TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce"

Transkript

1 TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dgmp)

2 Koncept párování bazí je striktně konzervativní Cytosine Guanine Deoxyribosa a fosfát dávají DNA řetězci směr konce dsdna nejsou stejné jednotlivé řetězce duplexu jsou k sobě komplementární 5 end 3 end T A G C HO DNA rětězce duplexu mohou být denaturována a znovu spojena T A G C OH 3 end 5 end

3 T m (melting temperature) je teplota při které je dsdna z poloviny denaturována Tm je závislá na: složení bazí rozpouštědle iontové síle ph délce DNA DNA replikace in vivo vyžaduje několik enzymů separace řetězců syntéza krátkých RNA primerů syntéza dvou nových DNA helixů podílí se enzymy: DNA primasa helikasa DNA polymerasa DNA ligasa SSB-proteiny

4 Vlastnosti DNA polymerasy 1. polymerasová aktivita Replikace probíhá vždy ve směru od 5 na 3 konec Nový nukleotid je přidáván á tedy vždy na 3 OH konec. 2. 3'-5' exonukleasová aktivita -opravná funkce proofreading 3. 5 exonukle exonukleas asová aktivita - odštěpuje RNA primer DNA replikace in vitro vyžaduje pouze jeden enzym DNA Polymerasa 1957 Arthur Kornberg dokázal existenci DNA polymerasy - DNA polymerase I in vitro polymerasa vyžaduje pouze: 4 deoxynukleotidy trifosfáty dsdna templát primer - ssdna nebo RNA s volnou 3'-OH FUNKCE OSTATNÍCH PROTEINů JE in vitro NAHRAZENA ZMĚNOU TEPLOT

5 Syntéza obou řetězců specifické dsdna in vitro 5 3 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3 5 Forward primer dntps 5 3 TTGAGAAAGGAATAAGC DNA POL AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3 5 Syntéza obou řetězců specifické dsdna in vitro 5 3 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC DNA POL TCTTTAGCTCATATACG 3 5 dntps Reverse primer 5 3 GCATATACTCGATTTCT 5 3 TTGAGAAAGGAATAAGCAGAATTCGTTCCAAAAAGAATGAGCTGTTGTTTGCAGAAATCGAGTATATGC AACTCTTTCCTTATTCGTCTTAAGCAAGGTTTTTCTTACTCGACAACAAACGTCTTTAGCTCATATACG 3 5

6 PCR: Co to je? Polymerase Chain Reaction: znamená amplifikace (mnohonásobná replikace) relativně krátkých úseků specifické DNA Základní nástroj molekulární biologie se vzrůstájícím významem i v dalších oborech (botanika, kriminalistika) The idea Ghobind Khorana 1971 Kary Mullis 1983 Nobelova cena 1993 poprvé provedená mnohonásobná in vitro replikace ve zkumavce Jak funguje PCR Řetězová reakce vychází z DNA replikace Spočívá v opakování cyklů denaturace (separace dsdna), navázání primerů a elongace primerů (syntéza nového vlákna DNA) pomocí změn teploty potřeba silného enzymu (polymerasy) který je schopen pracovat při vysokých teplotách termofilní organismy objeveny začátkem 70tých let

7 Jak funguje PCR Polymerasa izolovaná z termofilní baktérie (Thermus aquaticus, Pyrococcus furiosus) zkr. TAQ, PFU Polymerasa až s objevem a použitím TERMOSTABILNÍ POLYMERASY získala PCR na významu Praktické provedení PCR Počáteční denaturace 94 o C 3-5 min denaturace 94 o C 30 sec annealing ~55 o C 30 sec prodlužování 72 o C 1min/kilobáze počet cyklů x

8 Praktické provedení PCR agarozová elektroforéza PCR komponenty Templátová DNA vzorek k amplifikaci Primery krátké specifické úseky DNA zaručující specifitu amplifikace datp, dttp, dctp, dgtp volné stavební jednotky DNA Thermostabilní DNA polymerasa (e.g., Taq, Pfu) Pufr a soli (KCl, MgCl2)

9 Proces PCR Velký nadbytek primeru, dntps a Taq POL k DNA templátu Problémy: PCR je velmi citlivá na kontaminace Častý problém - nespecifická amplifikace Polymerasa pracuje i při nízkých teplotách (e.g., během nastavování reakce) Hot start PCR je řešení (protilátka proti Taq) Amplifikace je často možná i pro ne zcela známou sekvenci primerů např. DNA jiného biologického druhu Degenerované primery (multiple verze s různými bázemi v klíčové pozici (tryptofan + methionin): stupeň degenerace: P R E T T Y F L Y CCA CGA GAA ACA ACA TAC TTC CTA TAC prettyfly protein má kód degenerovaný na 11 pozicích G G G G G T T G T C C C C C tzn. (4)(2)(4)(2)(4)(4)(2)(2)(2)(4)(2) = krát T T T T T A T Touchdown PCR s vyšší přesností v prvních cyklech Maximální velikost produktu +/-5000 bazí pro standardní PCR: Long PCR kits mohou amplifikovat až 35 kbazí

10 Navrhování primerů Primery by měly být bazí dlouhé Nutná znalost alespoň části sekvence amplifikované DNA 3 konec primeru je důležitý: vhodné aby zde byla G nebo C báze Procentuální zastoupení G + C by mělo být 50-60% - ovlivňuje Tm (teplota kdy se váže primer na templát) Primery v jedné reakci by měly mít srovnatelné Tm Vyvarovat se repetitivním sekvencím Tm = (G+C)x4 + (A+T)x2 Vyvarovat se komplementaritě uvnitř či mezi primery degenerované primery max. 20 bp ideální do degenerace 250x Navrhování primerů Příklad navržení primerů: Konvence: DNA se vždy zapisuje ve směru od 5 ku 3 konci Cílová sekvence: (priming místo podtrženo): 5 TATAAGCCATAACGATATTGCTGAGTCAAGTCCACATATCATATGGATGAG AAATGCTTGTGGAGCTGATGTTGATTTGGAGAGACTCTCTCTCTCTCTCTCT CTCTCTCTCTCTCTCTCTCAAACCAGTTAAAGAGTGTGCCAGTAGAG 3 Forward Primer: 5 ATG GAT GAG AAA TGC TTG TG 3 Reverse Primer: 5 ACT GGC ACA CTC TTT AAC TGG 3

11 Praktické provedení PCR objem v mikrozkumavce: ųl složení: Templátová DNA ng1000ng Primery pmols 10mM Tris-CL ph 9.0, 50 mm KCl MgCl mm 50 ųm každého nukleotidu datp, dgtp, dttp, dctp 2 jednotky Taq polymerasy Praktické provedení PCR PCR se provádí v termocyklerech kovový blok z ušlechtilého kovu snadné programování vyhřívané víko

