TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

Rozměr: px
Začít zobrazení ze stránky:

Download "TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce"

Transkript

1 TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dgmp)

2 Koncept párování bazí je striktně konzervativní Cytosine Guanine Deoxyribosa a fosfát dávají DNA řetězci směr konce dsdna nejsou stejné jednotlivé řetězce duplexu jsou k sobě komplementární 5 end 3 end T A G C HO DNA rětězce duplexu mohou být denaturována a znovu spojena T A G C OH 3 end 5 end

3 T m (melting temperature) je teplota při které je dsdna z poloviny denaturována Tm je závislá na: složení bazí rozpouštědle iontové síle ph délce DNA DNA replikace in vivo vyžaduje několik enzymů separace řetězců syntéza krátkých RNA primerů syntéza dvou nových DNA helixů podílí se enzymy: DNA primasa helikasa DNA polymerasa DNA ligasa SSB-proteiny

4 Vlastnosti DNA polymerasy 1. polymerasová aktivita Replikace probíhá vždy ve směru od 5 na 3 konec Nový nukleotid je přidáván á tedy vždy na 3 OH konec. 2. 3'-5' exonukleasová aktivita -opravná funkce proofreading 3. 5 exonukle exonukleas asová aktivita - odštěpuje RNA primer DNA replikace in vitro vyžaduje pouze jeden enzym DNA Polymerasa 1957 Arthur Kornberg dokázal existenci DNA polymerasy - DNA polymerase I in vitro polymerasa vyžaduje pouze: 4 deoxynukleotidy trifosfáty dsdna templát primer - ssdna nebo RNA s volnou 3'-OH FUNKCE OSTATNÍCH PROTEINů JE in vitro NAHRAZENA ZMĚNOU TEPLOT

5 Syntéza obou řetězců specifické dsdna in vitro 5 3 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3 5 Forward primer dntps 5 3 TTGAGAAAGGAATAAGC DNA POL AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3 5 Syntéza obou řetězců specifické dsdna in vitro 5 3 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC DNA POL TCTTTAGCTCATATACG 3 5 dntps Reverse primer 5 3 GCATATACTCGATTTCT 5 3 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3 5

6 PCR: Co to je? Polymerase Chain Reaction: znamená amplifikace (mnohonásobná replikace) relativně krátkých úseků specifické DNA Základní nástroj molekulární biologie se vzrůstájícím významem i v dalších oborech (botanika, kriminalistika) The idea Ghobind Khorana 1971 Kary Mullis 1983 Nobelova cena 1993 poprvé provedená mnohonásobná in vitro replikace ve zkumavce Jak funguje PCR Řetězová reakce vychází z DNA replikace Spočívá v opakování cyklů denaturace (separace dsdna), navázání primerů a elongace primerů (syntéza nového vlákna DNA) pomocí změn teploty potřeba silného enzymu (polymerasy) který je schopen pracovat při vysokých teplotách termofilní organismy objeveny začátkem 70tých let

7 Jak funguje PCR Polymerasa izolovaná z termofilní baktérie (Thermus aquaticus, Pyrococcus furiosus) zkr. TAQ, PFU Polymerasa až s objevem a použitím TERMOSTABILNÍ POLYMERASY získala PCR na významu Praktické provedení PCR Počáteční denaturace 94 o C 3-5 min denaturace 94 o C 30 sec annealing ~55 o C 30 sec prodlužování 72 o C 1min/kilobáze počet cyklů x

8 Praktické provedení PCR agarozová elektroforéza PCR komponenty Templátová DNA vzorek k amplifikaci Primery krátké specifické úseky DNA zaručující specifitu amplifikace datp, dttp, dctp, dgtp volné stavební jednotky DNA Thermostabilní DNA polymerasa (e.g., Taq, Pfu) Pufr a soli (KCl, MgCl2)

9 Proces PCR Velký nadbytek primeru, dntps a Taq POL k DNA templátu Problémy: PCR je velmi citlivá na kontaminace Častý problém - nespecifická amplifikace Polymerasa pracuje i při nízkých teplotách (e.g., během nastavování reakce) Hot start PCR je řešení (protilátka proti Taq) Amplifikace je často možná i pro ne zcela známou sekvenci primerů např. DNA jiného biologického druhu Degenerované primery (multiple verze s různými bázemi v klíčové pozici (tryptofan + methionin): stupeň degenerace: P R E T T Y F L Y CCA CGA GAA ACA ACA TAC TTC CTA TAC prettyfly protein má kód degenerovaný na 11 pozicích G G G G G T T G T C C C C C tzn. (4)(2)(4)(2)(4)(4)(2)(2)(2)(4)(2) = krát T T T T T A T Touchdown PCR s vyšší přesností v prvních cyklech Maximální velikost produktu +/-5000 bazí pro standardní PCR: Long PCR kits mohou amplifikovat až 35 kbazí

