GENETIKA Mendelistická dědičnost Doc. MVDr. Eva Bártová, Ph.D.

Rozměr: px
Začít zobrazení ze stránky:

Download "GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D."


1 GENETIKA Mendelistická dědičnost 2014 Doc. MVDr. Eva Bártová, Ph.D.

2 Nauka o DĚDIČNOSTI (HEREDITA) a PROMĚNLIVOSTI (VARIABILITA) termín genetika poprvé použil v r W. BATESON název genetika odvozen z latinského genesis - zrození genetika je těsně svázána s evolucí Rok autor Objev J.G.Mendel experimenty s hrachem, Mendelovy zákony 1859 Ch. Darwin On the Origin of Species..., evoluce 1908 G.H.Hardy, W. Weinberg HW zákon 1910 T.H.Morgan Morganovy zákony 1941 G. Beadle, E. Tatum 1 gen - 1 enzym 1953 J. Watson, F. Crick struktura DNA 1977 W. Gilbert, F. Sanger sekvenování DNA 1986 K. Mullis a další PCR kompletní DNA sekvence člověka (Human Genome Project working draft )

3 3 části genetiky - 3 přístupy ke studiu: 1. MOLEKULÁRNÍ GENETIKA (replikace DNA, genová exprese) - struktura a exprese genů na molekulární úrovni - přenos genetické informace z generace na generaci 2. KLASICKÁ GENETIKA - přenos znaků z generace na generaci MENDELISMUS NEMENDELISTICKÁ DĚDIČNOST DĚDIČNOST KVANTITATIVNÍHO ZNAKU 3. POPULAČNÍ GENETIKA - variabilita v genech (znacích) v populacích a mezi populacemi

4 KLASICKÁ (FORMÁLNÍ) GENETIKA MENDELISMUS (Mendelistická dědičnost) - studuje jakoukoliv pravidelnou dědičnost kvalitativního znaku na úrovni jedince 1. Mendelova pravidla (zákony) 2. Genové interakce 3. Vazba vloh 4. Vazba na pohlaví

5 Johan Gregor Mendel ( ) otec moderní genetiky narozen v Hynčicích, (Rakousko, nyní ČR) Fylozofický Institut v Olomouci 1843 Augustiánské opatství Sv. Tomáše v Brně 1851 Univerzita ve Vídni 1853 učitel fyziky, 1868 opat experimenty s hrachem (Pisum sativum), jestřábníkem (Hieracium), včelami Mendelovy zákony dědičnosti zemřel v Brně (chronická nefritída)

6 GENOVÁ EXPRESE exprese genu (část DNA) prostřednictvím transkripce a translace Co je výsledkem genové exprese? PROTEIN plní různé funkce (stavební, regulační, katalytická) a tak vytváří či ovlivňuje různé znaky organizmu. Např: 1) gen pro barvu květu protein vzniklý expresí genu má funkci enzymu, který katalyzuje barvu květu 2) gen pro krevní skupiny kóduje protein (aglutinogen) přítomný na povrchu erytrocytů a tak vytváří krevní skupinu (aglutinační reakce) ZNAK = rys (charakteristika) organizmu Animace genové exprese: mations.html#

7 FENOTYP = běžně používané jako synonymum pro znak = doslova = stav znaku (konkrétní forma znaku) např. znak = barva očí má fenotypy = modrá, hnědá) = komplex znaků daného organizmu KVALITATIVNÍ ZNAK monogenní dědičnost (znak je ovlivněn jedním MAJOR GENEM) dán jen geneticky fenotyp vytváří různé kategorie KVANTITATIVNÍ ZNAK interakce mezi 2 či více MINOR GENY a prostředím fenotyp se liší v intenzitě (měřitelné) Uveď příklady kvalitativních a kvantitativních znaků

8 GEN = jednotka dědičnosti kóduje protein (strukturální gen) nebo trna a rrna Alela = konkrétní forma genu (gen může mít 1, 2 a více alel) dominantní, recesivní Lokus = místo genu na chromozomu Kolik má jedinec alel pro daný gen? GENOTYP - genetická (alelická) konstituce organizmu Homozygot jedinec nese 2 stejné alely téhož genu Heterozygot jedinec nese 2 různé alely téhož genu Autozomální - lokus je na nepohlavních chromozomech Gonozomální - lokus je na pohlavních chromozomech