12 PCR Optimalizace Složka AnnealingTeplota - Tm MgCl 2 KCl Enzym, Primer ph Formamid specifická amplifikace nízká nespecifická amplifikace vysoká vysoká nízká vysoká nízká vysoká nízká nespecificky nízká vysoká látky ovlivňující kvalitu PCR: formamid, DMSO, betain atd. pro GC-rich templáty Nespecifická amplifikace Základní typy PCR RT PCR (reverse transcriptase PCR) vlastní PCR předchází syntéza cdna z mrna pomocí RT jako primer slouží GSP (gene specific primer) oligo dt random hexamer primer hledání nových genů tvorba cdna knihoven hledání mutací zjišťování síly exprese různých genů

13 RACE PCR (rapid amplification of cdna ends) vychází z RT-PCR používá se k hledání celé sekvence nového genu nutná alespoň částečná znalost sekvence hledaného genu vhodné pro klonování genů a jeho následnou funkční expresi (GMO)

14 inverzní PCR Amplifikace neznámých segmentů DNA asymetrická PCR sekvenace DNA, příprava hybridizačních sond amplifikuje pouze jeden řetězec dsdna SEKVENCOVÁNÍ DNA automatické sekvenátory využívající asymetrické PCR jednozkumavková reakce PCR s jedním primerem a dideoxyribonukleotidy (ddatp, ddgtp, ddctp, ddttp) dideoxyribonukleotidy značené 4 fluorescenčními markery velice citlivé elektroforetické rozdělení v kapiláře fluorometr s automatickým vyhodnocením

15 multiplex PCR více amplifikací v jedné zkumavce lékařská diagnostika nested PCR 2 po sobě jdoucí PCR zvyšování specificity PCR LA-PCR (long and accurate) amplifikace dlouhých úseků, polymerasové kokteily např. Taq + Pfu polymerasa (180:1) Pwo polymerasa z Pyroccocus woesei DeepVent polymerasa z Termococcus litoralis (hlubokomořská baktérie) DNA polymeráza 5-3 exonukleázová aktivita 3-5 exonukleázová aktivita délka produktu frekvence chyby Taq + 3 kb 10-4 Pfu + 3 kb 1.3 x 10-6 Pwo + 3 kb x 10-6 DeepVent + 12 kb 3.0 x 10-5 long PCR koktejl kb 2.0 x 10-6 PROCESIVITA: jak dlouho se enzym udrží na vlákně STABILITA: kolik minut při denaturační teplotě např Taq 9 min při 97.5 C Pwo 2 hod při 100 C DeepVent 8hod při 100 C

16 in situ RT PCR lokalizace translace a exprese genů real time PCR slouží k přesné kvantifikaci amplifikovaného produktu využití fluorescence interkalačních barviv (etbr) fluorimetr je součástí termocykleru Real-time PCR monitoruje fluorescenci uvolňovanou jako odezvu na každý uskutečněný cyklus v PCR (v reálném čase). + daleko přesnější oproti end-point barvení EtBr při konvenční PCR - náročné na optimalizaci a vybavení

17 aplikace REAL-TIME PCR 1) absolutní kvantifikace množství DNA ve vzorku k externímu standardu, detekce virální či bakteriální DNA, forenzní chemie 2) koncová detekce SNP genotypizace, detekce mutací a polymorfismů 3) relativní kvantifikace princip měření vznikající fluorescence po každém cyklu PCR, stanovení křivek tání

18 chemismus 1) interkalační barviva SYBRgreen interkalace barviva na dvoušroubovici vznikající (amplifikované) DNA precizní výběr primerů nesmí vytvářet dimery nutná kontrola amplifikovaného produktu na křivku denaturačních teplot chemismus 2) hybridizační sondy (TAQman) uvolňování fluorescence po degradaci sondy nutná 5-3 exonukleasová aktivita Taq polymerasy fluorescenční značka: VIC, FAM (fluorescein) zhášeč: Tamra (Tetramethyl-6-Carboxyrhodamine) FRET = Förster/fluorescence resonance energy transfer

19 srovnání TaqMan SybrGreen specifita primery proba PCR podmínky primery PCR podmínky flexibilita singleplex multiplex (max.4) singleplex aplikace kvantifikace SNP detekce kvantifikace cena vysoká nízká kontaminace největší problém PCR aerosol, pipety, staré amplikony částečné řešení URACIL N-GLYKOSYLASA štěpí ss a dsdna s inkorporovaným deoxyuracilem (dutp) termolabilní, 0% aktivita nad 55 C nereaguje s templátem (dttp) dutp v qpcr mixu místo dttp pracuje během nastavení PCR reakce

20 chyby v pipetování templát (cdna) premix (primery, y,p proba,,polymerasa, dntp,,p pufr, srovnávací fluorescenční barvivo) částečné řešení - ROX fluorescence se nemění během PCR cyklů a vzrůstající fluorescence v každé zkumavce vzorku je extrapolována na srovnávací CYCLE NUMBER AMOUNT OF DNA , , , , , , , , , , ,048, ,097, ,194, ,388, ,777, ,554, ,108, ,217, ,435, ,870, ,073,741, ,400,000, ,500,000, ,550,000, ,580,000,000 AMOUNT OF DNA A A AMOUNT OF DNA lineární vynesení PCR CYCLE NUMBER logaritmické vynesení PCR CYCLE NUMBER

21 lineární ~20 do ~1500 C T hodnoty threshold treshold je třeba nastavit tak aby u každého vzorku procházel lineární části křivky C T počet cyklů při kterém fluorescence vzorku překročí threshold (prahovou hodnotu)

22 před každou kvantifikací je třeba vždy udělat standardní křivku absolutní kvantifikace threshold templát: 10x ředění buď přímo cdna, nebo plasmid s naklonovaným genem, který stanovujeme C T koncentrace templátu PARAMETRY STANDARDNÍ KŘIVKY směrnice: ideální -3,32 = 100% efektivita reakce %EFF kolik kopii templátu je zkopírováno v každém cyklu R 2 korelační koeficient (tolerovat se dá ještě 0,995)