10 Navrhování primerů Primery by měly být bazí dlouhé Nutná znalost alespoň části sekvence amplifikované DNA 3 konec primeru je důležitý: vhodné aby zde byla G nebo C báze Procentuální zastoupení G + C by mělo být 50-60% - ovlivňuje Tm (teplota kdy se váže primer na templát) Primery v jedné reakci by měly mít srovnatelné Tm Vyvarovat se repetitivním sekvencím Tm = (G+C)x4 + (A+T)x2 Vyvarovat se komplementaritě uvnitř či mezi primery degenerované primery max. 20 bp ideální do degenerace 250x Navrhování primerů Příklad navržení primerů: Konvence: DNA se vždy zapisuje ve směru od 5 ku 3 konci Cílová sekvence: (priming místo podtrženo): 5 TATAAGCCATAACGATATTGCTGAGTCAAGTCCACATATCATATGGATGAG AAATGCTTGTGGAGCTGATGTTGATTTGGAGAGACTCTCTCTCTCTCTCTCT CTCTCTCTCTCTCTCTCTCAAACCAGTTAAAGAGTGTGCCAGTAGAG 3 Forward Primer: 5 ATG GAT GAG AAA TGC TTG TG 3 Reverse Primer: 5 ACT GGC ACA CTC TTT AAC TGG 3

11 Praktické provedení PCR objem v mikrozkumavce: ųl složení: Templátová DNA ng1000ng Primery pmols 10mM Tris-CL ph 9.0, 50 mm KCl MgCl mm 50 ųm každého nukleotidu datp, dgtp, dttp, dctp 2 jednotky Taq polymerasy Praktické provedení PCR PCR se provádí v termocyklerech kovový blok z ušlechtilého kovu snadné programování vyhřívané víko

12 PCR Optimalizace Složka AnnealingTeplota - Tm MgCl 2 KCl Enzym, Primer ph Formamid specifická amplifikace nízká nespecifická amplifikace vysoká vysoká nízká vysoká nízká vysoká nízká nespecificky nízká vysoká látky ovlivňující kvalitu PCR: formamid, DMSO, betain atd. pro GC-rich templáty Nespecifická amplifikace Základní typy PCR RT PCR (reverse transcriptase PCR) vlastní PCR předchází syntéza cdna z mrna pomocí RT jako primer slouží GSP (gene specific primer) oligo dt random hexamer primer hledání nových genů tvorba cdna knihoven hledání mutací zjišťování síly exprese různých genů

13 RACE PCR (rapid amplification of cdna ends) vychází z RT-PCR používá se k hledání celé sekvence nového genu nutná alespoň částečná znalost sekvence hledaného genu vhodné pro klonování genů a jeho následnou funkční expresi (GMO)

14 inverzní PCR Amplifikace neznámých segmentů DNA asymetrická PCR sekvenace DNA, příprava hybridizačních sond amplifikuje pouze jeden řetězec dsdna SEKVENCOVÁNÍ DNA automatické sekvenátory využívající asymetrické PCR jednozkumavková reakce PCR s jedním primerem a dideoxyribonukleotidy (ddatp, ddgtp, ddctp, ddttp) dideoxyribonukleotidy značené 4 fluorescenčními markery velice citlivé elektroforetické rozdělení v kapiláře fluorometr s automatickým vyhodnocením

15 multiplex PCR více amplifikací v jedné zkumavce lékařská diagnostika nested PCR 2 po sobě jdoucí PCR zvyšování specificity PCR LA-PCR (long and accurate) amplifikace dlouhých úseků, polymerasové kokteily např. Taq + Pfu polymerasa (180:1) Pwo polymerasa z Pyroccocus woesei DeepVent polymerasa z Termococcus litoralis (hlubokomořská baktérie) DNA polymeráza 5-3 exonukleázová aktivita 3-5 exonukleázová aktivita délka produktu frekvence chyby Taq + 3 kb 10-4 Pfu + 3 kb 1.3 x 10-6 Pwo + 3 kb x 10-6 DeepVent + 12 kb 3.0 x 10-5 long PCR koktejl kb 2.0 x 10-6 PROCESIVITA: jak dlouho se enzym udrží na vlákně STABILITA: kolik minut při denaturační teplotě např Taq 9 min při 97.5 C Pwo 2 hod při 100 C DeepVent 8hod při 100 C

16 in situ RT PCR lokalizace translace a exprese genů real time PCR slouží k přesné kvantifikaci amplifikovaného produktu využití fluorescence interkalačních barviv (etbr) fluorimetr je součástí termocykleru Real-time PCR monitoruje fluorescenci uvolňovanou jako odezvu na každý uskutečněný cyklus v PCR (v reálném čase). + daleko přesnější oproti end-point barvení EtBr při konvenční PCR - náročné na optimalizaci a vybavení

17 aplikace REAL-TIME PCR 1) absolutní kvantifikace množství DNA ve vzorku k externímu standardu, detekce virální či bakteriální DNA, forenzní chemie 2) koncová detekce SNP genotypizace, detekce mutací a polymorfismů 3) relativní kvantifikace princip měření vznikající fluorescence po každém cyklu PCR, stanovení křivek tání