9 Terminologie: P generace = parentální (rodičovská) generace - vždy se jedná o dva různé homozygoty F1 - generace = první generace potomků (filiální) - vzniká křížením jedinců z P generace za vzniku heterozygotů F2 - generace = druhá generace potomků (filiální) - vzniká křížením dvou jedinců z F 1 generace B1 generace - vzniká zpětným kříţením (back crossing), tj. homozygot s heterozygotem (jedinec z P a F1 generace)

10 1. MENDELOVA PRAVIDLA - Mendel je sám neformuloval, vyplynuly z jeho prioritních prací - sledoval přenos znaků z rodičů na potomky - ( ) hybridizace hrachu (jestřábník, ovocné stromy) + matematický teoretický základ 1. UNIFORMITA HYBRIDŮ F1 jedinci F1 jsou genotypově i fenotypově uniformní, protože jejich rodiče jsou homozygoti 2. IDENTITA RECIPROKÝCH KŘÍŢENÍ pro charakteristiku F 1 hybridů je jedno, jestli má určitou alelu v P generaci samec nebo samice, protože geny leží na autosomech (v autosomech se pohlaví neliší) *Hybrid = heterozygot

11 3. ČISTOTA VLOH A JEJICH ŠTĚPENÍ (princip segregace vloh) vlohy jsou u jedinců čisté (nemíchají se) vlohy se štěpí, protože jde o 2 různé alely leţící na dvou různých homologních chromozomech a v průběhu gametogeneze se rozcházejí do různých gamet 4. VLOHY JSOU VOLNĚ KOMBINOVATELNÉ (princip kombinace vloh) protože alely leží na různých chromozomových párech PODMÍNKY PLATNOSTI 1. MONOGENNÍ DĚDIČNOST: 1 gen - 1 znak 2. AUTOSOMÁLNÍ DĚDIČNOST: geny jsou na autosomech 3. KAŢDÝ GEN LEŢÍ NA JINÉM CHROMOZOMU

12 Vztahy mezi alelami Úplná dominance - heterozygot je fenotypově stejný jako dominantní homozygot, tj. červený (fenotyp v F2 3:1) Neúplná dominance - jedna alela se uplatňuje silněji (heterozygot má květy tmavě růžové) (fenotyp v F2 1:2:1) Kodominance - společný projev dvou párových dominantních alel (př. krevní skupiny člověka) Př. krevní skupiny kódovány jedním genem (I). U lidí jsou 3 alely (IA, IB, i) a 4 fenotypy (A, B, AB, 0). Alely A a B jsou kodominantí. (u člověka je také MN krevní systém, který je také kodominantní)

13 Kombinační čtverec (Punnett square) navrhl Reginald Punnett používán ke zjištění pravděpodobnosti vzniku potomků s určitým genotypem MONOHYBRIDISMUS P: BB x bb gamety: F1 : gamety: F2 : genotypový štěpný poměr? fenotypový štěpný poměr? Interaktivní animace kombinačního čtverce:

14 DIHYBRIDISMUS P: GGYY x ggyy gamety: F1 : gamety: F2 : genotypový štěpný poměr? fenotypový štěpný poměr? Alternativou je rozvětvovací metoda (viz cvičení)

15 2. GENOVÉ INTERAKCE dva či více genů (major geny) ovlivňují 1 kvalitativní znak pozná se podle změny štěpných poměrů v F 2 generaci porušena podmínka 1 gen 1 znak RECIPROKÁ INTERAKCE - bez změny fenotypového štěpného poměru - znak je ve více formách, každá je determinována jednou z kombinací alel rodičovských genů př.zbarvení paprik (z cvičení zbarvení andulek) F 2 : R-C- R-cc rrc- rrcc červená hnědá žlutá zelená 9 : 3 : 3 : 1 Jak rozliším, ţe 9:3:3:1 je genová interakce nebo dihybridismus?

