Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Rozměr: px
Začít zobrazení ze stránky:

Download "Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk"


1 MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk Diplomová práce Brno 2007 Lenka Činčárová

2 Ráda bych tímto poděkovala svojí školitelce Mgr. Marii Brázdové, Ph.D. za cenné rady, odborné vedení, pomoc a připomínky při tvorbě této diplomové práce. Dále bych ráda poděkovala Veronice Kudláčkové a celému kolektivu LBCHMO za vytvoření příjemné pracovní atmosféry a inspirativního prostředí. Dekuji také své rodině za podporu během studia. Tato práce byla vypracována na Biofyzikálním ústavu Akademie Věd ČR v Brně v Laboratoři biofyzikální chemie a molekulární onkologie.

3 SEZNAM ZKRATEK aa aminokyselinové zbytky Amp ampicilin Amp r rezistence k ampicilinu bp páry bazí BSA hovězí sérový albumin DBSS strukturně selektivní vazba na DNA (DNA structure-selective binding) DEPC diethylpyrokarbonát, inhibitor RNAázy dsdna dvouřetězcová DNA (double stranded DNA) DTT 1,4-dithio-1-treitol EDTA ethylendiamintetraoctová kyselina flp53 lidský protein o celé délce (full lenght) FPLC rychlá proteinová kapalinová chromatografie HEPES N-(2-hydroxyethyl)piperazin-N -2-ethansulfonová kyselina IPTG izopropyl-β-thiogalaktosid lin DNA lineární forma DNA MOPS 4-morfolinpropansulfonová kyselina mutp53 mutantní forma proteinu p53 mutp53bs mutp53binding sites NK nukleová kyselina ocdna, oc otevřená kružnicová DNA p53c C-koncová DNA vazebná doména (aa ) p53cd centrální doména p53 (aa ) p53con konvenční sekvence specifické vazby p53 (consensus sequence) 5 PuPuPuC(A/T)(T/A)GpyPyPy3 p53for primer pro sekvenci p53, forward p53rev primer pro sekvenci p53, revers v opačném směru Pu purinová báze Py pyrimidinová báze RE responsivní element, místo vazby mutp53 scdna, sc superhelikální, nadšroubovicová DNA SCS selektivní vazba na scdna (supercoiled selective binding) SDS dodecyl síran sodný

4 SDS-PAGE sirna ssdna ssrna TEMED Tris wtp53 polyakrilamidová elektroforéza s SDS malé interferující molekuly RNA (small interfering RNA) jednořetězcová DNA jednořetězcová RNA N,N,N,N -tetramethylethylendiamin tris(hydroxymethyl)-aminomethan standardní forma proteinu p53

5 OBSAH 1. ÚVOD Nádorový supresorový protein p Struktura genu TP Mutace proteinu p Struktura proteinu p Polymorfismus kodonu 72 v genu TP Konformace proteinu wtp53 a mutp Funkce a regulace standardního typu proteuinu p53 (wtp53) Biologické konsekvence mutace proteinu p Heterogenita způsobů inaktivace wtp53 v lidských nádorech Mutantní p53 jako onkogen Dominantně negativní efekt Mechanismy získaných vlastností mutp53 ( gain-of-function ) Zvýšení poločasu rozpadu mutp53, narušená dráha degradace proteinem MDM Protein-protein interakce Transaktivace genů mutantními proteiny p Vazba p53 na DNA Sekvenčně specifická vazba na p53con (konsensní sekvence p53) Vazba mutp53 na DNA Sekvenčně specifická vazba mutp Strukturně selektivní vazba mutp Vazba mutp53 k MAR/SAR elementům in vivo Vazba mutp53 k repetetivním sekvencím in vivo Gliomy Astrocytomy Molekulární změny astrocytomů Role p53 v nádorech mozku p53 terapie mozkových nádorů CÍLE DIPLOMOVÉ PRÁCE MATERIÁL A METODY Materiál Bakteriální kmeny (Escherichia coli) Buněčné linie Plasmidová DNA Mapy plasmidů určených pro studium vazby p Mapy plasmidů určených pro studium exprese p Mapa plasmidu psuper (Brummelkamp, 2002) Příprava plasmidové DNA pro studium vazby p Metody Techniky pro práci s DNA Transformace buněk E.coli Izolace plasmidové DNA kolonou GIAGEN-tip