18 chemismus 1) interkalační barviva SYBRgreen interkalace barviva na dvoušroubovici vznikající (amplifikované) DNA precizní výběr primerů nesmí vytvářet dimery nutná kontrola amplifikovaného produktu na křivku denaturačních teplot chemismus 2) hybridizační sondy (TAQman) uvolňování fluorescence po degradaci sondy nutná 5-3 exonukleasová aktivita Taq polymerasy fluorescenční značka: VIC, FAM (fluorescein) zhášeč: Tamra (Tetramethyl-6-Carboxyrhodamine) FRET = Förster/fluorescence resonance energy transfer

19 srovnání TaqMan SybrGreen specifita primery proba PCR podmínky primery PCR podmínky flexibilita singleplex multiplex (max.4) singleplex aplikace kvantifikace SNP detekce kvantifikace cena vysoká nízká kontaminace největší problém PCR aerosol, pipety, staré amplikony částečné řešení URACIL N-GLYKOSYLASA štěpí ss a dsdna s inkorporovaným deoxyuracilem (dutp) termolabilní, 0% aktivita nad 55 C nereaguje s templátem (dttp) dutp v qpcr mixu místo dttp pracuje během nastavení PCR reakce

20 chyby v pipetování templát (cdna) premix (primery, y,p proba,,polymerasa, dntp,,p pufr, srovnávací fluorescenční barvivo) částečné řešení - ROX fluorescence se nemění během PCR cyklů a vzrůstající fluorescence v každé zkumavce vzorku je extrapolována na srovnávací CYCLE NUMBER AMOUNT OF DNA , , , , , , , , , , ,048, ,097, ,194, ,388, ,777, ,554, ,108, ,217, ,435, ,870, ,073,741, ,400,000, ,500,000, ,550,000, ,580,000,000 AMOUNT OF DNA A A AMOUNT OF DNA lineární vynesení PCR CYCLE NUMBER logaritmické vynesení PCR CYCLE NUMBER

21 lineární ~20 do ~1500 C T hodnoty threshold treshold je třeba nastavit tak aby u každého vzorku procházel lineární části křivky C T počet cyklů při kterém fluorescence vzorku překročí threshold (prahovou hodnotu)

22 před každou kvantifikací je třeba vždy udělat standardní křivku absolutní kvantifikace threshold templát: 10x ředění buď přímo cdna, nebo plasmid s naklonovaným genem, který stanovujeme C T koncentrace templátu PARAMETRY STANDARDNÍ KŘIVKY směrnice: ideální -3,32 = 100% efektivita reakce %EFF kolik kopii templátu je zkopírováno v každém cyklu R 2 korelační koeficient (tolerovat se dá ještě 0,995)

23 CYCLE AMOUNT OF DNA AMOUNT OF DNA AMOUNT OF DNA AMOUNT OF DNA 100% EFFICIENCY 90% EFFICIENCY 80% EFFICIENCY 70% EFFICIENCY , ,048 1, ,096 2,213 1, ,192 4,205 2, ,384 7,990 3,748 1, ,768 15,181 6,747 2, ,536 28,844 12,144 4, ,072 54,804 21,859 8, , ,127 39,346 14, , ,842 70,824 23, ,048, , ,482 40, ,097, , ,468 69, ,194,304 1,356, , , ,388,608 2,578, , , ,777, ,898, ,338, , ,554,432 9,307,650 2,408, , ,108,864 17,684,534 4,335, , ,217,728 33,600,615 7,804,726 1,667, ,435,456 63,841,168 14,048,506 2,835, ,870, ,298,220 25,287,311 4,819, ,073,741, ,466,618 45,517,160 8,193,466 MOUNT OF DNA AM %EFF 100% = 2.00x 90% = 1.90x 80% = 1.80x 70% = 1.70x 10,000,000,000 1,000,000, ,000,000 10,000,000 1,000, ,000 10,000 1, % EFF 90% EFF 80% EFF 70% EFF PCR CYCLE NUMBER relativní kvantifikace je možná pouze pokud sledovaný gen a referenční gen má srovnatelnou a vysokou efektivitu > 90% ± 3% REFERENČNÍ GEN relativní kvantifikace musí mít stabilní expresi ve všech studovaných vzorcích nejčastěji provozní geny (house-keeping) actin, GAPDH, cyklofilin, 18S RNA

24 TaqMan Human Endogenous Control Plate ΔC T ΔC T = 2 čtyřnásobný rozdíl v expresi změna v jednom cyklu při 100% efektivitě je rovna dvounásobné změně ve výchozí koncentraci cdna 18S ribosomální RNA přepisována jinou RNA polymerasou než mrna byly popsány výkyvy mezi množstvím rrna a mrna nelze použít pokud se vychází z mrna

25 vyhodnocení kalibrátor sample 1 sample 2 izolace celkové RNA (mrna) přepis do cdna navržení primerů a sond pro referenční gen a studovaný (GOI) určení č standardních d křivek k pro oba geny a stanovení efektivity it GAPDH GOI GAPDH GOI GAPDH GOI vyhodnocení kalibrátor sample A kalibrátor sample B sample A sample B GAPDH GOI