16 DOMINANTNÍ EPISTÁZE dominantní alela epistatického genu potlačuje fenotypový projev hypostatického genu př1. zbarvení jiřin (z cvičení zbarvení dýní) F 2 : Y-I- Y-ii yyi- yyii žlutá žlutá slonov. bílá 12 : 3 : 1 RECESÍVNÍ EPISTÁZE homozygotně recesívní sestava epistatického genu potlačuje fenotypový projev hypostatického genu př.1: zbarvení květů šalvěje (z cvičení zbarvení myší) F 2 : A-P- : A-pp : aap- : aapp fialová bílá růžová bílá 9 : 4(bílá) : 3

17 INHIBICE dominantní alela genu inhibitoru (supresoru, I) potlačuje funkci jiného genu, ale sama nemá ţádný účinek na fenotyp! př. zbarvení peří slepic F 2 : Č-I- : Č-ii : čči- : ččii bílé : červené : bílé : bílé 13 (bílé) : 3 (červené) KOMPENZACE funkce dominantních alel dvou genů je protisměrná, jejich fenotypové účinky se vzájemně vylučují př.: zakřivení lusku u hrachu (zbarvení peří kanárků) 10 : 3 : 3

18 KOMPLEMENTARITA dominantní alely dvou (či více) genů se vzájemně doplňují při realizaci fenotypového znaku (znak se vytvoří, jsou-li přítomny obě dominantní alely) Př.: zbarvení květů hrachoru F 2 : C-R- : C-rr : ccr- : ccrr červená bílá bílá bílá 9 (červená) : 7 (bílá) MULTIPLICITA (duplicita) duplicitní geny mají stejný fenotypový účinek intezita fenotypového účinku závisí na tom, zda se účinek duplicitních aktivních genů kumuluje a zda je mezi alelami téhož genu vztah dominance jednotlivé dominantní alely jsou identické, značí se stejným písmenem

19 Duplicitní faktory nekumulativní s dominancí účinek se nekumuluje, buď je nebo není dominantní alela př.: tvar tobolek u kokošky pastuší tobolky F 2 : ( ) : ( ) 15 : 1 Duplicitní faktory kumulativní s dominancí intenzita projevu znaku závisí na počtu dominantních alel, jejichž účinek se navzájem zesiluje př.: zbarvení obilek ječmene F 2 : tmavohnědé : hnědočervené : bílé 9 : 6 : 1 Duplicitní faktory kumulativní bez dominance neprojevuje se dominance a recesivita, intenzita projevu znaku závisí na celkovém počtu aktivních alel př.: barva obilek pšenice F2: tmavočervená : červená :světle červená : růžová : bílá 1 : 4 : 6 : 4 : 1

20 Odvození štěpných poměrů v F2 generaci A-B- A-bb aab- aabb Reciproká interakce Dominantní epistáze Recesivní epistáze Komplementarita 9 7 Kompenzace Inhibice 13 3 Duplicita nekumulativní 15 1 Duplicita kumulativní s dominancí Duplicita kumulativní bez dominance AABB AaBB AABb AAbb aabb AaBb Aabb aabb aabb

21 3. VAZBA VLOH (GENŮ) 2 a více genů leží na 1 chromozomu a tvoří vazbovou skupinu projeví se změnou očekávaných štěpných poměrů porušena podmínka 1 gen na jednom chromozomu

22 Thomas Hunt MORGAN ( ) americký genetik, embryolog studoval mutace na octomilce (Drosophila melanogaster) zjistil, že geny leţí na chromosomech získal Nobelovu cenu za fyziologii a medicínu v roce1933 Drosophila se stala modelovým organizmem v genetice MORGANOVY ZÁKONY!!! 1. geny jsou uloţeny na chromozomech lineárně za sebou 2. počet vazbových skupin je roven počtu párů homologních chromozomů Kolik vazebných skupin můţe mít člověk?

