Barevné formy zebřiček a jejich genetika - část II. příklady

Save this PDF as:

Rozměr: px
Začít zobrazení ze stránky:

Download "Barevné formy zebřiček a jejich genetika - část II. příklady"


1 Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje hlavní směr tohoto článku. V obecném článku je obecné vysvětlení rozdílů mezi dominancí a recesivitou v určitých barevných vlastnostech, také zde mluvíme o vlastnostech vázaných na pohlavní chromozómy a kombinací těchto barevných odchylek. Také je v obecném článku tabulka, kde jsou znázorněny základní barevné mutace a jejich dědičnost (dominance, recesivita, vazba na pohlavní chromozómy). Naskýtá se tedy jedna otázka: co když se naskytne případ, kdy kombinujeme 2 vlastnosti dědičné recesivně?, jaké bude potomstvo?. Na to je celkem snadná otázka, ale pokusím se to vysvětlit hlavně na příkladech. Za prvé si musíme uvědomit, že každá genetická (nebo barevná) odchylka je dědičná jako samostatná část genetické informace. Můžeme říci, že geny, které přecházejí do dalšího potomstva, se nemusí ještě projevit na vnějších vlastnostech (na barvě peří). Geny se nemusí vůbec projevit, pokud je jejich funkce jiným genem blokována nebo překryta. Představme si to jako malíře, který má malovat vždy přesný vzor barev a kombinuje jen několik základních, ze kterých pak míchá různé odstíny. Pokud má tento malíř k dispozici všechny barvy (tzn. že geny dokáží vytvářet všechno barvivo), namaluje vzor který můžeme přirovnat k základnímu (přírodnímu) zbarvení zebřičky pestré. Někdy mu však některé barvy chybí (geny nedokáží toto barvivo tvořit) a náš malíř vše kreslí tak jak má, ale bohužel mu chybí např. černá barva a proto ptáci jsou bílí, ovšem s hnědou kresbou na místech, kde je normálně použita (hnědou má k dispozici). A teď trochu konkrétněji. Barevné vlastnosti našich opeřenců můžeme rozebrat do základních barevných forem, jak bylo uváděno (např. černolící, bílí, smetanoví, phaeo, atd.). Geny určují, jakou barvu bude malíř na daní místa používat (ne jenom, které barvy má k dispozici). Dejme tomu, že máme zebřičku se zbarvením smetanovým (viz. foto v obecném článku). Toto zbarvení ovlivňují 2 geny, za prvé je to gen, který způsobuje zředění základního pigmentu - pastelové zbarvení (DB), označme ho např. gen D. Za druhé je to gen způsobující samostatně skořicové zbarvení (F), označíme ho písmenem S. Pokud jsou oba tyto geny ve své aktivní formě, je zbarvení jedince smetanové, čili téměř bílé s hnědými náznaky lícních skvrn a s tečkami pod křídly. Za aktivní formu považuji případ, kdy geny mají v našem případě obě alely ve formě, která zajišťuje projev tohoto genu ve vnějším prostředí, čili u znaků dominantních ve formě AA nebo Aa, u znaků recesivních ve formě aa (viz. příklad v obecné části). Protože se jedná o kombinaci 2 genů, musíme je rozebírat každý zvlášť, ovšem barevný projev tvoří oba dohromady. Označili jsem geny písmeny D a S. D pastelové zbarvení, projevuje se pokud alespoň jedna alela je dominantní: - můžeme zapsat jako: DD, popř. Dd, velké D je výraz pro dominantní alelu v případě pastelového zbarvení, malé d, výraz pro alelu recesivní. - naskýtá se případ, kdy máme 3 typy genotypů: DD, Dd, dd, ovšem ve skutečnosti se liší pouze typ DD, Dd (pastelová) od dd (standartní zbarvení), tzn. že na barvě zebřičky nepoznáme, jestli je genotypu DD, Dd, ovšem tato skutečnost má velký význam při křížení a musíme to vydedukovat pouze z rodokmenů.

