) Jindra Vrzalová x druhů mikrokuliček rozlišených různou kombinací barev (spektrální kód) na každém druhu je navázána molekula vázající specificky jeden analyt (protilátka, antigen, DNAsonda,,) Sandwichová

Více

Využití synchrotronového záření pro diagnostiku a vývoj nových léčiv

Využití synchrotronového záření pro diagnostiku a vývoj nových léčiv Využití synchrotronového záření pro diagnostiku a vývoj nových léčiv J.Hašek, ÚMCH AV ČR Zisky farmaceutických společností a společností využívajících biotechnologie činící mnoha miliard dolarů ročně jsou

Více

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD Shrnutí webináře Dystrofin 101: vše, co jste kdy chtěli vědět o dystrofinu (a nebáli jste se zeptat) Francesco Muntoni (University College of London), John Porter (PPMD) Dystrofinopatie: DMD versus BMD

Více

Seminář potravinářské mikrobiologie

Seminář potravinářské mikrobiologie Seminář potravinářské mikrobiologie Třešť 16.5.-18.5.2011 program Novinky v potravinářské mikrobiologii (i formou přehledových referátů) Kulatý stůl problémy v praxi a jak na ně Referáty PhD studentů Presentace

Více

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ

Více

Geneticky modifikované potraviny a krmiva

Geneticky modifikované potraviny a krmiva Geneticky modifikované potraviny a krmiva Co je to geneticky modifikovaný organismus (GMO)? Za GMO je považován organismus, s výjimkou člověka, jehož dědičná informace uložená v DNA byla změněna pomocí

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

Bioinformatika. hledání významu biologických dat. Marian Novotný. Friday, April 24, 15

Bioinformatika. hledání významu biologických dat. Marian Novotný. Friday, April 24, 15 Bioinformatika hledání významu biologických dat Marian Novotný Bioinformatika sběr biologických dat archivace biologických dat organizace biologických dat interpretace biologických dat 2 Biologové sbírají

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649. Základy genetiky - geneticky podmíněné nemoci Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi

Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Co je to vlastně ta fluorescence? Některé látky (fluorofory)

Více

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno Zpracování a využití biologického materiálu pro výzkumné účely od nemocných s monoklonální gamapatií Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie,

Více

FNUSA - ICRC Termocyklery pro PCR

FNUSA - ICRC Termocyklery pro PCR Název projektu OP VaVpI: FN u sv. Anny v Brně Mezinárodní centrum klinického výzkumu (FNUSA-ICRC) Číslo projektu: CZ.1.05/1.1.00/02.0123 ZADÁVACÍ DOKUMENTACE pro zadávací řízení podle zákona č. 137/2006

Více

Biochemie Ch52 volitelný předmět pro 4. ročník

Biochemie Ch52 volitelný předmět pro 4. ročník Biochemie Ch52 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Chemie. Mezipředmětové přesahy a

Více

Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění

Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění Klin. Biochem. Metab., 14 (35), 2006, No. 2, p. 89 95. Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění Gojová L., Kozák L. Centrum molekulární biologie a genové terapie, Fakultní

Více

Co se děje v genetické laboratoři?

Co se děje v genetické laboratoři? 12 Co se děje v genetické laboratoři? Tento letáček byl vytvořen s pomocí Dr Iana M Fraylinga, Institute of Medical Genetics, University Hospital of Wales, Cardiff, UK; Dr Domenica Coviella, Laboratory

Více

Zkušenosti s diagnostikou sepse pomocí testu SeptiFast Test M GRADE. Zdeňka Doubková Klinická mikrobiologie a ATB centrum VFN Praha

Zkušenosti s diagnostikou sepse pomocí testu SeptiFast Test M GRADE. Zdeňka Doubková Klinická mikrobiologie a ATB centrum VFN Praha Zkušenosti s diagnostikou sepse pomocí testu SeptiFast Test M GRADE Zdeňka Doubková Klinická mikrobiologie a ATB centrum VFN Praha Definice: Sepse je definována jako syndrom systémové zánětlivé odpovědi

Více

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11.