23 CYCLE AMOUNT OF DNA AMOUNT OF DNA AMOUNT OF DNA AMOUNT OF DNA 100% EFFICIENCY 90% EFFICIENCY 80% EFFICIENCY 70% EFFICIENCY , ,048 1, ,096 2,213 1, ,192 4,205 2, ,384 7,990 3,748 1, ,768 15,181 6,747 2, ,536 28,844 12,144 4, ,072 54,804 21,859 8, , ,127 39,346 14, , ,842 70,824 23, ,048, , ,482 40, ,097, , ,468 69, ,194,304 1,356, , , ,388,608 2,578, , , ,777, ,898, ,338, , ,554,432 9,307,650 2,408, , ,108,864 17,684,534 4,335, , ,217,728 33,600,615 7,804,726 1,667, ,435,456 63,841,168 14,048,506 2,835, ,870, ,298,220 25,287,311 4,819, ,073,741, ,466,618 45,517,160 8,193,466 MOUNT OF DNA AM %EFF 100% = 2.00x 90% = 1.90x 80% = 1.80x 70% = 1.70x 10,000,000,000 1,000,000, ,000,000 10,000,000 1,000, ,000 10,000 1, % EFF 90% EFF 80% EFF 70% EFF PCR CYCLE NUMBER relativní kvantifikace je možná pouze pokud sledovaný gen a referenční gen má srovnatelnou a vysokou efektivitu > 90% ± 3% REFERENČNÍ GEN relativní kvantifikace musí mít stabilní expresi ve všech studovaných vzorcích nejčastěji provozní geny (house-keeping) actin, GAPDH, cyklofilin, 18S RNA

24 TaqMan Human Endogenous Control Plate ΔC T ΔC T = 2 čtyřnásobný rozdíl v expresi změna v jednom cyklu při 100% efektivitě je rovna dvounásobné změně ve výchozí koncentraci cdna 18S ribosomální RNA přepisována jinou RNA polymerasou než mrna byly popsány výkyvy mezi množstvím rrna a mrna nelze použít pokud se vychází z mrna

25 vyhodnocení kalibrátor sample 1 sample 2 izolace celkové RNA (mrna) přepis do cdna navržení primerů a sond pro referenční gen a studovaný (GOI) určení č standardních d křivek k pro oba geny a stanovení efektivity it GAPDH GOI GAPDH GOI GAPDH GOI vyhodnocení kalibrátor sample A kalibrátor sample B sample A sample B GAPDH GOI

26 1 vyhodnocení změny exprese pro sample 1 metoda delta delta cé té 1. určíme C T pro všechny křivky 2. určíme C T GOI -C TGAPDH pro kalibrátor ΔC T kalibrátor 3. určíme C T GOI -C TGAPDH pro sample 1 ΔC T sample 1 4. ΔC Tsample 1 - ΔC Tkalibrátor ΔΔC T výsledek (kolikrát je gen více či méně exprimován) 2 -ΔΔCT 2 vyhodnocení počítá se i s efektivitou Sample A - kalibrátor Sample B - vzorek

27 3 vyhodnocení pomocí standardů o známe koncentraci se spočítají počty kopií ve vzorcích příklad linie živočišných buněk byla podstoupena umlčení (silencing) genu pkg2 s linie transfekované a netransfekované (kalibrátor) byla izolována RNA, přepsana do cdna a provedeno qpcr s primery a probou na gen pkg2 a GAPDH (referenční gen). Snížila se exprese genu pkg2 po umlčení? pkg2 Eff 86% cdna kalibrator C T 22,48 cdna silencing C T 22,3 GAPDH Eff 77% cdna kalibrator C T 20,05 cdna silencing C T 16,97 -ΔΔCT pkg2 cdna 2 kalibrator 2 (5,33-2,43) (1+0,86) 0,18 /(1+0,77) 3,08 1,1x10 4 kopií DNA 123 1,23x kopií cdna silencing GAPDH cdna kalibrator cdna silencing 0,134 0,192 0,194 Gen snížil expresi 7,5x 5,2x 5,2x 1,55x10 4 kopií 8,92x10 4 kopií

28 navrhování primerů velikost amplikonu bp délka primerů ů 20 bp primery se nesmí překrývat s próbou Tm C optimální teplota pro degradaci proby exonukleasovou aktivitou GC obsah 50-70% žádné vlásenky žádné dimery (self-dimery, cross-dimery)

29 délka proby navrhování proby bp primery se nesmí překrývat s próbou Tm C o 10 C vyšší než Tm primerů GC obsah 50-70% žádné G na 5 konci zháší fluorescenci FAM barvy navrhování primerů a proby

30 kontaminace genomickou DNA 1) ošetření vzorků před RT DNasou 2) navržení primerů do dvou exonů mezi nimiž je dlouhý intron 3) navržení primeru nebo proby na přechod intron/exon minor groove binding MGB PROBY stabilizuje vazbu proby na ssdna výrazně zvyšuje Tm můžeme navrhovat krátké proby při zachování vysoké Tm

31 MGB PROBY využití pro alelické diskriminace

32 kolik replikací a kdy replikovat? sample extrakce RNA přepis do cdna qpcr 3X 6X kolik replikací a kdy replikovat? ideální 3x sample extrakce RNA přepis do cdna qpcr 27X

33 instrumentace 7500 Real Time PCR System 7900HT Real Time PCR System StepONE Real Time PCR System halogenová lampa emisní filtry zesilovač ccd kamera excitační filtry zkumavky se vzorky v peltierovém bloku

34 instrumentace

35 Využití REAL TIME PCR pro detekci jednobodové mutace (lékařská diagnostika) HRM ANALYSA (HIGH RESOLUTION MELT) detekce SNP bez specifických sond díky kvalitní instrumentaci Corbett (±0.02 C) a nové generaci interkalačních barviv (LCGreenPlus)

36 HRM ANALYSA pro amplikony do 200bp Aplikace PCR a využití v praxi

37 Aplikace PCR a využití v praxi DIAGNOSTIKA V MEDICÍNĚ detekce virových a bakteriálních onemocnění Aplikace PCR a využití v praxi DIAGNOSTIKA V MEDICÍNĚ detekce geneticky vrozených chorob (mutace DNA) - AS PCR alelicky specifická PCR primer navržen tak, že mutace odpovídá konci primeru fragmenty DNA s nespárovanými konci se pohybují v elektrickém poli pomaleji - Real time PCR pomocí fluorescenční sondy odpovídající mutaci Např. detekce cystické fibrózy, choroba je podmíněná třínukleotidovou delecí v genu CFTR cystic fibrosis transmembrane regulator

38 Aplikace PCR a využití v praxi NEZÁVADNOST POTRAVIN Aplikace PCR a využití v praxi KRIMINALISTIKA VNRT variable number of tandem repeat vyskytují se na různých lokusech chromozomů a v populací kolísají mezi jedinci i v počtu opakování mezi 4-40x 40 např. ř GTGTGTGT

39 Aplikace PCR a využití v praxi ANALÝZA POTRAVIN molekulárně-genetické zhodnocení surovin živočišného a rostlinného původu, ů které byly vyprodukovány klasickým pěstováním (chovem) nebo s použitím genového inženýrství průkaz falšování potravin druhovou záměnou (rostlinného i živočišného původu) identifikace mikroorganismů kontaminující potraviny nebo EVOLUČNÍ BIOLOGIE geneticky změněných mikroorganismů ORNITOLOGIE používaných jako startovací nebo ochranné kultury v produkci potravin. skot ovce prase koza TEST