6 Izolace plasmidové DNA kitem NucleoSpin Plasmid (Macherey- Nagel) Stanovení koncentrace nukleových kyselin Příprava lineárních fragmentů pro vazbu p Metodika klonování Štěpení plasmidové DNA restrikční endonukleázou Van91I Izolace DNA z agarózového gelu kitem NucleoSpin Extract (Macherey-Nagel) Defosforylace vektorové DNA alkalickou fosfatázou Purifikace DNA pomocí fenol/chloroform/isoamylakoholové extrakce Ligace T4 DNA ligasou (Invitrogen) izolovaných fragmentů mutp53 a bakteriálního expresního vektoru pt PCR Techniky práce s proteiny Izolace rekombinantních proteinů mutp Separace proteinů na SDS polyakrylamidových gelech Barvení SDS PAGE gelu Coomasie blue (Eckershorn aj., 1988) Stanovení koncentrace proteinů podle obarveného SDS-PAGE Coomasie Blue Stanovení koncentrace proteinů podle Bradfordové Přenos proteinů z polyakrylamidových gelů, elektorblot Vazba proteinů na lineární DNA Inkubace p53 s DNA Agarózová elektroforéza Detekce DNA Přenos z agarózového gelu, vakuový blot Imunodetekce proteinů na membránách Práce s buněčnými kulturami Kultivace gliomových linií Izolace DNA z gliomových buněk Příprava proteinových lyzátů z gliomových buněk Izolace celkové RNA z gliomových buněk Syntéza cdna metodou TermoScriptTM RT-PCR Štěpení BstUI Transientní transfekce buněk gliomu Přečištění RNA pomocí DNA-freeTM kitu (Ambion) Detekce exprese genů pomocí PCR Přístroje VÝSLEDKY Charakterizace gliomových linií s mutp Detekce mutace v p Detekce exprese mutp53 v buňkách gliomových linií Polymorfismus kodonu 72 v genu TP53 gliomových linií U251, Onda10 a Onda Morfologie buněk linií Onda10, Onda Příprava mutp53 proteinu v E.coli Příprava expresního vektoru pro produkci mutp53 v E.coli BL21 (DE3) Vazba p53 na lineární DNA...44

7 4.3.1 Vazba proteinů p53 na lineární DNA fragmenty pbluescript, ppgm1, ppgm Vazba wtp53 proteinu Vazba mutp53 proteinů Vazba mutp53 na lineární fragmenty genomové DNA Charakterizace genomové DNA určené pro vazbu mutp Vazba mutantních proteinů R273C a R273H na genomovou DNA Regulace exprese kandidátních genů proteinem mutp53 v gliomových liniích Příprava cdna Test exprese metodou PCR DISKUSE Charakterizace gliomových linií s mutantní p Charakterizace vazebných schopností mutantních proteinů p Regulace genové exprese ZÁVĚR SUMMARY LITERATURA...65


Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální


Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace


Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich


Exprese rekombinantních proteinů

Exprese rekombinantních proteinů Exprese rekombinantních proteinů Exprese rekombinantních proteinů je proces, při kterém můžeme pomocí různých expresních systémů vytvořit protein odvozený od konkrétního genu, nebo části genu. Tento protein





Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární


IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek

IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek IZOLACE, SEPARACE A DETEKCE PROTEINŮ I Vlasta Němcová, Michael Jelínek, Jan Šrámek Studium aktinu, mikrofilamentární složky cytoskeletu pomocí dvou metod: detekce přímo v buňkách - fluorescenční barvení


Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip


Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií

Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Téma bakalářské práce: Úloha protein-nekódujících transkriptů ve virulenci patogenních bakterií Nové odvětví molekulární biologie se zabývá RNA molekulami, které se nepřekládají do proteinů, ale slouží


Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE


Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna

Zdrojem je mrna. mrna. zpětná transkriptáza. jednořetězcová DNA. DNA polymeráza. cdna Obsah přednášky 1) Klonování složených eukaryotických genů 2) Úprava rekombinantních genů 3) Produkce rekombinantních proteinů v expresních systémech 4) Promotory 5) Vektory 6) Reportérové geny Zdrojem


1. Metodika. Protokol č. F1-4 Metodika: Srovnávací analýza efektivity přípravy rekombinantního proteinu ve fermentoru

1. Metodika. Protokol č. F1-4 Metodika: Srovnávací analýza efektivity přípravy rekombinantního proteinu ve fermentoru Protokol č.: F1-4 Datum: 20.12.2010 Metodika: analýza efektivity přípravy výběr z výsledků ze zkušebních provozů výroby antigenů. Vypracoval: Ing. Václav Filištein, Mgr. Tereza Chrudimská, Spolupracující


Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014 Molekulárně biologické metody v mikrobiologii Mgr. Martina Sittová Jaro 2014 Harmonogram 1. den Izolace DNA 2. den Měření koncentrace DNA spektrofotometricky, real-time PCR 3. den Elektroforéza Molekulární


Izolace nukleových kyselin

Izolace nukleových kyselin Izolace nukleových kyselin Požadavky na izolaci nukleových kyselin V nativním stavu z přirozeného materiálu v dostatečném množství požadované čistotě. Nukleové kyseliny je třeba zbavit všech látek, které


Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin


Absorpční spektroskopie při biologické analýze molekul

Absorpční spektroskopie při biologické analýze molekul Absorpční spektroskopie při biologické analýze molekul Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 8.11.2007 7 1 UV spektroskopie DNA a proteinů Všechny atomy absorbují v UV oblasti



METODY STUDIA PROTEINŮ METODY STUDIA PROTEINŮ Mgr. Vlasta Němcová OBSAH PŘEDNÁŠKY 1) Stanovení koncentrace proteinu 2) Stanovení AMK sekvence proteinu Hmotnostní spektrometrie Edmanovo odbourávání


Metody práce s proteinovými komplexy

Metody práce s proteinovými komplexy Metody práce s proteinovými komplexy Zora Nováková, Zdeněk Hodný Proteinové komplexy tvořeny dvěma a více proteiny spojenými nekovalentními vazbami Van der Waalsovy síly vodíkové můstky hydrofobní interakce


Protokoly Transformace plasmidu do elektrokompetentních buněk BL21 Pracovní postup:

Protokoly Transformace plasmidu do elektrokompetentních buněk BL21 Pracovní postup: Protokoly Pracovní potřeby, pufry a chemikálie jsou uvedeny na konci protokolu. Pracovní postupy jsou odvozeny od těchto kitů: Champion pet160 Directional TOPO Expression Kit with Lumio Technology (Invitrogen)


Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci


Studium genetické predispozice ke vzniku karcinomu prsu

Studium genetické predispozice ke vzniku karcinomu prsu Univerzita Karlova v Praze 1. lékařská fakulta Studium genetické predispozice ke vzniku karcinomu prsu Petra Kleiblová Ústav biochemie a experimentální onkologie, 1. LF UK - skupina molekulární biologie


Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován



RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného


Příprava rekombinantních molekul pro diagnostické účely

Příprava rekombinantních molekul pro diagnostické účely 1 Příprava rekombinantních molekul pro diagnostické účely doc. RNDr. Milan Bartoš, Ph.D. Přírodovědecká fakulta MU, 2014 2 Obsah přednášky 1) Pojem rekombinantní DNA 2) Historické milníky


Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:


1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.


Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2


Zaměření bakalářské práce (témata BP)

Zaměření bakalářské práce (témata BP) Zaměření bakalářské práce (témata BP) Obor: Buněčná a molekulární diagnostika - zadává katedra - studenti si témata losují Obor: molekulární biologie a genetika - témata BP vychází z vybraného tématu DP



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Termín biotechnologie byl poprvé použit v roce 1917 Procesy, při kterých se na tvorbě výsledného produktu podílejí živé organismy Širší definice: biotechnologie


Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje


Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right


Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách

Molekulární biotechnologie č.8. Produkce heterologního proteinu v eukaryontních buňkách Molekulární biotechnologie č.8 Produkce heterologního proteinu v eukaryontních buňkách Eukaryontní buňky se využívají v případě, když Eukaryontní proteiny syntetizované v baktériích postrádají biologickou



MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického


Aplikovaná bioinformatika

Aplikovaná bioinformatika Aplikovaná bioinformatika Číslo aktivity: 2.V Název klíčové aktivity: Na realizaci se podílí: Implementace nových předmětů do daného studijního programu doc. RNDr. Michaela Wimmerová, Ph.D., Mgr. Josef


V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)


Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních


CENÍK. Restrikční enzymy

CENÍK. Restrikční enzymy CENÍK obchodní divize Forenzní DNA servis, s.r.o. Budínova 2, 180 81 Praha 8, CZE tel/fax: 233 931 123, GSM: 731 503 250 e-mail: Cena chlazených a mražených produktů neobsahuje dopravné


CENÍK. Restrikční enzymy

CENÍK. Restrikční enzymy CENÍK obchodní divize Forenzní DNA servis, s.r.o. Budínova 2, 180 81 Praha 8, CZE tel/fax: 233 931 123, GSM: 731 503 250 e-mail: Cena chlazených a mražených produktů neobsahuje dopravné


Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013

Biotechnologický kurz. II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Biotechnologický kurz Biotechnologický kurz II. letní škola metod molekulární biologie nukleových kyselin a genomiky 17. - 21. 6. 2013 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně Zemědělská



Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Column DNA Lego Kit UNIVERZÁLNÍ SOUPRAVY PRO RYCHLOU IZOLACI ČISTÉ DNA (Katalogové číslo D201 + D202) Popis Column DNA Lego Kit je základ moderní stavebnicové (Lego) soupravy pro izolaci čisté DNA různého


Nukleové kyseliny (NK)

Nukleové kyseliny (NK) Eva Roubalová B10 2007/2008 Předmět: - Obecná biologie - Biologie a genetika Zdroj velké části materiálů: učebnice Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava


Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE

Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE BiochemNet vytvoření sítě pro podporu spolupráce biomedicínských pracovišť a zvýšení uplatnitelnosti absolventů biochemických oborů v praxi Laboratorní workshop s teoreticko praktickou ukázkou molekulárně


Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky

Biotechnologický kurz. III. letní škola metod molekulární biologie nukleových kyselin a genomiky Biotechnologický kurz Biotechnologický kurz III. letní škola metod molekulární biologie nukleových kyselin a genomiky 18. - 22. 6. 2012 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU v Brně


Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie

Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie 1) Zadávání témat dle studovaného oboru 2) Přehled řešených témat v minulosti 3) 4) Přehled externích školících pracovišť Zaměření


Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky


In vitro testování scaffoldů pro tkáňové inženýrství. Mgr. Jana Horáková

In vitro testování scaffoldů pro tkáňové inženýrství. Mgr. Jana Horáková In vitro testování scaffoldů pro tkáňové inženýrství Mgr. Jana Horáková 9.12.2015 Proces tkáňového inženýrství 1. Návrh nosiče Seznámení se s problematikou dané tkáně/orgánu Návrh nosiče pro danou aplikaci


Separační metody používané v proteomice

Separační metody používané v proteomice Separační metody používané v proteomice Proteome = komplexní směsi proteinů Lidská buňka 10,000 typů proteinů Rozdíl v koncentraci 10 6,plasma10 9 Nutnost separace, frakcionace Na úrovni Proteinů Obtížně


DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod.

DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. Od 1.1.2014 DYNEX jediným OFICIÁLNÍM (autorizovaným) distributorem společnosti



MATEMATICKÁ BIOLOGIE INSTITUT BIOSTATISTIKY A ANALÝZ Lékařská a Přírodovědecká fakulta, Masarykova univerzita MATEMATICKÁ BIOLOGIE Přírodovědecká fakulta Masarykova univerzita, Brno Studijní obor Matematická biologie Masarykova


Molekulární diagnostika pletencové svalové dystrofie typu 2A

Molekulární diagnostika pletencové svalové dystrofie typu 2A Molekulární diagnostika pletencové svalové dystrofie typu 2A Lenka Fajkusová Centrum molekulární biologie a genové terapie Fakultní nemocnice Brno Pletencové svalové dystrofie (Limb Girdle Muscular Dystrophy


MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční



Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,



VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ VÝVOJ DNA ČIPŮ PRO DETEKCI GENETICKY MODIFIKOVANÝCH ORGANISMŮ Lucie Vištejnová 2, Jan Hodek 1, Patrik Sekerka 2, Jaroslava Ovesná 1, Kateřina Demnerová 2 1. Výzkumný ústav rostlinné výroby, Drnovská 507,






ZÁKLADY BAKTERIÁLNÍ GENETIKY Zdroj rozmanitosti mikrorganismů ZÁKLADY BAKTERIÁLNÍ GENETIKY Různé sekvence nukleotidů v DNA kódují různé proteiny Různé proteiny vedou k různým organismům s různými vlastnostmi Exprese genetické informace


Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví

Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Tematické okruhy k SZZ v bakalářském studijním oboru Zdravotní laborant bakalářského studijního programu B5345 Specializace ve zdravotnictví Dle čl. 7 odst. 2 Směrnice děkana pro realizaci bakalářských



MODERNÍ BIOFYZIKÁLNÍ METODY: MODERNÍ BIOFYZIKÁLNÍ METODY: POKROČILÉ PRAKTICKÉ VZDĚLÁVÁNÍ V EXPERIMENTÁLNÍ BIOLOGII Operační program Vzdělávání pro konkurenceschopnost Číslo projektu: CZ.1.07/2.3.00/09.0046 Praktický kurz pokročilých



ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN ELEKTROFORETICKÁ SEPARACE NUKLEOVÝCH KYSELIN Fragmenty nukleových kyselin lze dle jejich velikosti rozdělit elektroforézou. Elektroforéza využívá rozdílné pohyblivosti jednotlivých fragmentů, danou právě


Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové


Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk. Aleš Hampl

Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk. Aleš Hampl Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk Aleš Hampl Tkáně Orgány Živé buňky, které plní různé funkce (podpora struktury, přijímání živin, lokomoce,



DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit


Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,



REKOMBINACE Přestavby DNA REKOMBINACE Přestavby DNA variace v kombinacích genů v genomu adaptace evoluce 1. Obecná rekombinace ( General recombination ) Genetická výměna mezi jakýmkoli párem homologních DNA sekvencí - často lokalizovaných


Enzymy používané v molekulární biologii

Enzymy používané v molekulární biologii Enzymy používané v molekulární biologii Rozdělení enzymů 1. Podle substrátové specifity: většina metod molekulární biologie je závislá na použití enzymů, jejichž substrátem jsou nukleové kyseliny. Tyto


Mgr. Veronika Papoušková, Ph.D. Brno, 20. března 2014

Mgr. Veronika Papoušková, Ph.D. Brno, 20. března 2014 Co je to CEITEC? Mgr. Veronika Papoušková, Ph.D. Brno, 20. března 2014 Pět oborů budoucnosti, které se vyplatí studovat HN 28. 1. 2013 1. Biochemie 2. Biomedicínské inženýrství 3. Průmyslový design 4.



