binding protein alpha (CEBPA) a prognostický význam mutací v jeho genu u Ota Fuchs, Arnošt t Kostečka, Monika

Rozměr: px
Začít zobrazení ze stránky:

Download "binding protein alpha (CEBPA) a prognostický význam mutací v jeho genu u Ota Fuchs, Arnošt t Kostečka, Monika"


1 Transkripční faktor CCAAT/enhancer binding protein alpha (CEBPA) a prognostický význam mutací v jeho genu u akutní myeloidní leukemie Ota Fuchs, Arnošt t Kostečka, Monika Holická,, Martin Vostrý, ÚHKT Praha

2 Transkripční faktor C/EBPα transaktivační oblasti oblast pro vazbu k DNA oblast leucinového zipu odpovědná za homodimerizaci nebo heterodimerizaci 1. místo iniciace translace ATG TAD1 TAD2 DBD ZIP 2. místo iniciace translace ATG aa N-konec C-konec nt C/EBPα-42 C/EBPα-3 (42kDa) (3kDa)






8 Zejména pro s normálním karyotypem (4-45% případů ) je významná analýza důležitých prognotických faktorů: mutace transkripčního faktoru CCAAT/enhancerbinding protein (C/EBP) alfa (CEBPA) a mutace nukleofosminu (NPM1), oboje spojené s lepší než průměrnou prognózou.

9 Tabulka 1 Přehled vzorků pacientů a zdravých jedinců odpovídajícího stáří analyzovaných na přítomnost polymorfizmu a mutací CEBPA Analyzované osoby Zdraví jedinci MDS MM NHL Počet a P1 hom. e P1 het. f b P2 hom. P2 het c P3 hom P3 het d P4 het Mutace het a b c d e f P1-polymorfizmus 42 G>A podle GenBank Accesion No. NM_4364 a 993 G>A podle GenBank Accesion No. U347 P2-polymorfizmus 573 C>T podle GenBank Accesion No. NM_4364 a 1164 C>T podle GenBank Accesion No. U347 P3-polymorfizmus 69 G>T podle GenBank Accesion No. NM_4364 a 1281 G>T podle GenBank Accesion No. U347 P4-polymorfizmus dup podle GenBank Accesion No. NM_4364 a dup podle GenBank Accesion No. U347 homozygotní heterozygotní

10 Tabulka 2 Přehled P detekovaných mutací v kódujk dující oblasti CEBPA Číslo Pacien -ta Choro -ba Věk/ pohl FAB Cytogeneti ka Změna nukleotido -vé sekvence b Změna nukleotidové sekvence c Změna aminokyselino -vé sekvence Důsledky mutace /F ND 46,XX,inv( 9)[22] 6_155 del 1191_1646del H2_K352de l insq delece oblastí TAD2, DBD a ZIP /F ND 41-45,XX,kom plex.změna karyotypu 924_925ins TG 1515_1516insTG E39fsX318 posun čtecího rámce (frameshift) mezi oblastmi DBD a ZIP, ukončení-stop kodon v ZIP 638_1114 del 1229_175del C213_A358de latgdelx /F ND 46,XX[22] 541del 1132del Y181fsX316 posun čtecího rámce mezi oblastmi TAD1 a TAD2, ukončení- stop kodon mezi DBD a ZIP B42 48/F M1 46,XX[13] 542_543ins A 1133_1134insA Y181X ukončení- stop kodon mezi TAD1 a TAD2 1 29/M M1 46,XY,22p +[22] 68del 659del P23fsX159 posun čtecího rámce před TAD1, ukončení- stop kodon mezi TAD1 a TAD2 912_929del 153_152del Q35_T31de l delece v DBD 8 68/F ND 46,XX[22] 68del 659del P23fsX159 posun čtecího rámce před TAD1, ukončení- stop kodon mezi TAD1 a TAD2

11 /F ND ND 311_313del 92_94del G14del delece v TAD /M ND 46,XY[1]/47,X Y,+8[1] 26_411del 851_12del Q87fsX119 posun čtecího rámce a ukončení-stop kodon v TAD2, delece oblasti TAD /M M4 46,XY[22] 392_393ins A 983_984insA Y131X ukončení-stop kodon mezi TAD1 a TAD2 912_913ins TTG 153_154ins TTG K34_Q35insL inserce v oblasti DBD /M M4 46,XY[9]/47,XY, +8[13] 722 _746 del 1313_1337del L241fsX313 posun čtecíhorámce v DBD, ukončení- stop kodon mezi DBD a ZIP /M M6 46,XY[16]/44~54 XY, heterodiploidie [4] 899 G>T 149 G>T R3L záměna v DBD 18 61/M ND 46,XY[22] 656_794del 1247_1385del H219fsX272 delece, posun čtecího rámce a ukončení-stop kodon mezi TAD1 a TAD /F M 46,XX[5] 238_239ins G 829_83insG D8fsX17 posun čtecího rámce a ukončení-stop kodon mezi TAD1 a TAD 2, mutace indukovaná terapií