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek

Enzymy v molekulární biologii, RFLP. Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii, RFLP Molekulární biologie v hygieně potravin 3, 2014/15, Ivo Papoušek Enzymy v molekulární biologii umožňují nám provádět celou řadu přesně cílených manipulací Výhody enzymů:

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů

Více

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Kamila Zdeňková Transgenní rostliny, tj. takové rostliny, do jejichž dědičného základu byly metodami genového inženýrství

Více

KUPNÍ SMLOUVA. dle 409 a násl. zákona č. 513/1991 Sb., obchodního zákoníku, ve znění pozdějších předpisů (dále jen obchodní zákoník ) Smluvní strany:

KUPNÍ SMLOUVA. dle 409 a násl. zákona č. 513/1991 Sb., obchodního zákoníku, ve znění pozdějších předpisů (dále jen obchodní zákoník ) Smluvní strany: KUPNÍ SMLOUVA dle 409 a násl. zákona č. 513/1991 Sb., obchodního zákoníku, ve znění pozdějších předpisů (dále jen obchodní zákoník ) Smluvní strany: prodávající:... zapsaná v obchodním rejstříku vedeném...,

Více

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková

Metody detekce a identifikace MO se zaměřením na PCR a její variace. Kamila Zdeňková Metody detekce a identifikace MO se zaměřením na PCR a její variace Kamila Zdeňková Metody detekce a identifikace MO rozdělení metod pro mikrobiologické zkoušení potravin přehled rychlých metod detekce

Více

FNUSA - ICRC Termocyklery pro PCR

FNUSA - ICRC Termocyklery pro PCR Název projektu OP VaVpI: FN u sv. Anny v Brně Mezinárodní centrum klinického výzkumu (FNUSA-ICRC) Číslo projektu: CZ.1.05/1.1.00/02.0123 ZADÁVACÍ DOKUMENTACE pro zadávací řízení podle zákona č. 137/2006

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

nastavení real-time PCR cykleru Rotor Gene 3000

nastavení real-time PCR cykleru Rotor Gene 3000 Verze: 1.4 Datum poslední revize: 25. 3. 2015 nastavení real-time PCR cykleru Rotor Gene 3000 (Corbett Research) generi biotech OBSAH: 1. Nastavení teplotního profilu a spuštění cykleru... 3 2. Zadání

Více

Písemná zpráva zadavatele

Písemná zpráva zadavatele Písemná zpráva zadavatele veřejné zakázky zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, ve znění účinném ke dni zahájení zadávacího řízení (dále jen ZVZ ). Veřejná zakázka Název: Ostatní

Více

Univerzita Pardubice Chemicko-technologická fakulta Katedra analytické chemie

Univerzita Pardubice Chemicko-technologická fakulta Katedra analytické chemie Univerzita Pardubice Chemicko-technologická fakulta Katedra analytické chemie 12. licenční studium PYTHAGORAS Statistické zpracování dat Kalibrace a limity její přesnosti Semestrální práce 2009 RNDr. Markéta

Více

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU

V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014. Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU V. letní škola metod molekulární biologie nukleových kyselin a genomiky 16. - 20. 6. 2014 Ústav morfologie, fyziologie a genetiky zvířat AF MENDELU Zemědělská 1, Budova A, 4. patro (učebny dle programu)

Více

Verze: 1.2 Datum poslední revize: 24.9.2014. Nastavení real-time PCR cykleru. Light Cycler 480 Instrument. (Roche) generi biotech

Verze: 1.2 Datum poslední revize: 24.9.2014. Nastavení real-time PCR cykleru. Light Cycler 480 Instrument. (Roche) generi biotech Verze: 1.2 Datum poslední revize: 24.9.2014 Nastavení real-time PCR cykleru Light Cycler 480 Instrument (Roche) generi biotech OBSAH 1. Nastavení teplotního profilu...3 1.1. Nastavení nového teplotního

Více

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob

Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob Preimplantační genetická diagnostika (PGD) Molekulárně-genetická diagnostika vybraných dědičných chorob PGD preimplantační genetická diagnostika zahrnuje soubor technik, které se používají pro zjištění

Více

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha

Veronika Janů Šárka Kopelentová Petr Kučera. Oddělení alergologie a klinické imunologie FNKV Praha Veronika Janů Šárka Kopelentová Petr Kučera Oddělení alergologie a klinické imunologie FNKV Praha interakce antigenu s protilátkou probíhá pouze v místech epitopů Jeden antigen může na svém povrchu nést

Více

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

Molekulární základ dědičnosti

Molekulární základ dědičnosti Molekulární základ dědičnosti Dědičná informace je zakódována v deoxyribonukleové kyselině, která je uložena v jádře buňky v chromozómech. Zlomovým objevem pro další rozvoj molekulární genetiky bylo odhalení

Více

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC

Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC 1 Výrobce Návod k Použití Soupravy SURVEYOR Scan KRAS Kit Exon 2 CE IVD pro Systémy DHPLC Tento návod k použití si důkladně přečtěte před použitím tohoto produktu. Uschovejte si tento návod k použití,

Více

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)

Více

P ehled výsledk z Referen ní laborato e

P ehled výsledk z Referen ní laborato e P ehled výsledk z Referen ní laborato e 1,3 Hajdúch M, 1,3 Trojanec R, 2,3 Kolá Z, 1,3 Bouchalová K, 2,3 Sedláková E. 1 Laborato experimentální medicíny p i D tské klinice LF UP a FN Olomouc 2 Laborato

Více

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA

Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Směrnice správné laboratorní praxe pro vyšetřování nejčastějších mutací v mitochondriální DNA Pozn.: 1) Směrnice nezahrnují kritéria klinické indikace k vlastnímu molekulárně genetickému vyšetření a obecné

Více

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová. KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI

Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová. KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI Jaroslava Ovesná, Jan Hodek, Lucie Pavlátová KVALITATIVNÍ STANOVENÍ TRANSGENNÍ LINIE RÝŽE Bt 63 METODOU PCR METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2009 Metodika byla vypracována pracovníky

Více

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP

EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ. I. Šubrt Společnost lékařské genetiky ČLS JEP EKONOMICKÉ ASPEKTY GENETICKÝCH VYŠETŘENÍ I. Šubrt Společnost lékařské genetiky ČLS JEP Lékařská genetika Lékařský obor zabývající se diagnostikou a managementem dědičných onemocnění Genetická prevence

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

ZADÁVACÍ PODMÍNKY. Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT) Sídlo: U Nemocnice 2094/1, 128 20 Praha 2 IČ / DIČ

ZADÁVACÍ PODMÍNKY. Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT) Sídlo: U Nemocnice 2094/1, 128 20 Praha 2 IČ / DIČ VÝZVA K PODÁNÍ NABÍDEK DO VÝBĚROVÉHO ŘÍZENÍ NA ZADÁVACÍ PODMÍNKY Název zakázky: Systém Real-Time PCR 1. Identifikační údaje zadavatele Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT)

Více

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie.

Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Návrh směrnic pro správnou laboratorní diagnostiku Friedreichovy ataxie. Připravila L.Fajkusová Online Mendelian Inheritance in Man: #229300 FRIEDREICH ATAXIA 1; FRDA *606829 FRDA GENE; FRDA Popis onemocnění

Více

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky

Cystická fibróza. Iveta Valášková ivalskova@fnbrno.cz. Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza Iveta Valášková ivalskova@fnbrno.cz Fakultní nemocnice Brno Oddělení lékařské genetiky Cystická fibróza nejčastěji se vyskytující autozomálně recesivní dědičná metabolická porucha v zakavkazské

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Molekulární markery PCR, RAPD, RFLP, AFLP, mikrosatelity, sekvenace Genetické markery Genetické markery

Více

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací

Genetika. Genetika. Nauka o dědid. dičnosti a proměnlivosti. molekulárn. rní buněk organismů populací Genetika Nauka o dědid dičnosti a proměnlivosti Genetika molekulárn rní buněk organismů populací Dědičnost na úrovni nukleových kyselin Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci

Více

FLUORESCENČNÍ MIKROSKOP

FLUORESCENČNÍ MIKROSKOP FLUORESCENČNÍ MIKROSKOP na gymnáziu Pierra de Coubertina v Táboře Pavla Trčková, kabinet Biologie, GPdC Tábor Co je fluorescence Fluorescence je jev spočívající v tom, že některé látky (fluorofory) po

Více

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK

Richard Prùša. Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK Richard Prùša Richard Prùša Ústav klinické biochemie a patobiochemie 2. lékaøské fakulty UK . Základy analytických metod v klinické molekulární biologii Richard Prùša Praha 1997 Základy analytických metod

Více

Využití PCR pro studium mikrobiologických biodegradačních procesů. Bc. Tereza Dobešová

Využití PCR pro studium mikrobiologických biodegradačních procesů. Bc. Tereza Dobešová Využití PCR pro studium mikrobiologických biodegradačních procesů Bc. Tereza Dobešová Diplomová práce 011 ABSTRAKT Cílem diplomové práce bylo ověřit funkčnost a optimalizovat podmínky primerů, jejichž

Více

Filozofie validace. Je validace potřebná? Mezinárodní doporučení pro provádění validací ve forenzně genetických laboratořích

Filozofie validace. Je validace potřebná? Mezinárodní doporučení pro provádění validací ve forenzně genetických laboratořích INVESTICE DO ROZVOJE VZDĚLÁVÁNÍ Vzdělávání v oblasti forenzní genetiky reg. č. CZ.1.07/2.3.00/09.0080 Mezinárodní doporučení pro provádění validací ve forenzně genetických laboratořích INVESTICE DO ROZVOJE

Více

Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR

Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR Aleš Vráblík, Jan Hodek, Jaroslava Ovesná Metodika detekce vnitřního genu hrachu setého lektinu pomocí PCR METODIKA PRO PRAXI Výzkumný ústav rostlinné výroby, v.v.i. 2012 Metodika byla vypracována pracovníky

Více

Absorpční spektroskopie při biologické analýze molekul

Absorpční spektroskopie při biologické analýze molekul Absorpční spektroskopie při biologické analýze molekul Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 8.11.2007 7 1 UV spektroskopie DNA a proteinů Všechny atomy absorbují v UV oblasti

Více

Vývoj metod založených na PCR a jejich aplikace v onkologickém výzkumu a praxi

Vývoj metod založených na PCR a jejich aplikace v onkologickém výzkumu a praxi Vývoj metod založených na PCR a jejich aplikace v onkologickém výzkumu a praxi Development of PCR Methods and Their Applications in Oncological Research and Practice Hrstka R., Kolářová T., Michalová E.,

Více

Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE

Více

Nukleové kyseliny (polynukleotidy) Nukleové kyseliny a nadmolekulové komplexy polynukleotidů buněčných struktur

Nukleové kyseliny (polynukleotidy) Nukleové kyseliny a nadmolekulové komplexy polynukleotidů buněčných struktur Nukleové kyseliny (polynukleotidy) Nukleové kyseliny a nadmolekulové komplexy polynukleotidů buněčných struktur Objevitelem je Friedrich Miescher (1887) NK stojí v hierarchii látek potřebných k existenci

Více

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody

Návod k použití souprav. Wipe test. Kontaminační kontrola. Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody Návod k použití souprav Wipe test Kontaminační kontrola Testovací souprava pro kontrolu kontaminace využívající molekulárně - biologické metody REF 7091 40 reakcí 1. Popis výrobku V posledních letech se

Více

Metody detekce poškození DNA

Metody detekce poškození DNA STABILITA GENOMU II. Metody detekce poškození DNA Metody detekce poškození DNA Možnosti stanovení: 1. poškození DNA per se nebo 2. jeho následky mutace genů a mutace chromosomů 1. Detekce poškození DNA

Více

Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi

Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi. Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Metoda Live/Dead aneb využití fluorescenční mikroskopie v bioaugmentační praxi Juraj Grígel Inovativní sanační technologie ve výzkumu a praxi Co je to vlastně ta fluorescence? Některé látky (fluorofory)

Více

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD

cílem mnoha terapií je dostatečně zvýšit hladinu dystrofinu a změnit DMD fenotyp na BMD Shrnutí webináře Dystrofin 101: vše, co jste kdy chtěli vědět o dystrofinu (a nebáli jste se zeptat) Francesco Muntoni (University College of London), John Porter (PPMD) Dystrofinopatie: DMD versus BMD

Více

O původu života na Zemi Václav Pačes

O původu života na Zemi Václav Pačes O původu života na Zemi Václav Pačes Ústav molekulární genetiky Akademie věd ČR centrální dogma replikace transkripce DNA RNA protein reverzní transkripce translace informace funkce Exon 1 Intron (413

Více

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR

Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR Mikrobiologický ústav AV ČR Příloha 6 Havarijní plán 1/5 Havarijní plán pro práci s geneticky modifikovanými mikroorganismy Mikrobiologický ústav AV ČR a) Adresa pracoviště Mikrobiologický ústav AV ČR