2 S skořicové zbarvení, vázané na pohlavní chromozóm. - rozdíl u samců a samic. - může zde nastat několik možností: samci: SS, Ss, ss (XX, X s X, X s X s ) samice: S-, s- (XY, X s Y) - pomlčka u samic značí absenci tohoto genu na chromozómu Y (viz. obecná genetika). - u samic je to jednoduché: S- (XY) standartní zbarvené, s- (X s Y) skořicové zbarvení - u samců jsou 3 možnosti jako v případě s genem D, ale skořicové zbarvení se projevuje jen v recesivní fázi tzn. ve formě ss, takže jedinci ss (X s X s ) jsou skořicoví, jedinci Ss (X s X) jsou standartní, ale jsou nositeli tohoto zbarvení v další generaci, a jednici SS (XX) jsou standartní bez projevu této vlastnosti. Nyní ke konkrétním příkladům: Příklad č.1 Máme : označení genotypu: DDss, jeho zbarvení je smetanové a samici se standartním zbarvením: dds- křížení: DDss x dds- potomci: Mendelistický čtverec, nejdříve gen D Typy alel D D alely d Dd Dd d Dd Dd Vychází nám, že 100% potomstva má gen Dd, což značí pastelové zbarvení. Typy alel s s alely S Ss Ss - s- s- Z tabulky vidíme, že samci (mají obě alely, samice jen jednu) budou mít genotyp Ss a jejich zbarvení je standartní, ale jsou nositelem skořicového zbarvení v další generaci. Samice mají gen s- a jejich zbarvení je proto skořicové. Pokud vezmeme v potaz oba geny současně, můžeme říci, že z tohoto křížení budou všechny samice genotypu: Dds- a proto budou smetanové (Dd pastelové zbarvení + s- skořicové

3 zbarvení = smetanová barva), ovšem samci budou mít genotyp: DdSs a budou všichni se zředěným pigmentem, čili budou 100% pasteloví. Potomci: samci: DdSs pasteloví samice: Dds- smetanové Příklad č.2 Smetanový samec jako v předchozím příkladě, ale genotyp: DdSs! Standartní samice s genotypem:dds-! Na venek jsou oba ptáci naprosto totožní s těmi v příkladě č.1, ale. Křížení: DdSs x DdS- Potomci: Gen D Typy alel D d alely d Dd dd d Dd dd Vychází nám 50% genotyp dd, což ukazuje na standartní barvu a 50% genotyp Dd, což je pastelové zbarvení. Typy alel S s alely S SS Ss - S- s- Samci: SS a Ss, všichni standartní Samice: S- standartní s- skořicové Kombinací obou genů nám vychází 4 typy zbarvení: Samci: standartní: ddss nebo ddss (50% samců), pasteloví DdSS nebo DdSs(50% samců)

4 Samice: standartní: dds- (25% samic) skořicové: dds- (25% samic) pastelové: DdS- (25% samic) smetanové: Dds- (25% samic) Příklad č.3 Máme : označení genotypu: ddss, jeho zbarvení je standartní a samici se smetanovým zbarvením: DDs- křížení: ddss x DDs- potomci: gen D Typy alel d d alely D Dd Dd D Dd Dd Vychází nám, že 100% potomstva má gen Dd, což značí pastelové zbarvení. Typy alel S S alely s Ss Ss - S- S- Z tabulky vidíme, že samci (mají obě alely) budou mít genotyp Ss a jejich zbarvení je standartní, ale jsou nositelem skořicového zbarvení v další generaci. Samice mají gen S- a jejich zbarvení je také standartní. Potomci: samci: DdSs pasteloví samice: DdS- pastelové Příklad č.4 Standartní samec jako v předchozím příkladě, ale genotyp: ddss! Smetanová samice s genotypem:dds-!

5 Křížení: ddss x Dds- Potomci: Gen D Typy alel d d alely D Dd Dd d dd dd Vychází nám 50% genotyp dd, což ukazuje na standartní barvu a 50% genotyp Dd, což je pastelové zbarvení. Typy alel S s alely s Ss ss - S- s- Samci: Ss standartní ss skořicoví Samice: S- standartní s- skořicové Kombinací obou genů nám vychází 4 typy zbarvení u obou pohlaví: Samci: standartní: ddss (25% samců), pasteloví DdSs(25% samců) skořicoví ddss (25%samců) smetanoví Ddss (25% samců) Samice: standartní: dds- (25% samic) skořicové: dds- (25% samic) pastelové: DdS- (25% samic) smetanové: Dds- (25% samic) Co říci úplně na konec? Snad jen to, že na těchto příkladech z praxe můžete vidět, jak velký je rozdíl v potomstvu při kombinaci různých rodičů na venek zjevně stejných. Podle těchto příkladů si můžete spočítat předpokládaný vznik barevných forem i u ostatních mutací např. Phaeo je na tom podobně, i když zde bude nepatrná odlišnost.