SYLABY VZDĚLÁVACÍCH MODULŮ A JEJICH PŘEDMĚTŮ SYLABY VZDĚLÁVACÍCH MODULŮ A JEJICH PŘEDMĚTŮ EKOTECH Multidisciplinární výchova odborníků pro využití biotechnologií v ekologických oblastech 1) Název modulu: Transgenoze rostlin a její využití Garant:


Struktura nukleových kyselin Vlastnosti genetického materiálu

Struktura nukleových kyselin Vlastnosti genetického materiálu Struktura nukleových kyselin Vlastnosti genetického materiálu V předcházejících kapitolách bylo konstatováno, že geny jsou uloženy na chromozomech a kontrolují fenotypové vlastnosti a že chromozomy se


Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci


Struktura a funkce nukleových kyselin

Struktura a funkce nukleových kyselin Struktura a funkce nukleových kyselin ukleové kyseliny Deoxyribonukleová kyselina - DA - uchovává genetickou informaci Ribonukleová kyselina RA - genová exprese a biosyntéza proteinů Složení A stavební


ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii ONKOGENETIKA Spojuje: - lékařskou genetiku - buněčnou biologii - molekulární biologii - cytogenetiku - virologii Důležitost spolupráce různých specialistů při detekci hereditárních forem nádorů - (onkologů,internistů,chirurgů,kožních


Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování





První testový úkol aminokyseliny a jejich vlastnosti

První testový úkol aminokyseliny a jejich vlastnosti První testový úkol aminokyseliny a jejich vlastnosti Vysvětlete co znamená pojem α-aminokyselina Jaký je rozdíl mezi D a L řadou aminokyselin Kolik je základních stavebních aminokyselin a z čeho jsou odvozeny


Výuka genetiky na Přírodovědecké fakultě MU

Výuka genetiky na Přírodovědecké fakultě MU MASARYKOVA UNIVERZITA Přírodovědecká fakulta Výuka genetiky na Přírodovědecké fakultě MU Jiří Doškař Ústav experimentální biologie, Oddělení genetiky a molekulární biologie 1 V akademickém roce 1964/1965


Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní


Elektroforéza nukleových kyselin

Elektroforéza nukleových kyselin Elektroforéza nukleových kyselin Elektroforéza nukleových kyselin je založena na tom, že NK jsou v neutrálním nebo zásaditém prostředí polyanionty. Protože se zvyšujícím se počtem nukleotidů v molekule


Bioinformatika a výpočetní biologie KFC/BIN. I. Přehled

Bioinformatika a výpočetní biologie KFC/BIN. I. Přehled Bioinformatika a výpočetní biologie KFC/BIN I. Přehled RNDr. Karel Berka, Ph.D. Univerzita Palackého v Olomouci Definice bioinformatiky (Molecular) bio informatics: bioinformatics is conceptualising biology


Klonování gen a genové inženýrství

Klonování gen a genové inženýrství Klonování gen a genové inženýrství Genové inženýrství užite né termíny Rekombinantní DNA = DNA, ve které se nachází geny nejmén ze dvou zdroj, asto ze dvou zných druh organism Biotechnologie = manipulace


Hybridizace. doc. RNDr. Milan Bartoš, Ph.D.

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. Hybridizace doc. RNDr. Milan Bartoš, Ph.D. Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace


BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc.