Více

Jsme tak odlišní. Co nás spojuje..? Nukleové kyseliny

Jsme tak odlišní. Co nás spojuje..? Nukleové kyseliny Jsme tak odlišní Co nás spojuje..? ukleové kyseliny 1 UKLEVÉ KYSELIY = K anj = A ositelky genetických informací Základní význam pro všechny organismy V buňkách a virech Identifikace v buněčném jádře (nucleos)

Více

generi biotech nastavení real-time PCR cykleru Applied Biosystems 7300 a 7500 Fast Real-Time System (Applied Biosystems)

generi biotech nastavení real-time PCR cykleru Applied Biosystems 7300 a 7500 Fast Real-Time System (Applied Biosystems) Verze: 1.2 Datum poslední revize: 24.9.2014 nastavení real-time PCR cykleru Applied Biosystems 7300 a 7500 Fast Real-Time System (Applied Biosystems) generi biotech OBSAH 1. Nastavení nového teplotního

Více

Vzdělávání zdravotních laborantek v oblasti molekulární biologie

Vzdělávání zdravotních laborantek v oblasti molekulární biologie Vzdělávání zdravotních laborantek v oblasti molekulární biologie Beránek M., Drastíková M. Ústav klinické biochemie a diagnostiky, Lékařská fakulta UK a Fakultní nemocnice Hradec Králové beranek@lfhk.cuni.cz

Více

Sandwichová metoda. x druhů mikrokuliček rozlišených různou kombinací barev (spektrální kód)

Sandwichová metoda. x druhů mikrokuliček rozlišených různou kombinací barev (spektrální kód) Jindra Vrzalová x druhů mikrokuliček rozlišených různou kombinací barev (spektrální kód) na každém druhu je navázána molekula vázající specificky jeden analyt (protilátka, antigen, DNAsonda,,) Sandwichová

Více

Validace a verifikace molekulárně biologických metod založených na analýze extrahumánního genomu

Validace a verifikace molekulárně biologických metod založených na analýze extrahumánního genomu Validace a verifikace molekulárně biologických metod založených na analýze extrahumánního genomu Doplněk k doporučení výboru České společnosti klinické biochemie o validaci a verifikaci analytických metod

Více

Posouzení citlivosti, specifity a přesnosti identifikace nefermentujících Gram-negativních tyčinek pomocí PCR-HRMA

Posouzení citlivosti, specifity a přesnosti identifikace nefermentujících Gram-negativních tyčinek pomocí PCR-HRMA Univerzita Palackého v Olomouci Přírodovědecká fakulta Katedra buněčné biologie a genetiky Posouzení citlivosti, specifity a přesnosti identifikace nefermentujících Gram-negativních tyčinek pomocí PCR-HRMA

Více

Biomarkery - diagnostika a prognóza nádorových onemocnění

Biomarkery - diagnostika a prognóza nádorových onemocnění Biomarkery - diagnostika a prognóza nádorových onemocnění O. Topolčan,M.Pesta, J.Kinkorova, R. Fuchsová Fakultní nemocnice a Lékařská fakulta Plzeň CZ.1.07/2.3.00/20.0040 a IVMZČR Témata přednášky Přepdpoklady

Více

Výuka genetiky na Přírodovědecké fakultě MU

Výuka genetiky na Přírodovědecké fakultě MU MASARYKOVA UNIVERZITA Přírodovědecká fakulta Výuka genetiky na Přírodovědecké fakultě MU Jiří Doškař Ústav experimentální biologie, Oddělení genetiky a molekulární biologie 1 V akademickém roce 1964/1965

Více

Diagnostické metody v lékařské mikrobiologii

Diagnostické metody v lékařské mikrobiologii Diagnostické metody v lékařské mikrobiologii Výuková prezentace z: Lékařské mikrobiologie Jan Smíšek ÚLM 3. LF UK 2009 Princip identifikace Soubor znaků s rozdílnou diskriminační hodnotou Základní problémy

Více

2. PROTEINOVÉ TECHNIKY

2. PROTEINOVÉ TECHNIKY OBSAH 1. DNA TECHNIKY (P. Kotrba, Z. Knejzlík) 1 1.1 Polymerasová řetězová reakce - klonování DNA in vitro 1 1.2 Polymorfismus DNA a jeho analýza 3 1.3 VNTR sekvence, jejich význam v kriminalistice a diagnostice

Více

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1

Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 Beličková 1, J Veselá 1, E Stará 1, Z Zemanová 2, A Jonášová 2, J Čermák 1 1 Ústav hematologie a krevní transfuze, Praha 2 Všeobecná fakultní nemocnice, Praha MDS Myelodysplastický syndrom (MDS) je heterogenní

Více

Co se o sobě dovídáme z naší genetické informace

Co se o sobě dovídáme z naší genetické informace Genomika a bioinformatika Co se o sobě dovídáme z naší genetické informace Jan Pačes, Mgr, Ph.D Ústav molekulární genetiky AVČR, CZECH FOBIA (Free and Open Bioinformatics Association) hpaces@img.cas.cz

Více

CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION

CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION CLP ANALYSIS OF MOLECULAR MARKERS AFLP ANALYSIS CZECH VERSION AFLP ANALÝZA *** Technika AFLP (Amplification Fragment Lenght Polymorphism - polymorfismus délky amplifikovaných fragmentů) je modifikací RFLP,

Více

Falšování potravin. MVDr. Matej Pospiech, Ph.D.

Falšování potravin. MVDr. Matej Pospiech, Ph.D. Falšování potravin MVDr. Matej Pospiech, Ph.D. Mendelova univerzita, 31.10.2013 Obsah přednášky úvod, historie co považujeme za falšování specifika falšování potravin nejčastější způsoby falšování u jednotlivých

Více

PCR Spotřební materiál. Markéta Jeřábková 16.06.2010

PCR Spotřební materiál. Markéta Jeřábková 16.06.2010 PCR Spotřební materiál Markéta Jeřábková 16.06.2010 Obsah 1. twin.tec PCR Plates 2. PCR Tubes, PCR Tube Strips a Cap Strips 3. Films a Foils 4. twin.tec real-time PCR Plates Masterclear Cap Strips a real-time

Více

MOLEKULÁRNÍ ZÁKLADY DĚDIČNOSTI

MOLEKULÁRNÍ ZÁKLADY DĚDIČNOSTI Maturitní téma č. 33 MOLEKULÁRNÍ ZÁKLADY DĚDIČNOSTI NUKLEOVÉ KYSELINY - jsou to makromolekuly tvořené řetězci vzájemně spojených nukleotidů. Molekula nukleotidu sestává z : - pětiuhlíkatého monosacharidu

Více

Huntingtonova choroba

Huntingtonova choroba Huntingtonova choroba Renata Gaillyová OLG FN Brno Huntingtonova choroba je dědičné neurodegenerativní onemocnění mozku, které postihuje jedince obojího pohlaví příznaky se obvykle začínají objevovat mezi

Více

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno

Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Co nás učí nádory? Prof. RNDr. Jana Šmardová, CSc. Ústav patologie FN Brno Přírodovědecká a Lékařská fakulta MU Brno Brno, 17.5.2011 Izidor (Easy Door) Osnova přednášky 1. Proč nás rakovina tolik zajímá?