12 1591 MDS 76/F N D ND 18_389del 69_98del Y7_G13del delece v oblasti TAD MDS 25/F N D 46,XX[18] 26_411del 851_12del Q87fsX119 posun čtecího rámce a ukončení-stop kodon v TAD2, delece TAD MDS 75/F N D ND 5_52del 191_193de l E167del delece mezi TAD1 a TAD MDS 53/F N D ND 311_313del 92_94del G14del delece v TAD1 123 MDS- RAEB 6/F 46,XX[22] 477_478ins GTCCCCC 168_169in sgtccccc I16fsX171 ukončení- stop kodon v TAD MDS- RAEB 65/ M 46,XY[19]/47,XY,+8[3] 169_173 del 166_1664 del A358fs X42 posun čtecího rámce r v oblasti stop kodonu a delší protein

13 Overall survival [% ] 1 9 P = n = 15 5 n = n = Months CEBPA mutated/flt3 wild type CEBPA mutated/flt3 mutated CEBPA wild type

14 Overall survival [%] P =.584 n = 2 n = Months mut CEBPA/wt Flt3/nT wt CEBPA/wt FLT3/nT

15 Overall survival [%] P =.278 n = 292 n = Months mut CEBPA/mut Flt3 wt CEBPA




19 Fuchs O., Provaznikova D., Kocova M., Kostecka A., Neuwirtova R., Kobylka P., Cermak J., Brezinova J., Schwarz J., Salaj P., Klamova H., Maaloufova J., Lemez P., Novakova L., Benesova K. (28) CEBPA polymorphisms and mutations in patients with acute myeloid leukemia, myelodysplastic syndrome, multiple myeloma and non- Hodgkin s lymphoma. Blood Cells Mol.Diseases 4,

20 Fuchs O.: Growth-inhibiting activity of transcription factor C/EBP EBPα,, its role in haematopoiesis and its tumour suppressor or oncogenic properties in leukaemias Folia Biologica 53, (27). Fuchs O. Transcrription Factor C/EBP EBPα and its Effects on Cell Cycle Regulation,, in Cell Cycle Control: New Research,editors Nathan H.Leroy and Noah T.Fournier Fournier,, NOVA Publishers 28

21 Fuchs O, Kostecka A, Provaznikova D, Krasna B, Brezinova J, Filkukova J, Kotlin R, Kouba M, Kobylka P, Neuwirtova R, Jonasova A, Caniga M, Schwarz J, Markova J, Maaloufova J, Sponerova D, Novakova L, Cermak J: Nature of Frequent Deletions in CEBPA -Blood Cells Mol.Diseases 43, (29).

22 Poděkov kování patří Mgr. Daně Provazníkov kové, která se s námi n podílela na zavedení analýzy mutací,, RNDr. Janě Březinové za cytogenetická vyšet etření,, Ing. Janě Markové za některn které vzorky pro retrospektivní analýzu a všem v klinickým lékařům, kteří nám m poslali kostní dřeň nebo periferní krev k analýze.

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní


Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009

Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková. Parent projekt. Praha 19.2.2009 Potřebné genetické testy pro výzkum a jejich dostupnost, spolupráce s neurology Taťána Maříková Parent projekt Praha 19.2.2009 Diagnostika MD její vývoj 1981-1986: zdokonalování diferenciální diagnostiky


Leukemie a myeloproliferativní onemocnění

Leukemie a myeloproliferativní onemocnění Leukemie a myeloproliferativní onemocnění Myeloproliferativní tumory Klonální onemocnění hematopoetických stem cells charakterizované proliferací jedné nebo více myeloidních řad. Dospělí peak 5. 7. dekáda,


Molekulární diagnostika pletencové svalové dystrofie typu 2A

Molekulární diagnostika pletencové svalové dystrofie typu 2A Molekulární diagnostika pletencové svalové dystrofie typu 2A Lenka Fajkusová Centrum molekulární biologie a genové terapie Fakultní nemocnice Brno Pletencové svalové dystrofie (Limb Girdle Muscular Dystrophy





Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová

Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Cytogenetické vyšetřovací metody v onkohematologii Zuzana Zemanová Centrum nádorové cytogenetiky Ústav klinické biochemie a laboratorní diagnostiky VFN a 1. LF UK v Praze Klinický význam cytogenetických


Hypereozinofilní syndrom (HES) a chronická eozinofilní leukemie (CEL)

Hypereozinofilní syndrom (HES) a chronická eozinofilní leukemie (CEL) Hypereozinofilní syndrom (HES) a chronická eozinofilní leukemie (CEL) Chrobák L II. interní klinika, Oddělení klinické hematologie, LFHK a FN Hradec Králové Eozinofily Normální počet 0,1 0,5 x10 9 /l Regulace