23 Kolik gamet produkuje heterozygot AaBb a v jakém poměru? Kolik gamet produkuje heterozygot AaBb, jestliže mezi geny A a B je genetická vazba? vazbová fáze cis: na 1 chromozomu AB, na druhém ab vazbová fáze trans: na 1 chromozomu Ab, na druhém ab A cis a A trans a B b b B SÍLA VAZBY závisí na vzdálenosti mezi geny, tím je dála síla vazby a pravděpodobnost vzniku crossing-overu mezi 2 geny vazba úplná geny leží blízko sebe, vazba je silná, nedochází ke crossing-overu tj. nevznikají rekombinované genotypy vazba neúplná geny leží daleko od sebe, vazba je slabá, dochází ke crossing-overu tj. vznikají rekombinované genotypy

24 Vyjádření síly vazby: BATESONOVO ČÍSLO (c) = počet gamet s nerekombinovaným genotypem/počet gamet s rekombinovaným genotypem MORGANOVO ČÍSLO (p) = 100 x počet gamet vzniklých rekombinací/celkový počet gamet Vztah mezi c a p: c p p p 100 c 1 1 cm (centimorgan) vyjadřuje 1 % rekombinační frekvenci mezi dvěma geny na 1 chromozomu Stanovení síly vazby: - podle výsledků v F2 generaci - zpětným křížením (křížení homozygota s heterozygotem)

25 TESTOVACÍ KŘÍŢENÍ podobné zpětnému křížení (heterozygot x homozygot), slouží ke zjištění frekvence genotypů na základě fenotypového štěpného poměru u potomků Tří bodový test (viz. cvičení) sleduje se interakce mezi 3 geny slouží k sestavení chromozomové mapy = pořadí genů a jejich vzdálenost v centimorganech (cm) Chromozomová mapa: /posters/chromosome/chooser.shtml

26 4. VAZBA NA POHLAVÍ DĚDIČNOST NA POHLAVÍ VÁZANÁ (sex-linked) geny leží na gonosomech jeden z rodičů je hemizygot (samec) porušena podmínka geny leží na autosomech znaky úplně pohlavně vázané - geny leží v nehomologních částech heterochromozomů (není možný crossing-over) znaky neúplně pohlavně vázané - geny leží v homologních částech heterochromozomů (crossing-over možný, ale často blokován) heterologní homologní heterologní homologní

27 Znaky úplně pohlavně vázané - geny leží v heterologních částech pohlavních chromozomů a) gen leží na gonosomu Y (holandrická dědičnost) - znak se dědí z otce na syna (hypertrichosis auriculae chlupaté uši) b) gen leží na gonosomu X (hemofýlie, daltonismus u lidí, barva očí u octomilky) uniformita F1 generace, jestliže dominantní alela je na chromozomu X u samice (X D X D ), v F 2 3:1 dědičnost kříţem, jestliže dominantní alela je na chromozomu X u samce (X D Y), v F 2 1:1 hemizygot

28 Znaky související s pohlavím - geny leží na autosomech DĚDIČNOST POHLAVÍM PODMÍNĚNÁ (sex-limited) geny leží na autosomech obou pohlaví, ale znak se projeví jen u jednoho pohlaví, které má anatomickou predispozici znak se vyskytuje jen u jednoho pohlaví (př. kryptorchismus jen u samce) DĚDIČNOST POHLAVÍM OVLIVNĚNÁ (sex-influenced) geny leží na autosomech obou pohlaví, heterozygot je ovlivněn pohlavními hormony tj. u samce se projeví jinak než u samice znak se vyskytuje u obou pohlaví (př. zbarvení srsti u ayshirského skotu, plešatost u lidí) DĚDIČNOST POHLAVÍM OVLÁDANÁ (sex-controlled) geny leží na autosomech obou pohlaví, heterozygot a dominantní homozygot je ovlivněn pohlavními hormony, tj. u samce se projeví jinak než u samice znak se vyskytuje jen u jednoho pohlaví (př. sekundární pohlavní znaky vousy mužů, velikost ploutví u ryb) * Umět aplikovat na nějaký příklad z cvičení!!!