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. Personalizovaná medicína Roche v oblasti onkologie Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. listopadu 2013 Personalizovaná vs standardní péče Cílená léčba Spojení diagnostiky

Více

Metodické listy OPVK. Molekulární metody hodnocení genotypů Marker Assisted Breeding 14.

Metodické listy OPVK. Molekulární metody hodnocení genotypů Marker Assisted Breeding 14. Metodické listy OPVK Molekulární metody hodnocení genotypů Marker Assisted Breeding 14. Molekulární metody hodnocení genotypů 14.1. Izolace DNA V aplikacích zaměřených na analýzu rostlinného genomu je

Více

CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION

CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION AFLP ANALÝZA *** Technika AFLP (Amplification Fragment Lenght Polymorphism - polymorfismus délky amplifikovaných fragmentů) je modifikací RFLP,

Více

Studie zdravotního stavu dětí

Studie zdravotního stavu dětí Studie zdravotního stavu dětí z Radvanic a Bartovic Miroslav Dostál Ústav experimentální mediciny AV ČR, v.v.i., Praha 1 Zdravotní stav dětí Cíl porovnat zdravotní stav dětí žijících v Radvanicích & Bartovicích

Více

Výukový materiál zpracován v rámci projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0996

Výukový materiál zpracován v rámci projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0996 Výukový materiál zpracován v rámci projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0996 Šablona: III/2 č. materiálu: VY_32_INOVACE_CHE_413 Jméno autora: Mgr. Alena Krejčíková Třída/ročník:

Více

ISBN 978-80-7305-651-3

ISBN 978-80-7305-651-3 www.mendelianum.cz Mendelianum MZM, Brno ÚŽFG AV ČR, v.v.i., Brno Ústav fyziologie FVL VFU Brno Vydala Veterinární a farmaceutická univerzita Brno 2013 ISBN 978-80-7305-651-3 MENDEL FORUM 2013 26. dubna

Více

Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12

Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12 Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12 Firma Abbott Laboratories nabízí na imunoanalytických systémech ARCHITECT test ke stanovení biologicky aktivní části vitaminu

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

Prezentace školy. 00216224 Masarykova univerzita Žerotínovo nám. 9, Brno, Jihomoravský kraj. Veřejná vysoká škola

Prezentace školy. 00216224 Masarykova univerzita Žerotínovo nám. 9, Brno, Jihomoravský kraj. Veřejná vysoká škola Prezentace školy 00216224 Masarykova univerzita Žerotínovo nám. 9, Brno, Jihomoravský kraj Veřejná vysoká škola Spolupráce MU s podniky Spolupráce s podniky Výzkum a vývoj Studenti Další vzdělávání Ostatní

Více

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí

Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí Stárnutí organismu Stárnutí organismu Fyziologické hodnoty odchylky během stárnutí poklesy funkcí se liší mezi orgánovými systémy Některé projevy stárnutí ovlivňuje výživa Diagnostické metody odlišují

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

KUPNÍ SMLOUVA. dle 409 a násl. zákona č. 513/1991 Sb., obchodního zákoníku, ve znění pozdějších předpisů (dále jen obchodní zákoník ) Smluvní strany:

KUPNÍ SMLOUVA. dle 409 a násl. zákona č. 513/1991 Sb., obchodního zákoníku, ve znění pozdějších předpisů (dále jen obchodní zákoník ) Smluvní strany: KUPNÍ SMLOUVA dle 409 a násl. zákona č. 513/1991 Sb., obchodního zákoníku, ve znění pozdějších předpisů (dále jen obchodní zákoník ) Smluvní strany: prodávající:... zapsaná v obchodním rejstříku vedeném...,

Více

MOBILNÍ GENETICKÉ ELEMENTY. Lekce 13 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc.