Platnost od: 1. 11. 2015 Uvolněno pro systém: 1. 11. 2015 Výtisk č: 02 Počet stran: 12 Verze: A1 Přijato do evidence: 1. 11. 2015

Platnost od: 1. 11. 2015 Uvolněno pro systém: 1. 11. 2015 Výtisk č: 02 Počet stran: 12 Verze: A1 Přijato do evidence: 1. 11. 2015 Zpracovatel: M. Vostrý Podpis: Přezkoumal a schválil: M. Beličková Podpis: Garant dokumentu: M. Beličková Podpis: Platnost od: 1. 11. 2015 Uvolněno pro systém: 1. 11. 2015 Výtisk č: 02 Počet stran: 12


Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc

Akutní leukémie a myelodysplastický syndrom. Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie a myelodysplastický syndrom Hemato-onkologická klinika FN a LF UP Olomouc Akutní leukémie (AL) Představují heterogenní skupinu chorob charakterizovaných kumulací klonu nevyzrálých, nádorově


Myeloproliferativní tumory

Myeloproliferativní tumory Myeloproliferativní tumory Klonální onemocnění hematopoetických stem cells charakterizované proliferací jedné nebo více myeloidních řad. Dospělí peak 5. 7. dekáda, CML a ET, také u dětí Hypercelulární


Genetický screening predispozice k celiakii

Genetický screening predispozice k celiakii VETERINÁRN RNÍ A FARMACEUTICKÁ UNIVERZITA BRNO Farmaceutická fakulta Ústav humánn nní farmakologie a toxikologie Genetický screening predispozice k celiakii RNDr. Ladislava Bartošov ová,ph.d. 1, PharmDr.


Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty J.Berkovcová, M.Dziechciarková, M.Staňková, A.Janošťáková, D.Dvořáková, M.Hajdúch Laboratoř


Roman Hájek Tomáš Jelínek. Plazmocelulární leukémie (PCL)

Roman Hájek Tomáš Jelínek. Plazmocelulární leukémie (PCL) Roman Hájek Tomáš Jelínek Plazmocelulární leukémie (PCL) Definice (1) vzácná forma plazmocelulární dyskrázie nejagresivnější z lidských monoklonálních gamapatií incidence: 0,04/100 000 obyvatel evropské


Gibbsovo samplování a jeho využití

Gibbsovo samplování a jeho využití Gibbsovo samplování a jeho využití Regulace genů Hlavní pozornost výzkumů DNA je většinou věnována analýze genů Geny tvoří pouhá 3% lidské DNA Ukazuje se, že zbývající junk DNA má také velký význam Obsahuje


Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA

Cytogenetika. chromosom jádro. telomera. centomera. telomera. buňka. histony. páry bazí. dvoušroubovice DNA Cytogenetika telomera chromosom jádro centomera telomera buňka histony páry bazí dvoušroubovice DNA Typy chromosomů Karyotyp člověka 46 chromosomů 22 párů autosomů (1-22 od největšího po nejmenší) 1 pár


Chromozomální aberace nalezené u párů s poruchou reprodukce v letech

Chromozomální aberace nalezené u párů s poruchou reprodukce v letech Chromozomální aberace nalezené u párů s poruchou reprodukce v letech 2000-2005 Jak přistupovat k nálezům minoritních gonozomálních mozaik? Šantavá A., Adamová, K.,Čapková P., Hyjánek J. Ústav lékařské


Transplantace kostní dřeně (BMT, HCT, PBPC,TKD) ( transplantace krvetvorných buněk, periferních kmenových buněk)

Transplantace kostní dřeně (BMT, HCT, PBPC,TKD) ( transplantace krvetvorných buněk, periferních kmenových buněk) Transplantace kostní dřeně (BMT, HCT, PBPC,TKD) ( transplantace krvetvorných buněk, periferních kmenových buněk) Transplantace transfuze koncentrátu krvetvorných progenitorových buněk (štěp) pacientovi


Struktura a funkce biomakromolekul

Struktura a funkce biomakromolekul Struktura a funkce biomakromolekul KBC/BPOL 7. Interakce DNA/RNA - protein Ivo Frébort Interakce DNA/RNA - proteiny v buňce Základní dogma molekulární biologie Replikace DNA v E. coli DNA polymerasa a



SEZNAM LABORATORNÍCH VYŠETŘENÍ Laboratoř morfologická SME 8/001/01/VERZE 01 SEZNAM LABORATORNÍCH VYŠETŘENÍ Cytologické vyšetření nátěru kostní dřeně Patologické změny krevního obrazu, klinická symptomatologie s možností hematologického


-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat


6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního


Translace (druhý krok genové exprese)