Více

RNA interference (RNAi)

RNA interference (RNAi) Liběchov, 29. 11. 2013 RNA interference (RNAi) post-transkripční umlčení genové exprese přirozený mechanismus regulace genové exprese a genomové stability obranný antivirový mechanismus konzervovaný mechanismus

Více

Projekt realizovaný na SPŠ Nové Město nad Metují

Projekt realizovaný na SPŠ Nové Město nad Metují Projekt realizovaný na SPŠ Nové Město nad Metují s finanční podporou v Operačním programu Vzdělávání pro konkurenceschopnost Královéhradeckého kraje Modul 02 Přírodovědné předměty Hana Gajdušková 1 Viry

Více

Metodika analýzy mléčných výrobků a jejich sójových analogů na přítomnost RoundUp Ready sóji

Metodika analýzy mléčných výrobků a jejich sójových analogů na přítomnost RoundUp Ready sóji Zuzana Tesařová, Dana Šídová, Aleš Vráblík, Jan Hodek, Jaroslava Ovesná Metodika analýzy mléčných výrobků a jejich sójových analogů na přítomnost RoundUp Ready sóji METODIKA PRO PRAXI Výzkumný ústav rostlinné

Více

Real-time cykler s analýzou tání s vysokým rozlišením

Real-time cykler s analýzou tání s vysokým rozlišením VÝZVA PRO PODÁNÍ NABÍDEK VEŘEJNÁ ZAKÁZKA S NÁZVEM: Real-time cykler s analýzou tání s vysokým rozlišením 1. Identifikační údaje zadavatele: Název zadavatele: Univerzita Palackého v Olomouci sídlo zadavatele:

Více

Zkušenosti s diagnostikou sepse pomocí testu SeptiFast Test M GRADE. Zdeňka Doubková Klinická mikrobiologie a ATB centrum VFN Praha

Zkušenosti s diagnostikou sepse pomocí testu SeptiFast Test M GRADE. Zdeňka Doubková Klinická mikrobiologie a ATB centrum VFN Praha Zkušenosti s diagnostikou sepse pomocí testu SeptiFast Test M GRADE Zdeňka Doubková Klinická mikrobiologie a ATB centrum VFN Praha Definice: Sepse je definována jako syndrom systémové zánětlivé odpovědi

Více

Pavel Čermák. Thomayerova nemocnice Praha - Krč. 14.2.2013 výroční zasedání SLM

Pavel Čermák. Thomayerova nemocnice Praha - Krč. 14.2.2013 výroční zasedání SLM Pavel Čermák Thomayerova nemocnice Praha - Krč Úkoly na rok 2012 Vytvoření seznamu přístrojů Doplnění podkladů pro kalkulaci Možná úprava některých stávajících výkonů?? Revize pracovních časů u všech výkonů

Více

analýza dat a interpretace výsledků

analýza dat a interpretace výsledků Genetická transformace bakterií III analýza dat a interpretace výsledků Předmět: Biologie ŠVP: Prokaryotní organismy, genetika Doporučený věk žáků: 16-18 let Doba trvání: 45 minut Specifické cíle: analyzovat

Více

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 10 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 10 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 26.06.2014 Ročník: 6AF, 6BF Anotace DUMu: Procesy následující bezprostředně po transkripci.

Více

Biochemie. ochrana životního prostředí analytická chemie chemická technologie Forma vzdělávání: Platnost: od 1. 9. 2009 do 31. 8.

Biochemie. ochrana životního prostředí analytická chemie chemická technologie Forma vzdělávání: Platnost: od 1. 9. 2009 do 31. 8. Studijní obor: Aplikovaná chemie Učební osnova předmětu Biochemie Zaměření: ochrana životního prostředí analytická chemie chemická technologie Forma vzdělávání: denní Celkový počet vyučovacích hodin za

Více

TheraScreen : souprava k detekci mutací K-RAS Pro detekci 7 typů mutací genu K-RAS

TheraScreen : souprava k detekci mutací K-RAS Pro detekci 7 typů mutací genu K-RAS TheraScreen : souprava k detekci mutací K-RAS Pro detekci 7 typů mutací genu K-RAS K použití se systémem Roche LightCycler 480 Real-Time PCR (Přístroj II) (katalogové číslo: 05015278001) a se systémem

Více

nastavení real-time PCR cykléru icycler iq5 Multi-Color Real-Time PCR Detection System

nastavení real-time PCR cykléru icycler iq5 Multi-Color Real-Time PCR Detection System Verze: 1.0 Datum poslední revize: 2.1.2014 nastavení real-time PCR cykléru icycler iq5 Multi-Color Real-Time PCR Detection System (BioRad) generi biotech OBSAH: 1. Spuštění již existujícího či nastavení

Více

Prezentace školy. 00216224 Masarykova univerzita Žerotínovo nám. 9, Brno, Jihomoravský kraj. Veřejná vysoká škola

Prezentace školy. 00216224 Masarykova univerzita Žerotínovo nám. 9, Brno, Jihomoravský kraj. Veřejná vysoká škola Prezentace školy 00216224 Masarykova univerzita Žerotínovo nám. 9, Brno, Jihomoravský kraj Veřejná vysoká škola Spolupráce MU s podniky Spolupráce s podniky Výzkum a vývoj Studenti Další vzdělávání Ostatní

Více

C V C. Návod k použití pro Biofortuna SSPGo TM HLA Wipe Test BF-40-01. Revize 3. Červenec 2014

C V C. Návod k použití pro Biofortuna SSPGo TM HLA Wipe Test BF-40-01. Revize 3. Červenec 2014 Dot146v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Strana 1 / 8 Návod k použití pro Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Revize 3 Červenec 2014 Dot146v1 Instructions for

Více

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika

DUM č. 3 v sadě. 37. Bi-2 Cytologie, molekulární biologie a genetika projekt GML Brno Docens DUM č. 3 v sadě 37. Bi-2 Cytologie, molekulární biologie a genetika Autor: Martin Krejčí Datum: 02.06.2014 Ročník: 6AF, 6BF Anotace DUMu: chromatin - stavba, organizace a struktura