MOBILNÍ GENETICKÉ ELEMENTY. Lekce 13 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. MOBILNÍ GENETICKÉ ELEMENTY Lekce 13 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. Demerec (1937) popsal nestabilní mutace u D. melanogaster B. McClintocková (1902-1992, Nobelova cena 1983) ukázala ve

Více

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 10 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 26.06.2014 Ročník: 6AF, 6BF Anotace DUMu: Procesy následující bezprostředně po transkripci.

Více

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura

Více

SLEDOVÁNÍ VÝSKYTU GENOTOXICKÝCH LÁTEK V POVODÍ ŘEKY SVRATKY V SOUVISLOSTI S URANOVÝM PRŮMYSLEM

SLEDOVÁNÍ VÝSKYTU GENOTOXICKÝCH LÁTEK V POVODÍ ŘEKY SVRATKY V SOUVISLOSTI S URANOVÝM PRŮMYSLEM SLEDOVÁNÍ VÝSKYTU GENOTOXICKÝCH LÁTEK V POVODÍ ŘEKY SVRATKY V SOUVISLOSTI S URANOVÝM PRŮMYSLEM Jana Badurová, Hana Hudcová, Radoslava Funková, Helena Mojžíšková, Jana Svobodová Toxikologická rizika spojená

Více

DISERTAČNÍ PRÁCE AUTOREFERÁT IDENTIFIKACE DNA ROSTLINNÝCH A ŽIVOČIŠNÝCH DRUHŮ V POTRAVINÁCH POUŽITÍM POLYMERÁZOVÉ ŘETĚZOVÉ REAKCE

DISERTAČNÍ PRÁCE AUTOREFERÁT IDENTIFIKACE DNA ROSTLINNÝCH A ŽIVOČIŠNÝCH DRUHŮ V POTRAVINÁCH POUŽITÍM POLYMERÁZOVÉ ŘETĚZOVÉ REAKCE Vysoké učení technické v Brně, Fakulta chemická, Purkyňova 464/118, 612 00 Brno DISERTAČNÍ PRÁCE AUTOREFERÁT IDENTIFIKACE DNA ROSTLINNÝCH A ŽIVOČIŠNÝCH DRUHŮ V POTRAVINÁCH POUŽITÍM POLYMERÁZOVÉ ŘETĚZOVÉ

Více

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba?

HD - Huntingtonova chorea. monogenní choroba HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? HD - Huntingtonova chorea monogenní choroba HD 4 HDF (CAG) 6-35 (CAG) 36-100+ čistě genetická choroba? 0% geny 100% podíl genů a prostředí na rozvoji chorob 0% prostředí 100% F8 - hemofilie A monogenní

Více

Písemná zpráva zadavatele pro část 4. - Fluorometr pro testování proteinů, RNA, DNA

Písemná zpráva zadavatele pro část 4. - Fluorometr pro testování proteinů, RNA, DNA Písemná zpráva zadavatele pro část 4. - Fluorometr pro testování proteinů, RNA, DNA veřejné zakázky zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, v platném znění (dále jen ZVZ ). Veřejná

Více

Střední škola gastronomie, hotelnictví a lesnictví Bzenec, náměstí Svobody 318. Profilová část maturitní zkoušky

Střední škola gastronomie, hotelnictví a lesnictví Bzenec, náměstí Svobody 318. Profilová část maturitní zkoušky Střední škola gastronomie, hotelnictví a lesnictví Bzenec, náměstí Svobody 318 Obor: 29 42 M / 01 Analýza potravin Třída: AN4A Období: jaro 2013 Profilová část maturitní zkoušky 1. Povinná volitelná zkouška

Více

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty J.Berkovcová, M.Dziechciarková, M.Staňková, A.Janošťáková, D.Dvořáková, M.Hajdúch Laboratoř

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

analýza dat a interpretace výsledků

analýza dat a interpretace výsledků Genetická transformace bakterií III analýza dat a interpretace výsledků Předmět: Biologie ŠVP: Prokaryotní organismy, genetika Doporučený věk žáků: 16-18 let Doba trvání: 45 minut Specifické cíle: analyzovat

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více