Translace (druhý krok genové exprese) Translace (druhý krok genové exprese) Od RN k proteinu Milada Roštejnská Helena Klímová 1 enetický kód trn minoacyl-trn-synthetasa Translace probíhá na ribosomech Iniciace translace Elongace translace


Projekt CAMELIA Projekt ALERT

Projekt CAMELIA Projekt ALERT Projekt Alert akutní leukemie klinický registr x Web projektu Diskusní klub projektu Management dat Služby IS Help Zpět Analytické nástroje Prohlížeč dat Expertní služby x Projekt CAMELIA Projekt ALERT


Mgr. Zuzana Kufová , Mikulov. Genomické analýzy u Waldenströmovy makroglobulinémie

Mgr. Zuzana Kufová , Mikulov. Genomické analýzy u Waldenströmovy makroglobulinémie Mgr. Zuzana Kufová 10.4.2015, Mikulov Genomické analýzy u Waldenströmovy makroglobulinémie Obsah přednášky Genomický profil u WM Mutace v genu MYD88 Mutace v genu CXCR4 Diagnostika Výsledky


Zuzana Kufová 10.4.2015, Mikulov. Analýza u amyloidóz, hereditárních amyloidóz

Zuzana Kufová 10.4.2015, Mikulov. Analýza u amyloidóz, hereditárních amyloidóz Zuzana Kufová 10.4.2015, Mikulov Analýza u amyloidóz, hereditárních amyloidóz Obsah přednášky Hereditární amyloidózy - hereditární amyloidózy - proteiny akutní fáze AL amyloidóza


ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii ONKOGENETIKA Spojuje: - lékařskou genetiku - buněčnou biologii - molekulární biologii - cytogenetiku - virologii Důležitost spolupráce různých specialistů při detekci hereditárních forem nádorů - (onkologů,internistů,chirurgů,kožních


Roman Hájek. Zbytkové nádorové onemocnění. Mikulov 5.září, 2015

Roman Hájek. Zbytkové nádorové onemocnění. Mikulov 5.září, 2015 Roman Hájek Zbytkové nádorové onemocnění Mikulov 5.září, 2015 Zbytkové nádorové onemocnění 1. Minimal residual disease (MRD) Proč lékaře zbytkové nádorové onemocnění stále více zajímá? Protože se zásadně





Pavlína Tinavská Laboratoř imunologie, Nemocnice České Budějovice

Pavlína Tinavská Laboratoř imunologie, Nemocnice České Budějovice Pavlína Tinavská Laboratoř imunologie, Nemocnice České Budějovice nízce agresivní lymfoproliferativní onemocnění základem je proliferace a akumulace klonálních maligně transformovaných vyzrálých B lymfocytů


Zajímavé kazuistiky z laboratoře

Zajímavé kazuistiky z laboratoře Zajímavé kazuistiky z laboratoře Kamila Kutějová a kol. Spadia Lab Setkání uživatelů Průtokové cytometrie Beckman Coulter květen 2016, Mikulov Myelom biklonální Pacientka 80 let, hematoonkol.ambulance


Polychromatická cytometrie v hemato-onkologii

Polychromatická cytometrie v hemato-onkologii Polychromatická cytometrie v hemato-onkologii Tomáš Kalina, Ester Mejstříková, Ondřej Hrušák Klinika dětské hematologie a onkologie Univerzita Karlova, 2. LF a FN Motol - cytometrie


Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění


Přehled výzkumných aktivit

Přehled výzkumných aktivit Přehled výzkumných aktivit ROK 2004 Lenka Zahradová Laboratoř experimentální hematologie a buněčné imunoterapie Oddělení klinické hematologie FNB Bohunice Přednosta: prof. MUDr. M. Penka, CSc. Oddělení


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti URČOVÁNÍ PRIMÁRNÍ STRUKTURY BÍLKOVIN

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti URČOVÁNÍ PRIMÁRNÍ STRUKTURY BÍLKOVIN Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti URČOVÁNÍ PRIMÁRNÍ STRUKTURY BÍLKOVIN Primární struktura primární struktura bílkoviny je dána pořadím AK jejích polypeptidových řetězců


II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch


cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD Shrnutí webináře Dystrofin 101: vše, co jste kdy chtěli vědět o dystrofinu (a nebáli jste se zeptat) Francesco Muntoni (University College of London), John Porter (PPMD) Dystrofinopatie: DMD versus BMD


Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech

Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Přínos molekulární genetiky pro diagnostiku a terapii malignit GIT v posledních 10 letech Minárik M. Centrum aplikované genomiky solidních nádorů (CEGES), Genomac výzkumný ústav, Praha XXIV. JARNÍ SETKÁNÍ





Výsledky léčby Waldenströmovy makroglobulinemie na IHOK FN Brno

Výsledky léčby Waldenströmovy makroglobulinemie na IHOK FN Brno C Z E C H G R O U P C Z E C H G R O U P Výsledky léčby Waldenströmovy makroglobulinemie na IHOK FN Brno Luděk Pour IHOK FN Brno 10-11.4. 2015 XIII. Roční setkání CMG C M G Č E S K Á M YE LO M O VÁ S K


BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.