29 DETERMINACE POHLAVÍ U ŢIVOČICHŮ 1. vliv prostředí - teplota - želvy, krokodýli (t <28 C) (t C) (t >32 C) 2. vliv pohlavních chromozomů Typ Savci (Drosophila) Y-gen SRY zástupci XY XX savci, hmyz, některé ryby, plaz, obojživelníci Ptakopysk Y-gen DMRT1 X 1 Y 1 X 2 Y 2 X 3 Y 3 X 4 Y 4 X 5 Y 5 X 1 X 1 X 2 X 2 X 3 X 3 X 4 X 4 X 5 X 5 ptakopysk Ptačí (Abraxas, ZW) Y-gen DMRT1 ZZ ZW ptáci, motýli, některé ryby, plazi, obojživelníci, rostliny Protenor XO XX ploštice, rovnokřídlý hmyz sady chromozomů n 2n sociální hmyz


31 NEMENDELISTICKÁ DĚDIČNOST znaky, které se dědí jinak, než podle pravidel mendelismu všechny znaky u hub, virů a bakterií se dědí nemendelisticky termín se používá spíše pro výjimky u eukaryotických buněk 1. maternální dědičnost (extranukleární) 2. dědičnost vázaná na infekční agens 3. maternální efekt 4. trinukleotidové repetice 5. komplexní znaky

32 MATERNÁLNÍ DĚDIČNOST (cytoplazmatická, extranukleární) objevena v roce Carl Correns u rostliny Mirabilis jalapa nocenka jalapenská znaky potomků se nevyštěpují v poměrech odpovídajících mendelismu všichni potomci mají fenotyp 1 rodiče (obvykle matky - množství cytoplazmy v samičí gametě je větší než v samčí gametě zdrojem mitochondrií (chloroplastů) potomka je matka) neplatí identita reciprokých kříţení

33 samičí gameta samčí gameta Vysvětlení: Samčí mitochondrie jsou obvykle zničeny po oplodnění. V roce 1999 byl tento mechanismus objasněn: mitochondrie spermií jsou označeny ubiquitinem, aby byly následně zničeny v embryu. Některé IVF techniky mohou tento proces narušit.

34 Př.: panašovanost rostlin - geny pro barvu rostlinných chloroplastů leží na cpdna, nezbarvené chloroplasty jsou výsledkem mutace genu cpdna Fenotyp samičí rostliny (vajíčko) Bílý Zelený Panašovaný Fenotyp samčí rostliny (pyl) Bílý Zelený Panašovaný Bílý Zelený Panašovaný Fenotyp potomka Bílý Bílý Bílý Zelený Zelený Zelený Bílý Bílý Zelený Panašovaný Zelený Bílý Zelený Panašovaný Panašovaný Bílý Zelený Panašovaný

35 Mitochondriální dědičnost: mitochondriální onemocnění ovlivněny buňky mozku, nervy, svaly, ledviny, srdce, oko, uši příznaky: snížený růst, svalová slabost, problémy se zrakem a sluchem, mentální retardace, onemocnění jater, ledvin a srdce, cukrovka, neurologické problémy... projev závisí na množství mitochondrií s mutací Příklady: 1) Leber s hereditary optic neuropathy (LHON) mutace v genech mtdna pro elektron transportní řetězec proteinů defect v enzymech oxidativní fosforylace produkce ATP je zastavena degenerace n. opticus ztráta zraku (častější u mužů) 2) Kearns-Sayre syndrom delece v mtdna odstranění genů trna, narušena translace v mitochondriích neuromuskulární defekt, paralyza svalů oka, akumulace abnormálních proteinů v sítnici, chronický zánět a degenerace sítnice oka, srdeční onemocnění

36 DĚDIČNOST VÁZANÁ NA INFEKČNÍ AGENS znaky přenášené symbiotickými viry nebo bakteriemi lokalizace v cytoplazmě, k přenosu dochází při míchání cytoplasmy (při fertilizaci) Př.: symbiotické RNA viry L a M u některých kvasinek - společně vyvolávají produkci toxinu, který zabíjí kvasinky bez M viru nebo obou virů (vůči vlastnímu toxinu je kvasinka odolná) kvasinka produkující toxin citlivé kvasinky L virus M virus jen L virus bez virů

37 MATERNÁLNÍ EFEKT odlišný od maternální dědičnosti extranukleárních genů! fenotyp potomka (bez ohledu na jeho genotyp) závisí na genotypu matky (bez ohledu na její fenotyp)!!!! princip: před fertilizací je v oocytu přítomen protein (produkt genu matky), který ovlivňuje orientaci mitotického vřeténka v první mitóze po fertilizaci a tím ovlivňuje vynutí ulity (doprava nebo doleva) u potomka Př.: pravotočivé nebo levotočivé vinutí ulity u plţe plovatky toulavé (Lymnaea peregra) Směr vinutí odlivňuje pár alel: D - dominantní (pravotočivost) d - recesivní (levotočivost) * Umět vysvětlit na příkladu!!!!