6 Ještě jeden dodatek: Pokud křížíte 2 jedince s různými znaky recesivní povahy, znamená to, že potomci mohou být od rodičů úplně odlišní a nemusí být vůbec nositeli stejného zbarvení. Musíte brát v úvahu, že každý gen vystupuje sám za sebe a pokud se dostane do spojení s jiným typem genu, většinou se vzájemně nijak neovlivňují, jen se jejich vlastnosti jednoduše nakombinují dohromady a vzájemně se překryjí. Pokud máte čistě bílého jedince (gen A) a křížíte např. se strakatým (gen B), což jsou 2 typy genů, pravděpodobně získáte potomstvo standartního zbarvení, protože když budeme brát v úvahu čistotu (neboli homozygotnost) daných rodičů, ani jeden z genů se nemůže projevit u potomků neboť: Strakatý standart: AAbb x aabb bílý Potomci: AaBb standartní, štěpitelní do bílé i do straky Protože: Gen A způsobuje: AA, Aa standartní barvu aa bílou barvu (vlastně absence černého a hnědého barviva) Gen B: BB, Bb standartní barva bb strakatý jedinec Tohle je hlavní odpověď, jak je to s recesivními geny. Vidíme, že kdybychom měli jedince štěpitelné do těchto znaků (vezmeme např. potomky předchozího křížení) a spárovali je mezi sebou, vznikne nám mnoho zajímavých jedinců: Křížení AaBb x AaBb Potomci: Gen A: AA, Aa standartní 75% aa bílí 25% Gen B: BB, Bb standartní 75% bb strakatí 25% Když dáme dohromady oba geny, pak vyjdou fenotypy takto: 56% AA(Aa)BB(Bb) standartní 18,75% aabb(bb) bílí (bílá je vlastně absence barviva a jestli si vzpomínáte na horní část článku, malíř maluje jen s barvami, které má a proto druhý gen nemůže zbarvení obnovit) 18,75% AA(Aa)bb strakatí standartní 6,5% aabb strakatí bílí (gen pro strakatost může na některých místech obnovovat tvorbu černého pigmentu a proto se zde mohou tvořit černé skvrny, ovšem také nemusí a ptáci mohou být čistě bílí toto je zatím pro mne záhadou a neověřenou informací). Autor: Ing. Pavel Matiska

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou



MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp


12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat


Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly


Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny


Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto


Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat


V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865


Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského


Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém


Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2


Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou



OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 Genetika a plemenné znaky u králíků Chov králíků, II. Kategorie Johana Vinšová *13. 8. 1997 Žabonosy 113, Kolín 2, 280 02 ZO ČSCH Kolín 1 Práce započata dne: 25. 11. 2014


Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků


9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů 9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou


Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)


Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci


Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v


Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela


Základní barvy holuba domácího

Základní barvy holuba domácího Základní barvy holuba domácího Ing. Juraj Kafka Národní komise pro standardy holubů ČSCH 5 Popis původního zbarvení Columba livia, (L.) modré černopruhé 4 3 1 2 1. Krk část opeření s rozprostřenými pigmentovými



GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


Bochov Dědičnost bílých znaků

Bochov Dědičnost bílých znaků 4.11.2011 Bochov Dědičnost bílých znaků Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou určeny ke komerčnímu


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u


Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je


Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním



GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky


GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních


Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto


Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u


Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA


VY_32_INOVACE_11.18 1/6 Genetika Genetika

VY_32_INOVACE_11.18 1/6 Genetika Genetika 1/6 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost


BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů.

BARVY BORDER COLLIÍ. Na konci tohoto dokumentu naleznete schéma hlavních barev podle lokusů. BARVY BORDER COLLIÍ Barva psí srsti je dána geneticky. Pro všechny border collie (snad až na vzácné výjimky) platí, že ve své genetické výbavě nesou alelu Si, která determinuje irské zbarvení (bílé znaky)


Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým



GENETIKA V MYSLIVOSTI GENETIKA V MYSLIVOSTI Historie genetiky V r. 1865 publikoval Johann Gregor Mendel výsledky svých pokusů s hrachem v časopisu Brněnského přírodovědeckého spolku, kde formuloval principy přenosu vlastností


Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že


1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,


MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that


13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu


S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef


- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil


Mendelistická genetika

Mendelistická genetika Mendelistická genetik Mgr. leš RUD Rozmnožování orgnismů Nepohlvní nový jedinec vzniká z diploidních somtických buněk je geneticky identický s mteřským jedincem Pohlvní nový jedinec vzniká spojením chromozomových


Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010


Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


1. generace 2. generace 3. generace I J K F I L

1. generace 2. generace 3. generace I J K F I L GENETIKA A CHOV Základem chovatelské činnosti je volba chovného páru, při kterém vybíráme především podle plemenných znaků obou jedinců. Obecná chovatelská praxe či zásada je spojovat podobné s podobným,


Studie landseera. Studie landseera - zbarvení srsti

Studie landseera. Studie landseera - zbarvení srsti Studie landseera Při studiu landseera jsem se musela aspoň zlehýnka dotknout i genetického minima, jinak bych si nedovolila tvrdit, že jsem něco studovala. Tato studie se týká zbarvení srsti landseera.


Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.



PRAKTIKUM Z OBECNÉ GENETIKY RNDr. Pavel Lízal, Ph.D. Přírodovědecká fakulta MU Ústav experimentální biologie Oddělení genetiky a molekulární biologie 1) Praktikum z obecné genetiky 2) Praktikum z genetiky rostlin


Rukověť genetiky pro chovatele potkanů

Rukověť genetiky pro chovatele potkanů Rukověť genetiky pro chovatele potkanů Příručka pro chovatele, kteří by se rádi dozvěděli, jak celá ta věc funguje Bc. Markéta Čacká Praha, 2013 Verze určená pro čtečky (optimalizováno na Kindle 3) OBSAH


Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců


QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití).

QTL u koní. Kmen je skupina koní v rámci plemene, odlišných morfologických a užitkových vlastností (šlechtění na tažné a jezdecké využití). QTL u koní Dnešní plemena koní se odvozují od divokých předků, od: Equus przewalskii (kůň Převalského-kertaka) Equus gmelini (kůň západní) Equus gracilis (kůň severský) Pojmy plemenitby Plemeno je skupina


Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus


Zvyšování kvality výuky technických oborů

Zvyšování kvality výuky technických oborů Zvyšování kvality výuky technických oborů Klíčová aktivita V.2 Inovace a zkvalitnění výuky směřující k rozvoji odborných kompetencí žáků středních škol Téma V.2.18 Dřeviny Kapitola 2 Rozmnožování rostlin


Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka

Genetická determinace zbarvení vlasů u člověka. Genetická determinace zbarvení očí u člověka Genetická determinace zbarvení vlasů u člověka Genetická determinace zbarvení očí u člověka znaky polygenní, které však při studiu dědičnosti v rodinách vykazují zdánlivě jednoduchou dědičnost výzkumem


RURGenetika zápočtový program Programování II

RURGenetika zápočtový program Programování II RURGenetika zápočtový program Programování II Rudolf Rosa cvičící: Doc. RNDr. Pavel Töpfer, CSc. Obsah Specifikace...1 Původní specifikace...1 Upravená specifikace...2 Program...3 třída Populace...4 Datové


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika


Gonosomální dědičnost

Gonosomální dědičnost Gonosomální dědičnost Praktické cvičení č.12 Jaro 2016 Aneta Kohutová Biologický ústav Lékařská fakulta Masarykova univerzita Kamenice 5, 625 00 Brno Cíle cvičení Student:


Výukový materiál zpracovaný v rámci projektu Výuka modern

Výukový materiál zpracovaný v rámci projektu Výuka modern St ední pr myslová škola strojnická Olomouc, t. 17. listopadu 49 Výukový materiál zpracovaný v rámci projektu Výuka modern Registrační číslo projektu: CZ.1.07/1.5.00/34.0205 Šablona: III/2 P írodov dné


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


Genové interakce Modifikace mendelovských poměrů

Genové interakce Modifikace mendelovských poměrů Modifikace mendelovských poměrů Z Mendelových experimentů vyplynuly nejjednodušší principy přenosu genetické informace, kdy jsou geny umístěny na homologních chromozomech, které segregují jeden od druhého


genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace



STŘEDOŠKOLSKÁ ODBORNÁ ČINNOST STŘEDOŠKOLSKÁ ODBORNÁ ČINNOST Obor SOČ: 7. Zemědělství, potravinářství, lesní a vodní hospodářství Genetika kvalitativních znaků králíků Johana Vinšová Kraj: Praha Praha 2016 STŘEDOŠKOLSKÁ ODBORNÁ ČINNOST


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním


Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21

Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21 Glosář - Cestina alely aneuploidie asistovaná reprodukce autozomálně dominantní autozomálně recesivní BRCA chromozom chromozomová aberace cytogenetický laborant de novo Různé formy genu, které se nacházejí


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


Druhová a mezidruhová hybridizace

Druhová a mezidruhová hybridizace Druhová a mezidruhová hybridizace Obsah Druhová a mezidruhová hybridizace... 1 Obsah... 1 Monohybridní křížení... 1 Dihybridní křížení... 2 Polyhybridní křížení... 3 Souhrn Mendelismus v dědičnosti kvalitativních


GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných



21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST 21. ČLOVĚK A DĚDIČNOST, GENETICKÁ PROMĚNLIVOST A. Metody studia dědičnosti člověka, dědičné choroby a dispozice k chorobám, genetické poradenství B. Mutace a její typy, modifikace, příklad z genetiky člověka


Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649


Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením


Genetická "oblast nejasnosti" u HCH: co to znamená? Genetický základ

Genetická oblast nejasnosti u HCH: co to znamená? Genetický základ Novinky ve výzkumu Huntingtonovy nemoci. Ve srozumitelném jazyce. Napsáno vědci. Určeno široké huntingtonské veřejnosti. Genetická "oblast nejasnosti" u HCH: co to znamená? Přechodní alely a alely s redukovanou

Více Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00


Nadaní v přírod. vědách. Jiřina Novotná Katedra matematiky Pedagogická fakulta MU Brno

Nadaní v přírod. vědách. Jiřina Novotná Katedra matematiky Pedagogická fakulta MU Brno Nadaní v přírod. vědách Jiřina Novotná Katedra matematiky Pedagogická fakulta MU Brno Úvod charakteristika nadaných Oblast poznávání: - schopnost manipulovat abstraktními symbolickými systémy, - schopnost


Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;


Praktické cvičení z genetiky: Dědičnost kvalitativních znaků, mimojaderná dědičnost, genetika člověka

Praktické cvičení z genetiky: Dědičnost kvalitativních znaků, mimojaderná dědičnost, genetika člověka Praktické cvičení z genetiky: Dědičnost kvalitativních znaků, mimojaderná dědičnost, genetika člověka Dědičnost kvantitativních znaků 1) Plemena Bantam a Plymouth představují dva kontrastní typy slepic.


Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce


Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho


QTL u psů. Genetika zbarvení u psů

QTL u psů. Genetika zbarvení u psů QTL u psů Tomarktus pochází z doby před 20 mil. lety a je nejstarším známým prapředkem dnešních psovitých šelem. Nejstarší nálezy prapředků psů se známkami domestikace pocházejí z dnešního území Iráku


Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). Orphanet - Volně přístupné webové stránky s informacemi


Národní program uchování a využívání genetických zdrojů zvířat

Národní program uchování a využívání genetických zdrojů zvířat METODIKA CHOVU GENETICKÝCH ZDROJŮ KRÁLÍKŮ První zmínky o chovu králíků na území Čech pocházejí ze 13. století, chovatelství jako takové se však začíná rozvíjet na počátku 19. století. V polovině 19. století


Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série


Rukověť genetiky pro chovatele potkanů

Rukověť genetiky pro chovatele potkanů Rukověť genetiky pro chovatele potkanů Příručka pro chovatele, kteří by se rádi dozvěděli, jak celá ta věc funguje Bc. Markéta Čacká Praha, 2013 Rukověť genetiky pro chovatele potkanů OBSAH Úvod... 3 Základy


1. Úvod do genetických algoritmů (GA)

1. Úvod do genetických algoritmů (GA) Obsah 1. Úvod do genetických algoritmů (GA)... 2 1.1 Základní informace... 2 1.2 Výstupy z učení... 2 1.3 Základní pomy genetických algoritmů... 2 1.3.1 Úvod... 2 1.3.2 Základní pomy... 2 1.3.3 Operátor


Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Obecná genetika Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Ing. Roman Longauer, CSc. Ústav zakládání a pěstění lesů, LDF MENDELU Brno Tento projekt je spolufinancován Evropským


11.12.2011 Brno - Lužánky Základy genetiky pro chovatele potkanů

11.12.2011 Brno - Lužánky Základy genetiky pro chovatele potkanů 11.12.2011 Brno - Lužánky Základy genetiky pro chovatele potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou



ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová


Proč nový systém odhadu plemenných hodnot?

Proč nový systém odhadu plemenných hodnot? Proč nový systém odhadu plemenných hodnot? Faktory ovlivňující užitkovost Chovatel Výživa Prostředí Užitkovost Genetická výbava 5-15% Zisk chovatele Spotřebitel Hodnocení zvířat 1900 KU 1920 vývoj metod



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti


Bochov. Genetika pro chovatele potkanů

Bochov. Genetika pro chovatele potkanů 14.5.2011 Bochov Genetika pro chovatele potkanů Osnova 1. Základy genetiky 2. Genetika tvaru těla 3. Genetika typu srsti 4. Genetika potkaních barev 5. Genetika potkaních znaků 6. Test znalostí alias soutěž