Studijní materiály pro bioinformatickou část ViBuChu. úloha II. Jan Komárek, Gabriel Demo

Studijní materiály pro bioinformatickou část ViBuChu. úloha II. Jan Komárek, Gabriel Demo Studijní materiály pro bioinformatickou část ViBuChu úloha II Jan Komárek, Gabriel Demo Adenin Struktura DNA Thymin 5 konec 3 konec DNA tvořena dvěmi řetězci orientovanými antiparalelně (liší se orientací


Nukleové kyseliny Replikace Transkripce translace

Nukleové kyseliny Replikace Transkripce translace Nukleové kyseliny Replikace Transkripce translace Figure 4-3 Molecular Biology of the Cell ( Garland Science 2008) Figure 4-4 Molecular Biology of the Cell ( Garland Science 2008) Figure 4-5 Molecular


Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI


Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi


Proteiny Genová exprese. 2013 Doc. MVDr. Eva Bártová, Ph.D.

Proteiny Genová exprese. 2013 Doc. MVDr. Eva Bártová, Ph.D. Proteiny Genová exprese 2013 Doc. MVDr. Eva Bártová, Ph.D. Bílkoviny (proteiny), 15% 1g = 17 kj Monomer = aminokyseliny aminová skupina karboxylová skupina α -uhlík postranní řetězec Znát obecný vzorec


Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem


1.12.2009. Buněčné kultury. Kontinuální kultury

1.12.2009. Buněčné kultury. Kontinuální kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace ztrácejí diferenciační


Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin


Příloha I. Vědecké závěry a zdůvodnění změny v registraci

Příloha I. Vědecké závěry a zdůvodnění změny v registraci Příloha I Vědecké závěry a zdůvodnění změny v registraci 1 Vědecké závěry S ohledem na hodnotící zprávu výboru PRAC týkající se pravidelně aktualizované zprávy/aktualizovaných zpráv o bezpečnosti (PSUR)



DMPK (ZNF9) V DIFERENCOVANÝCH. Z, Kroupová I, Falk M* M FISH ANALÝZA m-rna DMPK (ZNF9) V DIFERENCOVANÝCH TKÁNÍCH PACIENT IENTŮ S MYOTONICKOU DYSTROFI FIÍ Lukáš Z, Kroupová I, Falk M* M Ústav patologie FN Brno *Biofyzikáln lní ústav AVČR R Brno Definice MD Myotonická


Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno

Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie, LF MU, Brno Zpracování a využití biologického materiálu pro výzkumné účely od nemocných s monoklonální gamapatií Ing. Martina Almáši, Ph.D. OKH-LEHABI FN Brno, Babákova myelomová skupina při Ústavu patologické fyziologie,


Diagnostika a příznaky mnohočetného myelomu. J.Minařík, V.Ščudla

Diagnostika a příznaky mnohočetného myelomu. J.Minařík, V.Ščudla Diagnostika a příznaky mnohočetného myelomu J.Minařík, V.Ščudla Mnohočetný myelom Nekontrolované zmnožení nádorově změněných plasmatických buněk v kostní dřeni Mnohočetný = obvykle více oblastí kostní


IMALAB s.r.o. U Lomu 638, Zlín

IMALAB s.r.o. U Lomu 638, Zlín Pracoviště zdravotnické laboratoře: 1. Laboratoř molekulární biologie 2. Cytogenetická laboratoř 3. Imunoanalytická laboratoř 4. Biochemická laboratoř tř. T. Bati 3705, 760 01 Zlín 4.1 Odběrové a sběrné


Buněčné kultury. Kontinuální kultury

Buněčné kultury. Kontinuální kultury Buněčné kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace


Ě ÁÁ Ú é é ý ů ý ů é ý ů é é ú Ž ý ů é ů é é Ě ÁÁ Ú é Ý ž ý ž ý ý ů ž ů ň é Ž ý Ž ů ý é é é é ý ž Í Ě ÁÁ Ú é é ň é Ž ý ž Ž Í ý é ý Í ů ý ý ý é ý é ý é ň Ž Ž Ě ÁÁ Ú é é ý Ý é é ý Ž Í Í é ž Í Ž Ě ÁÁ Ú é


Buněčné kultury Primární kultury

Buněčné kultury Primární kultury Buněčné kultury Primární kultury - odvozené přímo z excise tkáně buněčné linie z různých organizmů, tkání explantované kultury jednobuněčné suspense lze je udržovat jen po omezenou dobu během kultivace