26 1 vyhodnocení změny exprese pro sample 1 metoda delta delta cé té 1. určíme C T pro všechny křivky 2. určíme C T GOI -C TGAPDH pro kalibrátor ΔC T kalibrátor 3. určíme C T GOI -C TGAPDH pro sample 1 ΔC T sample 1 4. ΔC Tsample 1 - ΔC Tkalibrátor ΔΔC T výsledek (kolikrát je gen více či méně exprimován) 2 -ΔΔCT 2 vyhodnocení počítá se i s efektivitou Sample A - kalibrátor Sample B - vzorek

27 3 vyhodnocení pomocí standardů o známe koncentraci se spočítají počty kopií ve vzorcích příklad linie živočišných buněk byla podstoupena umlčení (silencing) genu pkg2 s linie transfekované a netransfekované (kalibrátor) byla izolována RNA, přepsana do cdna a provedeno qpcr s primery a probou na gen pkg2 a GAPDH (referenční gen). Snížila se exprese genu pkg2 po umlčení? pkg2 Eff 86% cdna kalibrator C T 22,48 cdna silencing C T 22,3 GAPDH Eff 77% cdna kalibrator C T 20,05 cdna silencing C T 16,97 -ΔΔCT pkg2 cdna 2 kalibrator 2 (5,33-2,43) (1+0,86) 0,18 /(1+0,77) 3,08 1,1x10 4 kopií DNA 123 1,23x kopií cdna silencing GAPDH cdna kalibrator cdna silencing 0,134 0,192 0,194 Gen snížil expresi 7,5x 5,2x 5,2x 1,55x10 4 kopií 8,92x10 4 kopií

28 navrhování primerů velikost amplikonu bp délka primerů ů 20 bp primery se nesmí překrývat s próbou Tm C optimální teplota pro degradaci proby exonukleasovou aktivitou GC obsah 50-70% žádné vlásenky žádné dimery (self-dimery, cross-dimery)

29 délka proby navrhování proby bp primery se nesmí překrývat s próbou Tm C o 10 C vyšší než Tm primerů GC obsah 50-70% žádné G na 5 konci zháší fluorescenci FAM barvy navrhování primerů a proby

30 kontaminace genomickou DNA 1) ošetření vzorků před RT DNasou 2) navržení primerů do dvou exonů mezi nimiž je dlouhý intron 3) navržení primeru nebo proby na přechod intron/exon minor groove binding MGB PROBY stabilizuje vazbu proby na ssdna výrazně zvyšuje Tm můžeme navrhovat krátké proby při zachování vysoké Tm

31 MGB PROBY využití pro alelické diskriminace

32 kolik replikací a kdy replikovat? sample extrakce RNA přepis do cdna qpcr 3X 6X kolik replikací a kdy replikovat? ideální 3x sample extrakce RNA přepis do cdna qpcr 27X

33 instrumentace 7500 Real Time PCR System 7900HT Real Time PCR System StepONE Real Time PCR System halogenová lampa emisní filtry zesilovač ccd kamera excitační filtry zkumavky se vzorky v peltierovém bloku

34 instrumentace

35 Využití REAL TIME PCR pro detekci jednobodové mutace (lékařská diagnostika) HRM ANALYSA (HIGH RESOLUTION MELT) detekce SNP bez specifických sond díky kvalitní instrumentaci Corbett (±0.02 C) a nové generaci interkalačních barviv (LCGreenPlus)

36 HRM ANALYSA pro amplikony do 200bp Aplikace PCR a využití v praxi

37 Aplikace PCR a využití v praxi DIAGNOSTIKA V MEDICÍNĚ detekce virových a bakteriálních onemocnění Aplikace PCR a využití v praxi DIAGNOSTIKA V MEDICÍNĚ detekce geneticky vrozených chorob (mutace DNA) - AS PCR alelicky specifická PCR primer navržen tak, že mutace odpovídá konci primeru fragmenty DNA s nespárovanými konci se pohybují v elektrickém poli pomaleji - Real time PCR pomocí fluorescenční sondy odpovídající mutaci Např. detekce cystické fibrózy, choroba je podmíněná třínukleotidovou delecí v genu CFTR cystic fibrosis transmembrane regulator

38 Aplikace PCR a využití v praxi NEZÁVADNOST POTRAVIN Aplikace PCR a využití v praxi KRIMINALISTIKA VNRT variable number of tandem repeat vyskytují se na různých lokusech chromozomů a v populací kolísají mezi jedinci i v počtu opakování mezi 4-40x 40 např. ř GTGTGTGT

39 Aplikace PCR a využití v praxi ANALÝZA POTRAVIN molekulárně-genetické zhodnocení surovin živočišného a rostlinného původu, ů které byly vyprodukovány klasickým pěstováním (chovem) nebo s použitím genového inženýrství průkaz falšování potravin druhovou záměnou (rostlinného i živočišného původu) identifikace mikroorganismů kontaminující potraviny nebo EVOLUČNÍ BIOLOGIE geneticky změněných mikroorganismů ORNITOLOGIE používaných jako startovací nebo ochranné kultury v produkci potravin. skot ovce prase koza TEST