BAKTERIÁLNÍ GENETIKA. Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. BAKTERIÁLNÍ GENETIKA Lekce 12 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. -dědičnost u baktérií principiálně stejná jako u komplexnějších organismů -genom haploidní a značně menší Bakteriální genom


Obecná biologie a genetika B53 volitelný předmět pro 4. ročník

Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Obecná biologie a genetika B53 volitelný předmět pro 4. ročník Charakteristika vyučovacího předmětu Vyučovací předmět vychází ze vzdělávací oblasti Člověk a příroda, vzdělávacího oboru Biologie. Mezipředmětové


Mikročipy v mikrobiologii

Mikročipy v mikrobiologii Mikročipy v mikrobiologii doc. RNDr. Milan Bartoš, Ph.D. Přírodovědecká fakulta MU, 2014 Obsah přednášky 1) Charakteristika biočipů, DNA microarrays a DNA chip 2) Výroba čipů, charakteristika



CZ.1.07/2.4.00/31.0133 BiochemNet - Vytvoření sítě pro podporu spolupráce biomedicínských pracovišť a zvýšení uplatnitelnosti absolventů biochemických oborů v praxi CZ.1.07/2.4.00/31.0133 Univerzita Palackého Přírodovědecká


AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení


ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)


Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,


Centrální dogma molekulární biologie

Centrální dogma molekulární biologie řípravný kurz LF MU 2011/12 Centrální dogma molekulární biologie Nukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Mendel) 1869 objev nukleových kyselin (Miescher) 1944 genetická informace v nukleových


Kyselina hyaluronová. Kyselina hyaluronová. Streptococcus equi subsp. produkovaná kyselina hyaluronová a. Autor prezentace: Mgr.

Kyselina hyaluronová. Kyselina hyaluronová. Streptococcus equi subsp. produkovaná kyselina hyaluronová a. Autor prezentace: Mgr. Kyselina hyaluronová Streptococcus equi subsp. zooepidemicus a jím produkovaná kyselina hyaluronová a glukuronidáza Marcela Tlustá Biotechnologická laborato Meyer a Palmer, 1934 Extracelulární matrix,


Elektroforéza nukleových kyselin. Molekulární biologie v hygieně potravin 2, 2014/15, Ivo Papoušek

Elektroforéza nukleových kyselin. Molekulární biologie v hygieně potravin 2, 2014/15, Ivo Papoušek Elektroforéza nukleových kyselin Molekulární biologie v hygieně potravin 2, 2014/15, Ivo Papoušek Elektroforéza Patří mezi nejpoužívanější separační techniky při izolaci a analýze nukleových kyselin (X


Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ I n v e s t i c e d o r o z v o j e v z d ě l á v á n í I ti d j dělá á í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním



TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy


Kosterní svalstvo tlustých a tenkých filament

Kosterní svalstvo tlustých a tenkých filament Kosterní svalstvo Základní pojmy: Sarkoplazmatické retikulum zásobárna iontů vápníku - depolarizace membrány uvolnění vápníku v blízkosti kontraktilního aparátu vazba na proteiny zajišťující kontrakci


Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny


Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace


DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura


Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady


Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8


WESTERN BLOT. Velikost signálu je vyhodnocována srovnáním s naneseným proteinovým markerem, což je komerčně dostupná směs proteinů o známé velikosti.

WESTERN BLOT. Velikost signálu je vyhodnocována srovnáním s naneseným proteinovým markerem, což je komerčně dostupná směs proteinů o známé velikosti. WESTERN BLOT Western blot je metoda používaná pro kvalitativní nebo semikvantitativní detekci určitého proteinu ve vzorku. Metoda je tvořena třemi základními kroky: 1. elektroforetickou separací proteinů,


Schéma průběhu transkripce

Schéma průběhu transkripce Molekulární základy genetiky PROTEOSYNTÉZA A GENETICKÝ KÓD Proteosyntéza je složitý proces tvorby bílkovin, který zahrnuje proces přepisu genetické informace z DNA do kratšího zápisu v informační mrna


Genetické markery - princip a využití

Genetické markery - princip a využití Genetika a šlechtění lesních dřevin Genetické markery - princip a využití Doc. Ing. RNDr. Eva Palátová, PhD. Ing. R. Longauer, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován