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován


Diferenciální diagnostika lymfadenomegalie a splenomegalie. Vít Procházka

Diferenciální diagnostika lymfadenomegalie a splenomegalie. Vít Procházka Diferenciální diagnostika lymfadenomegalie a splenomegalie Vít Procházka Motto Sebelepší hematoonkolog se neobejde bez spolupráce s lékařem prvního kontaktu. Mezioborová spolupráce je základem správné


Diagnostika a příznaky mnohočetného myelomu

Diagnostika a příznaky mnohočetného myelomu Diagnostika a příznaky mnohočetného myelomu J.Minařík, V.Ščudla Mnohočetný myelom Nekontrolované zmnožení nádorově změněných plasmatických buněk v kostní dřeni Mnohočetný = obvykle více oblastí kostní


Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie


Transfer of Regenerative medicine products into practice in biotech park 4MEDi. Jakub Schůrek 19.5.2016 Ostrava

Transfer of Regenerative medicine products into practice in biotech park 4MEDi. Jakub Schůrek 19.5.2016 Ostrava Transfer of Regenerative medicine products into practice in biotech park 4MEDi Jakub Schůrek 19.5.2016 Ostrava Osnova Infrastruktura 4MEDi Případové studie projektů ve 4MEDi: 1. SCL biological Czech s.r.o.





Molecular-cytogenetic analysis of chromosome 11 aberrations in hematological malignancies

Molecular-cytogenetic analysis of chromosome 11 aberrations in hematological malignancies Univerzita Karlova v Praze 1. lékařská fakulta Doktorské studijní programy v biomedicíně Studijní obor: Molekulární a buněčná biologie, genetika a virologie RNDr. Iveta Šárová Molekulárně cytogenetická


Proteinové znaky dětské leukémie identifikované pomocí genových expresních profilů

Proteinové znaky dětské leukémie identifikované pomocí genových expresních profilů Proteinové znaky dětské leukémie identifikované pomocí genových expresních profilů M.Vášková a spol. Klinika dětské hematologie a onkologie 2.LF UK a FN Motol Childhood Leukemia Investigation Prague Průtoková


Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace


Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický!

Typy chromosomů. A telocentrický B akrocentrický C submetacentrický D metacentrický. Člověk nemá typ telocentrický! Karyologie Typy chromosomů A telocentrický B akrocentrický C submetacentrický D metacentrický Člověk nemá typ telocentrický! Chromosom chromosom telomera jádro centomera telomera buňka histony dvoušroubovice


Myelodysplastický syndrom v novém tisíciletí.

Myelodysplastický syndrom v novém tisíciletí. Pùvodní práce Myelodysplastický syndrom v novém tisíciletí. Jak klasifikovat a jak léèit nemocné? J. Čermák 1, A. Vítek 1, K. Michalová 1,2, J. Březinová 1, Z. Zemanová 2 1 Ústav hematologie a krevní transfuze,


GENOTOXICITA LÉČIV. Klára A. Mocová. VŠCHT Praha Fakulta technologie ochrany prostředí Ústav chemie ochrany prostředí

GENOTOXICITA LÉČIV. Klára A. Mocová. VŠCHT Praha Fakulta technologie ochrany prostředí Ústav chemie ochrany prostředí GENOTOXICITA LÉČIV Klára A. Mocová VŠCHT Praha Fakulta technologie ochrany prostředí Ústav chemie ochrany prostředí Centralizovaný rozvojový projekt MŠMT č. C29: Integrovaný systém vzdělávání v oblasti


Mgr. Eva Flodrová FN Brno,Oddělení lékařské genetiky Laboratoř molekulární diagnostiky.

Mgr. Eva Flodrová FN Brno,Oddělení lékařské genetiky Laboratoř molekulární diagnostiky. Mgr. Eva Flodrová FN Brno,Oddělení lékařské genetiky Laboratoř molekulární diagnostiky enzymy katalyzující oxidativní metabolické reakce xenobiotik provádějí redukci C-, N-, S-, hydroxylaci,


Bílkoviny a rostlinná buňka

Bílkoviny a rostlinná buňka Bílkoviny a rostlinná buňka Bílkoviny Rostliny --- kontinuální diferenciace vytváření orgánů: - mitotická dělení -zvětšování buněk a tvorba buněčné stěny syntéza bílkovin --- fotosyntéza syntéza bílkovin


Molekulárně cytogenetické vyšetření pacientů s mnohočetným myelomem na OLG FN Brno

Molekulárně cytogenetické vyšetření pacientů s mnohočetným myelomem na OLG FN Brno Molekulárně cytogenetické vyšetření pacientů s mnohočetným myelomem na OLG FN Brno Filková H., Oltová A., Kuglík P.Vranová V., Kupská R., Strašilová J., Hájek R. OLG FN Brno, PřF MU Brno, IHOK FN Brno


doc. MUDr. Dagmar Pospíšilová, Ph.D. MUDr. Martina Suková

doc. MUDr. Dagmar Pospíšilová, Ph.D. MUDr. Martina Suková Pátek 10. 10. 11.00-19.00 Registrace 13.00-13.15 Zahájení 13.15-15.00 Neonkologická hematologie blok 1 doc. MUDr. Dagmar Pospíšilová, Ph.D. MUDr. Martina Suková 1 Divoká Martina Vzácné hemoglobinové varianty


Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace

Klasifikace mutací. Z hlediska lokalizace mutací v genotypu. Genové mutace. Chromozomální mutace. Genomové mutace Mutace Klasifikace mutací Z hlediska lokalizace mutací v genotypu Genové mutace Chromozomální mutace Genomové mutace Vznik genových mutací Tranzice pyrim. za pyrim. C na T T na C purin za purin A na G



PŘÍLOHA I SOUHRN ÚDAJŮ O PŘÍPRAVKU PŘÍLOHA I SOUHRN ÚDAJŮ O PŘÍPRAVKU 1 1. NÁZEV PŘÍPRAVKU VPRIV 200 U prášek pro přípravu infuzního roztoku 2. KVALITATIVNÍ A KVANTITATIVNÍ SLOŽENÍ Jedna injekční lahvička obsahuje 200 jednotek* (U) velaglucerasum


Mutageneze vznik chyby na DNA mutagen (chemická látka / záření)

Mutageneze vznik chyby na DNA mutagen (chemická látka / záření) Genotoxicita - úvod Genotoxicita: toxická látka ovlivňuje genetický materiál buňky (nukleové kyseliny) Při působení vyšších koncentrací genotoxických látek dochází k přímému úhynu buněk Nižší koncentrace


Léčba anémie erytropoézu stimulujícími proteiny u pacientů s myelodysplastickým syndromem

Léčba anémie erytropoézu stimulujícími proteiny u pacientů s myelodysplastickým syndromem 101 Léčba anémie erytropoézu stimulujícími proteiny u pacientů s myelodysplastickým syndromem Magda Šišková 1. interní klinika hematoonkologie, Všeobecná fakultní nemocnice a 1. lékařská fakulta Univerzity



MYELOFIBROSA - DIAGNOSTIKA A LÉČEBNÉ MOŽNOSTI MYELOFIBROSA - DIAGNOSTIKA A LÉČEBNÉ MOŽNOSTI DEFINICE: chronické myeloproliferativní (klonální) onemocnění charakteristické zmnožením vaziva v kostní dřeni a extramedulární krvetvorbou (první popis -


Akutní myeloidní leukémie

Akutní myeloidní leukémie Akutní myeloidní leukémie Prof. MUDr. Petr Cetkovský, Ph.D. Ústav klinické a experimentální hematologie 1. LF a ÚHKT AML - incidence Geneticky heterogenní nemoc s akumulací získaných genetických alterací


Režimy s nízkým rizikem FN riziko do 10 % Režimy se středním rizikem FN riziko 10 19% Režimy s vysokým rizikem FN riziko 20 a více procent

Režimy s nízkým rizikem FN riziko do 10 % Režimy se středním rizikem FN riziko 10 19% Režimy s vysokým rizikem FN riziko 20 a více procent Portál DIOS verze II Druhá verze portálu DIOS a jeho elektronické knihovny chemorežimů přináší nové informace a nové nástroje týkající se problematiky toxicity chemoterapie. Jde především o problematiku


Patologie krevního ústrojí. II. histologické praktikum 3. ročník všeobecného směru

Patologie krevního ústrojí. II. histologické praktikum 3. ročník všeobecného směru Patologie krevního ústrojí II. histologické praktikum 3. ročník všeobecného směru H&E Polycythaemia vera Giemsa Erythroidní proliferace Glycophorin C Polycythaemia vera ABNORMAL MEGAKARYOCYTIC PROLIFERATION



DIAGNOSTICKÝ A LÉČEBNÝ POSTUP U CHRONICKÉ MYELOIDNÍ LEUKEMIE DOSPĚLÝCH (nebo Algoritmus vyšetření a léčby CML v roce 2008) DIAGNOSTICKÝ A LÉČEBNÝ POSTUP U CHRONICKÉ MYELOIDNÍ LEUKEMIE DOSPĚLÝCH (nebo Algoritmus vyšetření a léčby CML v roce 2008) Úvod V České republice každoročně onemocní chronickou myeloidní leukemií (CML)


QIAsymphony DSP DNA Kits

QIAsymphony DSP DNA Kits QIAsymphony DSP DNA Kits QIAsymphony DSP DNA Kity jsou určené k použití pouze v kombinaci s QIAsymphony SP. QIAsymphony DSP DNA Mini Kity poskytují reagencie pro automatickou izolaci celkové DNA z lidské


Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie

Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie 1) Zadávání témat dle studovaného oboru 2) Přehled řešených témat v minulosti 3) 4) Přehled externích školících pracovišť Zaměření


1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická





Spinální svalová atrofie. Vypracovali: Kateřina Teplá Monika Madrová Anna Dobrovolná Mária Čižmárová Dominika Štrbová Juraj Štipka

Spinální svalová atrofie. Vypracovali: Kateřina Teplá Monika Madrová Anna Dobrovolná Mária Čižmárová Dominika Štrbová Juraj Štipka Spinální svalová atrofie Vypracovali: Kateřina Teplá Monika Madrová Anna Dobrovolná Mária Čižmárová Dominika Štrbová Juraj Štipka Klinický popis - relativně vzácná nemoc, nicméně se jedná o nejčastější




Ď Ů Ň ž Ů ž ň ž ž ž Č Č Ď Č ž Ě ž ž ž ž ň ž ž ž ž ž ž ž Ě ň ž ž ž ž Ďž ň ž Č Č ň Č Ď Ě Ň Č Ň ž ž ž Ů ň Ň ž ň ň ž ň ň ň ž ň ž Č ž ž Ř ž ž ž ž ň ž ž ž ž Ř ž ň ž ž ž ž ž ž ž Ě Ě Ě Č ž Ď Ř ž ň ň Ř ž ž ž ž


Screening kolorektálního karcinomu proč ANO

Screening kolorektálního karcinomu proč ANO Screening kolorektálního karcinomu proč ANO Doc. Zdeněk Beneš, CSc. Thomayerova nemocnice Proč screeningový program KRK 2014 predikce 8 743 nových případů Přes 4 000 pacientů zemře Většina pacientů chodí


rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu

rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu Genealogie Monogenní dědičnost rodokmeny vazby mezi členy rodiny + popis pro konkrétní sledovaný znak využití Mendelových zákonů v lékařství genetické konzultace o možném výskytu onemocnění v rodině Genealogické


Alzheimerova choroba. senility nádoba? Helena Janíčková 8.3.2012, Krásný Ztráty

Alzheimerova choroba. senility nádoba? Helena Janíčková 8.3.2012, Krásný Ztráty Alzheimerova choroba senility nádoba? Helena Janíčková 8.3.2012, Krásný Ztráty Alzheimerova choroba senilita demence stařecká demence další typy demence... Peter Falk Charles Bronson Charlton Heston Marice


Genetika člověka / GCPSB. Radim Vrzal

Genetika člověka / GCPSB. Radim Vrzal Genetika člověka / GCPSB Radim Vrzal Analýza chromosomů a s nimi spojených nemocí (část I.) Genetický materiál: Chromosomy Série buněčných dělení Zygota + Úkoly genetického systému Jak každá buňka dostane


ZÍSKANÉ CHROMOSOMOVÉ ABERACE. Vytvořilo Oddělení lékařské genetiky FN Brno

ZÍSKANÉ CHROMOSOMOVÉ ABERACE. Vytvořilo Oddělení lékařské genetiky FN Brno ZÍSKANÉ CHROMOSOMOVÉ ABERACE CHROMOSOMOVÉ ABERACE (CHA) Cílem cytogenetického vyšetření je zjištění přítomnosti / nepřítomnosti chromosomových aberací (patologických chromosomových změn) TYPY ZÍSKANÝCH


MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční


Program konference. XI. workshop mnohočetný myelom s mezinárodní účastí. Roční setkání. České myelomové skupiny. Mikulov 26. 27.4.

Program konference. XI. workshop mnohočetný myelom s mezinárodní účastí. Roční setkání. České myelomové skupiny. Mikulov 26. 27.4. Program konference XI. workshop mnohočetný myelom s mezinárodní účastí a Roční setkání České myelomové skupiny Mikulov CZECH CMG M Y E L O M A GROUP ČESKÁ MYELOMOVÁ SKUPINA PROGRAM Čtvrtek 25.4.2013 19.00


,, Cesta ke zdraví mužů

,, Cesta ke zdraví mužů PREZENTACE VÝSLEDKŮ ŘEŠENÍ PILOTNÍHO PROJEKTU PREVENTIVNÍ PÉČE PRO MUŢE,, Cesta ke zdraví mužů prim. MUDr. Monika Koudová GHC GENETICS, s.r.o.- NZZ, Praha Projekt byl realizován ve dvou etapách: I. etapa


Stratifikace pacientů, prognostické faktory. Jana Katolická FN u svaté Anny, Brno

Stratifikace pacientů, prognostické faktory. Jana Katolická FN u svaté Anny, Brno Stratifikace pacientů, prognostické faktory Jana Katolická FN u svaté Anny, Brno mcrcp heterogenní onemocnění Absence validovaných biomarkerů pro identifikaci pacienta : Se špatnou prognózou Rezistentní

Více Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu ;