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Přehled Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymerasa Princip procesu PCR Optimalizace PCR Typy PCR Aplikace

Více

KVANTIFIKACE ZMĚN GENOVÉ EXPRESE

KVANTIFIKACE ZMĚN GENOVÉ EXPRESE KVANTIFIKACE ZMĚN GENOVÉ EXPRESE Northern bloty pracné a zdlouhavé Genové čipy nákladné; http://www.molbio.upol.cz/ Semikvantitativní RT-PCR qpcr nepřesné metodiky real-time PCR vysoké dynamické rozpětí

Více

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR)

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi

Více

Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor

Více

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární

Více

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika

Více

Metody studia genové exprese

Metody studia genové exprese Metody studia genové exprese Ing. Lucie Němcová, Ph.D. Laboratoř vývojové biologie nemcova@iapg.cas.cz Transkriptom Genová exprese: Geny jsou exprimovány tehdy, jsou-li přepsány do RNA (mrna). Rozdílná

Více

Principy a využit. ití qpcr. KBC/BAM Pokročil. rní biologie

Principy a využit. ití qpcr. KBC/BAM Pokročil. rní biologie Principy a využit ití qpcr KBC/BAM Pokročil ilé biochemické a biotechnologické metody Mgr. Mária M Šmehilová, Ph.D. UP PŘF CRH Oddělen lení molekulárn rní biologie Úvod do PCR PCR - 1984 Kary Mullis (Nobelova

Více

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION

USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION USING OF AUTOMATED DNA SEQUENCING FOR PORCINE CANDIDATE GENES POLYMORFISMS DETECTION VYUŽITÍ AUTOMATICKÉHO SEKVENOVÁNÍ DNA PRO DETEKCI POLYMORFISMŮ KANDIDÁTNÍCH GENŮ U PRASAT Vykoukalová Z., Knoll A.,

Více

Enzymy používané v molekulární biologii

Enzymy používané v molekulární biologii Enzymy používané v molekulární biologii Rozdělení enzymů 1. Podle substrátové specifity: většina metod molekulární biologie je závislá na použití enzymů, jejichž substrátem jsou nukleové kyseliny. Tyto

Více

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

UNIVERZITA KARLOVA V PRAZE Přírodovědecká fakulta. Studijní program: Biologie. Katedra antropologie a genetiky člověka.

UNIVERZITA KARLOVA V PRAZE Přírodovědecká fakulta. Studijní program: Biologie. Katedra antropologie a genetiky člověka. UNIVERZITA KARLOVA V PRAZE Přírodovědecká fakulta Studijní program: Biologie Katedra antropologie a genetiky člověka Lenka Dvořáková Využití metod PCR ve forenzní genetické analýze Use of PCR in forensic

Více

Molekulárn. rní. biologie Struktura DNA a RNA

Molekulárn. rní. biologie Struktura DNA a RNA Molekulárn rní základy dědičnosti Ústřední dogma molekulárn rní biologie Struktura DNA a RNA Ústřední dogma molekulárn rní genetiky - vztah mezi nukleovými kyselinami a proteiny proteosyntéza replikace

Více

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Modifikace PCR, sekvenování Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Multiplex PCR Reakční směs obsahuje ne jeden, ale několik párů primerů rozpoznávajících různé cílové sekvence

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 5. Metody molekulární biologie II DNA footprinting hledání interakcí DNA s proteiny Polymerázová řetězová reakce (Polymerase chain reaction PCR) Malé

Více

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.

Více

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.:

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.: Yi TPMT Diagnostická souprava Návod k použití Výrobce: YBUX s.r.o. Haasova 27 Brno 616 00 Česká republika IČ 63487951 tel.: +420 541 423 710 e-mail: ybux@ybux.eu Název: Yi TPMT Popis: Diagnostická souprava

Více

Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie

Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Leona Leišová Přírodovědecká fakulta UK, Praha 2009 Metody kvantifikace: Nepřímé metody odhad míry

Více

MIKROBIOLOGIE V BIOTECHNOLOGII

MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Využití živých organismů pro uskutečňování definovaných chemických procesů pro průmyslové nebo komerční aplikace Organismus je geneticky upraven metodami genetického

Více

REPLIKACE A REPARACE DNA

REPLIKACE A REPARACE DNA REPLIKACE A REPARACE DNA 1 VÝZNAM REPARACE DNA V MEDICÍNĚ Příklad: Reparace DNA: enzymy reparace nukleotidovou excizí Onemocnění: xeroderma pigmentosum 2 3 REPLIKACE A REPARACE DNA: Replikace DNA: 1. Podstata

Více

Ivo Papoušek. Biologie 8, 2015/16

Ivo Papoušek. Biologie 8, 2015/16 Ivo Papoušek Biologie 8, 2015/16 Doporučená literatura: Metody molekulární biologie (2005) Autoři: Jan Šmarda, Jiří Doškař, Roman Pantůček, Vladislava Růžičková, Jana Koptíková Izolace nukleových kyselin

Více

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce

Více

Univerzita Palackého v Olomouci. Bakalářská práce

Univerzita Palackého v Olomouci. Bakalářská práce Univerzita Palackého v Olomouci Bakalářská práce Olomouc 2012 Eliška Růžičková Univerzita Palackého v Olomouci Přírodovědecká fakulta Katedra buněčné biologie a genetiky Real-time PCR a jeho využití pro

Více

Struktura a funkce nukleových kyselin

Struktura a funkce nukleových kyselin Struktura a funkce nukleových kyselin ukleové kyseliny Deoxyribonukleová kyselina - DA - uchovává genetickou informaci Ribonukleová kyselina RA - genová exprese a biosyntéza proteinů Složení A stavební

Více

KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR)

KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) Metoda Real-time PCR slouží pro kvantifikaci DNA a transkripce. Metoda je založena na klasické PCR, ovšem s využitím speciálního cycleru, který v průběhu PCR

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie.

4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. 4. Centrální dogma, rozluštění genetického kódu a zrod molekulární biologie. Od genu k proteinu - centrální dogma biologie Geny jsou zakódovány v DNA - Jakým způsobem? - Jak se projevují? Již v roce 1902

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní

Více

Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip

Více

PP Master Mixy... 13 PPP Master Mix 14 Plain PP Master Mix 15 Combi PPP Master Mix 16 new Plain Combi PP Master Mix 17

PP Master Mixy... 13 PPP Master Mix 14 Plain PP Master Mix 15 Combi PPP Master Mix 16 new Plain Combi PP Master Mix 17 Obsah DNA polymerázy pro PCR a pufry............................... 5 Taq DNA polymeráza 6 Taq DNA polymeráza Unis 7 TaqPurple DNA polymeráza 8 Taq DNA polymeráza 1.1 9 Combi Taq DNA polymeráza 10 LA DNA

Více

DY D NE N X Hana Vlastníková

DY D NE N X Hana Vlastníková DYNEX Hana Vlastníková Molekulární biologie: Vybavení laboratoře na klíč Přístrojová technika Kompatibilní diagnostické soupravy Profesionální přístup SOP Technická podpora Servis Přístrojové vybavení:

Více

Metody používané v MB. analýza proteinů, nukleových kyselin

Metody používané v MB. analýza proteinů, nukleových kyselin Metody používané v MB analýza proteinů, nukleových kyselin Nukleové kyseliny analýza a manipulace Elektroforéza (délka fragmentů, čistota, kvantifikace) Restrikční štěpení (manipulace s DNA, identifikace

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA genetickou podstatu konkrétních proteinů mutace bodové, sekvenční delece/inzerce nukleotidů, chromosomové aberace (numerické, strukturální) polymorfismy konkrétní mutace,

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Exprese genetické informace

Exprese genetické informace Exprese genetické informace Stavební kameny nukleových kyselin Nukleotidy = báze + cukr + fosfát BÁZE FOSFÁT Nukleosid = báze + cukr CUKR Báze Cyklické sloučeniny obsahující dusík puriny nebo pyrimidiny

Více

Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,

Více

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza

Exprese genetického kódu Centrální dogma molekulární biologie DNA RNA proteinu transkripce DNA mrna translace proteosyntéza Exprese genetického kódu Centrální dogma molekulární biologie - genetická informace v DNA -> RNA -> primárního řetězce proteinu 1) transkripce - přepis z DNA do mrna 2) translace - přeložení z kódu nukleových

Více

Seminář izolačních technologií

Seminář izolačních technologií Seminář izolačních technologií Zpracoval: Karel Bílek a Kateřina Svobodová Podpořeno FRVŠ 2385/2007 a 1305/2009 Úpravy a aktualizace: Pavla Chalupová ÚMFGZ MZLU v Brně 1 Lokalizace jaderné DNA 2 http://www.paternityexperts.com/basicgenetics.html

Více

Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI

Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI Výborný přístroj, výborné výsledky Fragmentační analyzátor je automatizovaný kapilárový systém s CE značkou

Více

Detekce Leidenské mutace

Detekce Leidenské mutace Detekce Leidenské mutace MOLEKULÁRNÍ BIOLOGIE 3. Restrikční štěpení, elektroforéza + interpretace výsledků Restrikční endonukleasy(restriktasy) bakteriální enzymy štěpící cizorodou dsdna na kratší úseky

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci

Více

Gymnázium, Brno, Elgartova 3

Gymnázium, Brno, Elgartova 3 Gymnázium, Brno, Elgartova 3 Šablona: III/2 Inovace a zkvalitnění výuky prostřednictvím ICT Název projektu: GE Vyšší kvalita výuky Číslo projektu: CZ.1.07/1.5.00/34.0925 Autor: Mgr. Hana Křivánková Téma:

Více

MIKROBIOLOGIE V BIOTECHNOLOGII

MIKROBIOLOGIE V BIOTECHNOLOGII Biotechnologie MIKROBIOLOGIE V BIOTECHNOLOGII Termín biotechnologie byl poprvé použit v roce 1917 Procesy, při kterých se na tvorbě výsledného produktu podílejí živé organismy Širší definice: biotechnologie

Více

REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK

REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK Molekulární základy dědičnosti - rozšiřující učivo REPLIKACE, BUNĚČNÝ CYKLUS, ZÁNIK BUNĚK REPLIKACE deoxyribonukleové kyseliny (zdvojení DNA) je děj, při kterém se tvoří z jedné dvoušoubovice DNA dvě nová

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu

Více

Alelov specifická PCR

Alelov specifická PCR Pímá analýza muací jedné známé muace (SNP polymorfismy) MOLEKULÁRNÍ DIAGNOSTIKA PÍMOU ANALÝZOU Marin Beránek Pednáka pro magisry a UK PCR RLP viz pedelý seminá ARMS (ASA) Real-ime PCR viz aké pednáka dr

Více

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní

Více

TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE

TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy

Více

DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod.

DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. Od 1.1.2014 DYNEX jediným OFICIÁLNÍM (autorizovaným) distributorem společnosti

Více

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková

Diagnostika retrovirů Lentiviry - HIV. Vladislava Růžičková Diagnostika retrovirů Lentiviry - HIV Vladislava Růžičková VI. Třída RNA-viry se zpětnou transkriptázou RT Čeleď: Retroviridae (hostitelé: Obratlovci) Rody: Alpharetrovirus Betaretrovirus Gammaretrovirus

Více

MODERNÍ BIOFYZIKÁLNÍ METODY:

MODERNÍ BIOFYZIKÁLNÍ METODY: MODERNÍ BIOFYZIKÁLNÍ METODY: POKROČILÉ PRAKTICKÉ VZDĚLÁVÁNÍ V EXPERIMENTÁLNÍ BIOLOGII Operační program Vzdělávání pro konkurenceschopnost Číslo projektu: CZ.1.07/2.3.00/09.0046 Praktický kurz pokročilých

Více

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce

ší šířen METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce METODY ANALÝZY NUKLEOVÝCH KYSELIN Polymerázová řetězová reakce Většina metod analýzy DNA využívá možnost amplifikace DNA v in vitro podmínkách. Polymerázová řetězová reakce - PCR (polymerase chain reaction)

Více

Stanovení Ct hodnoty. Stanovení míry variability na úrovni izolace RNA, reverzní transkripce a real-time PCR

Stanovení Ct hodnoty. Stanovení míry variability na úrovni izolace RNA, reverzní transkripce a real-time PCR Stanovení Ct hodnoty Ct hodnotu (číselný výstup real-time PCR) stanovíme z amplifikačního grafu (grafický výstup real-time PCR) proložením thresholdu skrze lineární část amplifikační křivky. V bodě protnutí

Více

NÁVOD K POUŽITÍ PRO HER2 DNA QUANTIFICATION KIT

NÁVOD K POUŽITÍ PRO HER2 DNA QUANTIFICATION KIT IČ: 80 DIČ: CZ80 sales@intellmed.eu NÁVOD K POUŽITÍ PRO HER DNA QUANTIFICATION KIT IČ: 80 DIČ: CZ80 sales@intellmed.eu OBSAH Návod k použití pro HER DNA QUANTIFICATION KIT.... Úvod.... Označení.... Rozsah

Více

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Kamila Zdeňková Transgenní rostliny, tj. takové rostliny, do jejichž dědičného základu byly metodami genového inženýrství

Více

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního

Více

Příprava rekombinantních molekul pro diagnostické účely

Příprava rekombinantních molekul pro diagnostické účely 1 Příprava rekombinantních molekul pro diagnostické účely doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 2 Obsah přednášky 1) Pojem rekombinantní DNA 2) Historické milníky

Více

Laboratorní přístrojová technika

Laboratorní přístrojová technika Laboratorní přístrojová technika Co najdeme v laboratoři? Přístroje pro obecné použití centrifugy, třepačky, pipety, biohazard boxy Trocha teorie o DNA a PCR Analytické přístroje a příprava vzorků elektroforézy

Více

Genetické markery, markery DNA

Genetické markery, markery DNA Obecná genetika Genetické markery, markery DNA Prof. Ing. Dušan GÖMÖRY, DrSc. Ing. Roman LONGAUER, CSc. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Genetický polymorfismus

Genetický polymorfismus Genetický polymorfismus Za geneticky polymorfní je považován znak s nejméně dvěma geneticky podmíněnými variantami v jedné populaci, které se nachází v takových frekvencích, že i zřídkavá má frekvenci

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky.