38 Fenotyp potomka vţdy závisí na genotypu matky! P generace levotočivá pravotočivá F1 generace levotočivá F2 generace všichni potomci pravotočivá F3 generace všichni potomci pravotočivá levotočivá F1 - uniformní F2 - uniformní F3-3 : 1

39 TRINUKLEOTIDOVÉ REPETICE onemocnění způsobené zmnožením mikrosatelitů (tandemové opakování trojice nukleotidů) zdravý jedinec má malý počet repetic s každou generací se počet repetic zvyšuje premutace (predispozice, že jedinec bude postižen) postiţení (jedinec bude mít příznaky onemocnění) Huntingtonova choroba (HD)= tanec sv. Víta vzácné autosomálně dominantní neurologické onemocnění způsobené zmnožením trinukleotidových repetic v genu kódující Huntingtin protein 36 repetic (CAG) = práh pro onemocnění Příznaky: abnormální pohyby (tanec sv. Víta), špatná koordinace, změna chování

40 komplexní znaky se dědí kvantitativně (více genů), ale exprimují se kvalitativně neplatí Mendlovy zákony Při. dysplazie kyčelního kloubů KOMPLEXNÍ ZNAKY více genů, více genotypů kontinuální genetická variabilita vliv vnějšího prostředí (mutageneze)

41 Př. dysplazie je determinována 5 aditivními geny (G, H, I, J, K) pouze dominantní alely přispívají k dysplazii rodiče: gghhiijjkk (normální) x GGHHIIJJKK (s dysplazií) potomek: GgHhIiJjKk Bude mít potomek dysplazii? práhem k onemocnění je přítomnost 7 dominantních alel (které z nich to budou je jedno) př. gghhiijjkk nebo GGHHIIJjkk Opatření: zařazovat do chovu jedince bez dysplazie sourozenci těchto jedinců, jejich rodiče a sourozenci rodičů by také měli být bez dysplazie

42 GRAFICKÉ POROVNÁNÍ ZNAKŮ znak kvalitativní znak dědičnost monogenní malý vliv prostředí kvantitativní znak komplexní znak polygenní polygenní velký velký

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp



MENDELISMUS GENOVÉ INTERAKCE NEMENDELISMUS MENDELISMUS GENOVÉ INTERAKCE NEMENDELISMUS Biologie a genetika BSP, LS4, 2014/2015, Ivan Literák 4. GENOVÉ INTERAKCE Dva (příp. více) geny ovlivňují 1 znak (kvalitativní!) 2 major-geny se ovlivňují -


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého


Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu


Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické Gonozomáln lní dědičnost Mgr. Aleš RUDA Chromozomové určení pohlaví autozomy gonozomy člověk má 22 párůp autozomů a 1 pár p gonozomů označen ení pohlavních chromozomů: : X a Y. jsou možné celkem 3 kombinace:


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu


Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 Mutace Mutace - náhodná změna v genomu organismu - spontánní


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou


Genová vazba. Obr. č. 1: Thomas Hunt Morgan

Genová vazba. Obr. č. 1: Thomas Hunt Morgan Genová vazba Jednou ze základních podmínek platnosti Mendelových zákonů je lokalizace genů, které podmiňují různé vlastnosti na různých chromozómech. Toto pravidlo umožňuje volnou kombinovatelnost genů


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus


Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce?

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce? REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince Co bylo dřív? Slepice nebo vejce? Rozmnožování Rozmnožování (reprodukce) může být nepohlavní (vegetativní, asexuální) pohlavní (sexuální;


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by - Ned?le, B?ezen 01, 2015 Otázka: Genetika I P?edm?t: Biologie P?idal(a):


GENETIKA. zkoumá dědičnost a proměnlivost organismů

GENETIKA. zkoumá dědičnost a proměnlivost organismů GENETIKA zkoumá dědičnost a proměnlivost organismů Dědičnost: schopnost organismů uchovávat informace o své struktuře a funkčních schopnostech a předávat je svým potomkům Proměnlivost (variabilita) je



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.


-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ


Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Druhová a mezidruhová hybridizace

Druhová a mezidruhová hybridizace Druhová a mezidruhová hybridizace Obsah Druhová a mezidruhová hybridizace... 1 Obsah... 1 Monohybridní křížení... 1 Dihybridní křížení... 2 Polyhybridní křížení... 3 Souhrn Mendelismus v dědičnosti kvalitativních


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). Orphanet - Volně přístupné webové stránky s informacemi


Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje


Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce



GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou



TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti


Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák

Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák Biologie a genetika, BSP, LS7 2014/2015, Ivan Literák KVANTITATIVNÍ GENETIKA dědičnost kvantitativních znaků ZNAKY KVALITATIVNÍ: gen znak barva hrachu: žlutá zelená (i komplikovaněji penetrace, epresivita,


Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením


rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické


Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi



GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že


Determinace pohlaví a evoluce pohlavních chromosomů

Determinace pohlaví a evoluce pohlavních chromosomů Determinace pohlaví a evoluce pohlavních chromosomů Radka Reifová Katedra zoologie Prezentaci naleznete na: v záložce Courses Jak vznikají dvě pohlaví Mechanismy determinace


Buňky, tkáně, orgány, soustavy

Buňky, tkáně, orgány, soustavy Lidská buňka buněčné organely a struktury: Jádro Endoplazmatické retikulum Goldiho aparát Mitochondrie Lysozomy Centrioly Cytoskelet Cytoplazma Cytoplazmatická membrána Buněčné jádro Jadérko Karyoplazma


A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům Karlova univerzita, Lékařská fakulta Hradec Králové Obor: všeobecné lékařství - test z biologie Vyberte tu z nabídnutých odpovědí (1-5), která je nejúplnější. Otázka Odpověď 1. Mezi organely membránového


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00



PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin


UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku)

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) B I O L O G I E 1. Definice a obory biologie. Obecné vlastnosti organismů. Základní klasifikace organismů.


Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny

Molekulární genetika: Základní stavební jednotkou nukleových kyselin jsou nukleotidy, které jsou tvořeny Otázka: Molekulární genetika, genetika buněk Předmět: Biologie Přidal(a): jeti52 Molekulární genetika: Do roku 1953 nebylo přesně známa podstata genetické informace, genů, dědičnosti,.. V roce 1953 Watson


Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností


Digitální učební materiál

Digitální učební materiál Digitální učební materiál Projekt CZ.1.07/1.5.00/34.0415 Inovujeme, inovujeme Šablona III/2 Inovace a zkvalitnění výuky prostřednictvím ICT (DUM) Tematická Odborná biologie, část biologie Společná pro


S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef


Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k


Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Obecná genetika Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Ing. Roman Longauer, CSc. Ústav zakládání a pěstění lesů, LDF MENDELU Brno Tento projekt je spolufinancován Evropským



TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST TYPY DĚDIČNOSTI GONOSOMÁLNÍ DĚDIČNOST DĚDIČNOST POHLAVNĚ VÁZANÁ geny lokalizované na pohlavních chromozomech X nebo Y řídí vznik nejen primárních pohlavních znaků přenos genů na potomky je vázán na přenos


"Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Základy Genetiky

Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT . Základy Genetiky "Učení nás bude více bavit aneb moderní výuka oboru lesnictví prostřednictvím ICT ". Základy Genetiky ROSTLINNÁ BUŇKA aaaaaaaa jádro mitochondrie chromatin (DNA) aaaaaaaa aaaaaaa aaaaaaaa aaaaaaaa plastid


DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura


Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina

Molekulární genetika. DNA = deoxyribonukleová kyselina. RNA = ribonukleová kyselina Přehled GMH Seminář z biologie GENETIKA Molekulární genetika Základní dogma molekulární biologie Základním nosičem genetické informace je molekula DNA. Tato molekula se může replikovat (kopírovat). Informace


Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Dle čl. 7 odst. 2 Směrnice děkana pro realizaci bakalářských


Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený