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální

Více

ZÁKLADNÍ PRINCIPY A VYUŽITÍ KVANTITATIVNÍ PCR S OHLEDEM NA ONKOLOGICKOU DIAGNOSTIKU

ZÁKLADNÍ PRINCIPY A VYUŽITÍ KVANTITATIVNÍ PCR S OHLEDEM NA ONKOLOGICKOU DIAGNOSTIKU Masarykova univerzita v Brně Přírodovědecká fakulta Katedra Biochemie ZÁKLADNÍ PRINCIPY A VYUŽITÍ KVANTITATIVNÍ PCR S OHLEDEM NA ONKOLOGICKOU DIAGNOSTIKU Bakalářská práce Magdaléna Dvořáková Brno 2007

Více

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Mgr. Klára Vilimovská Dědečková, Ph.D. Synlab genetics s.r.o. Molekulární

Více

Centrální dogma molekulární biologie

Centrální dogma molekulární biologie řípravný kurz LF MU 2011/12 Centrální dogma molekulární biologie Nukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Mendel) 1869 objev nukleových kyselin (Miescher) 1944 genetická informace v nukleových

Více

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI INDUKOVANÉ PŮSOBENÍM ORGANICKÝCH LÁTEK Z PRACHOVÝCH ČÁSTIC V OVZDUŠÍ Kateřina Hanzalová Oddělení genetické ekotoxikologie Ústav experimentální medicíny AV ČR v.v.i.

Více

Písemná zpráva zadavatele

Písemná zpráva zadavatele Písemná zpráva zadavatele veřejné zakázky zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, ve znění účinném ke dni zahájení zadávacího řízení (dále jen ZVZ ). Veřejná zakázka Název: Ostatní

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin:

NUKLEOVÉ KYSELINY. Složení nukleových kyselin. Typy nukleových kyselin: NUKLEOVÉ KYSELINY Deoxyribonukleová kyselina (DNA, odvozeno z anglického názvu deoxyribonucleic acid) Ribonukleová kyselina (RNA, odvozeno z anglického názvu ribonucleic acid) Definice a zařazení: Nukleové

Více

nastavení real-time PCR cykleru Rotor Gene 3000

nastavení real-time PCR cykleru Rotor Gene 3000 Verze: 1.4 Datum poslední revize: 25. 3. 2015 nastavení real-time PCR cykleru Rotor Gene 3000 (Corbett Research) generi biotech OBSAH: 1. Nastavení teplotního profilu a spuštění cykleru... 3 2. Zadání

Více

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Využití techniky RACE (Rapid amplification of complementary DNA ends) pro identifikaci genů pro metalothioneiny Metodické návody pro

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

Molekulárně biologické a cytogenetické metody

Molekulárně biologické a cytogenetické metody Molekulárně biologické a cytogenetické metody Molekulárně biologickému vyšetření obvykle předchází na rozdíl od všech předcházejících izolace nukleových kyselin, což je ve většině případů DNA jako nositelka

Více

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková Metody detekce a identifikace MO se zaměřením na PCR a její variace Kamila Zdeňková Metody detekce a identifikace MO rozdělení metod pro mikrobiologické zkoušení potravin přehled rychlých metod detekce

Více

FNUSA - ICRC Termocyklery pro PCR

FNUSA - ICRC Termocyklery pro PCR Název projektu OP VaVpI: FN u sv. Anny v Brně Mezinárodní centrum klinického výzkumu (FNUSA-ICRC) Číslo projektu: CZ.1.05/1.1.00/02.0123 ZADÁVACÍ DOKUMENTACE pro zadávací řízení podle zákona č. 137/2006

Více

Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich

Více

Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy molekulární a buněčné biologie. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy molekulární a buněčné biologie Přípravný kurz Komb.forma studia oboru Všeobecná sestra Genetický aparát buňky DNA = nositelka genetické informace - dvouvláknová RNA: jednovláknová mrna = messenger

Více

a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy

a) Primární struktura NK NUKLEOTIDY Monomerem NK jsou nukleotidy 1 Nukleové kyseliny Nukleové kyseliny (NK) sice tvoří malé procento hmotnosti buňky ale významem v kódování genetické informace a její expresí zcela nezbytným typem biopolymeru všech živých soustav a)

Více

Havarijní plán PřF UP

Havarijní plán PřF UP Havarijní plán PřF UP v němž se nakládá s geneticky modifikovanými organismy (GMO), zpracovaný podle 20, odst. 4 zákona č. 78/2004 Sb. pro pracoviště kateder Buněčné biologie a genetiky a Oddělení molekulární

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 1. Struktura a replikace DNA Literatura: Alberts a kol.: Základy buněčné biologie Espero Publishing, 2000 Garrett & Grisham: Biochemistry 2nd ed., Saunders

Více

Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie

Nukleové kyseliny. Nukleové kyseliny. Genetická informace. Gen a genom. Složení nukleových kyselin. Centrální dogma molekulární biologie Centrální dogma molekulární biologie ukleové kyseliny 1865 zákony dědičnosti (Johann Gregor Transkripce D R Translace rotein Mendel) Replikace 1869 objev nukleových kyselin (Miescher) 1944 nukleové kyseliny

Více