Více

WWW.DYNEX.CZ. diagnostiky LF a FN Hradec Králové

WWW.DYNEX.CZ. diagnostiky LF a FN Hradec Králové Možnosti a úskalí detekce DNA Borrelia burgdorferi sensu lato Bolehovská R., Plíšková L., Ústav klinické i ké biochemie i a diagnostiky LF a FN Hradec Králové obtížná Diagnostika lymeské boreliózy klinický

Více

HISTO SPOT SSO soupravy

HISTO SPOT SSO soupravy Návod k použití HISTO SPOT SSO soupravy testovací soupravy pro tkáňovou typizaci HLA alel molekulárně biologickými metodami IVD katalogové číslo 726010: HISTO SPOT A 4D (96 testů) verze: 11 / 2013 katalogové

Více

doc. RNDr. Milan Bartoš, Ph.D.

doc. RNDr. Milan Bartoš, Ph.D. doc. RNDr. Milan Bartoš, Ph.D. Konference Klonování a geneticky modifikované organismy Parlament České republiky, Poslanecká sněmovna 7. května 2015, Praha Výroba léků rekombinantních léčiv Výroba diagnostických

Více

Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění

Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění Klin. Biochem. Metab., 14 (35), 2006, No. 2, p. 89 95. Možnosti využití DNA čipů v molekulární diagnostice dědičných onemocnění Gojová L., Kozák L. Centrum molekulární biologie a genové terapie, Fakultní

Více

Výuka genetiky na Přírodovědecké fakultě UK v Praze

Výuka genetiky na Přírodovědecké fakultě UK v Praze Výuka genetiky na Přírodovědecké fakultě UK v Praze Studium biologie na PřF UK v Praze Bakalářské studijní programy / obory Biologie Biologie ( duhový bakalář ) Ekologická a evoluční biologie ( zelený

Více

Bioinformatika. hledání významu biologických dat. Marian Novotný. Friday, April 24, 15

Bioinformatika. hledání významu biologických dat. Marian Novotný. Friday, April 24, 15 Bioinformatika hledání významu biologických dat Marian Novotný Bioinformatika sběr biologických dat archivace biologických dat organizace biologických dat interpretace biologických dat 2 Biologové sbírají

Více

Činnost a aktivity zdravotníků v oblasti klonování a GMO

Činnost a aktivity zdravotníků v oblasti klonování a GMO Konference ZV PS ČR Klonování a GMO dne 7. 5. 2015 v Praze Činnost a aktivity zdravotníků v oblasti klonování a GMO Vladimír Ostrý Státní zdravotní ústav v Praze Centrum zdraví, výživy a potravin v Brně

Více

Praktický kurz. Moderní biofyzikální přístupy v experimentální biologii

Praktický kurz. Moderní biofyzikální přístupy v experimentální biologii Oddělení funkční genomiky a proteomiky Ústav experimentální biologie, Přírodovědecká fakulta Masarykova univerzita Praktický kurz Moderní biofyzikální přístupy v experimentální biologii Místo konání: Brno,

Více

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche

Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Konečná zpráva hodnocení různých způsobů přípravy vzorků pro AMPLICOR HPV test firmy Roche Charakteristika testu: Set AMPLICOR HPV vyráběný firmou Roche je určený pro detekci vysoko-rizikových typů lidských

Více

DISERTAČNÍ PRÁCE AUTOREFERÁT IDENTIFIKACE DNA ROSTLINNÝCH A ŽIVOČIŠNÝCH DRUHŮ V POTRAVINÁCH POUŽITÍM POLYMERÁZOVÉ ŘETĚZOVÉ REAKCE

DISERTAČNÍ PRÁCE AUTOREFERÁT IDENTIFIKACE DNA ROSTLINNÝCH A ŽIVOČIŠNÝCH DRUHŮ V POTRAVINÁCH POUŽITÍM POLYMERÁZOVÉ ŘETĚZOVÉ REAKCE Vysoké učení technické v Brně, Fakulta chemická, Purkyňova 464/118, 612 00 Brno DISERTAČNÍ PRÁCE AUTOREFERÁT IDENTIFIKACE DNA ROSTLINNÝCH A ŽIVOČIŠNÝCH DRUHŮ V POTRAVINÁCH POUŽITÍM POLYMERÁZOVÉ ŘETĚZOVÉ

Více

Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách

Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách Určení koncentrace proteinu fluorescenční metodou v mikrotitračních destičkách Teorie Stanovení celkových proteinů Celkové množství proteinů lze stanovit pomocí několika metod; například: Hartree-Lowryho

Více

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

B5, 2007/2008, I. Literák

B5, 2007/2008, I. Literák B5, 2007/2008, I. Literák NOBELOVY CENY V R. 2004 LÉKAŘSTVÍ A FYZIOLOGIE R. AXEL (USA) a L. BUCK (USA): funkce čichového systému u myší cca 1000 genů (u člověka něco méně) pro vznik stejného počtu čichových

Více

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11.

Personalizovaná medicína Roche v oblasti onkologie. Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. Personalizovaná medicína Roche v oblasti onkologie Olga Bálková, Roche s.r.o., Diagnostics Division Pracovní dny, Praha, 11. listopadu 2013 Personalizovaná vs standardní péče Cílená léčba Spojení diagnostiky

Více

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek

Prenatální diagnostika. KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnostika KBI/GENE Mgr. Zbyněk Houdek Prenatální diagnóza Pod tímto pojmem se skrývá diagnóza genetických chorob v průběhu těhotenství. Tyto informace mohou vést k naplánování odpovídající

Více

cobas 4800 BRAF V600 Mutation Test BRAF

cobas 4800 BRAF V600 Mutation Test BRAF cobas 4800 BRAF V600 Mutation Test PRO ÚČELY DIAGNOSTIKY IN VITRO. cobas DNA Sample Preparation Kit DNA SP 24 Tests P/N: 05985536190 cobas 4800 BRAF V600 Mutation Test BRAF 24 Tests P/N: 05985595190 POZNÁMKA:

Více

Pavlína Tinavská Laboratoř imunologie, Nemocnice České Budějovice

Pavlína Tinavská Laboratoř imunologie, Nemocnice České Budějovice Pavlína Tinavská Laboratoř imunologie, Nemocnice České Budějovice nízce agresivní lymfoproliferativní onemocnění základem je proliferace a akumulace klonálních maligně transformovaných vyzrálých B lymfocytů

Více

Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12

Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12 Aktivní B12 (Holotranskobalamin) pokrok v diagnostice deficitu vitaminu B12 Firma Abbott Laboratories nabízí na imunoanalytických systémech ARCHITECT test ke stanovení biologicky aktivní části vitaminu

Více

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty

Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty Mutace s dobrou prognózou, mutace se špatnou prognózou omezené možnosti biologické léčby pro onkologické pacienty J.Berkovcová, M.Dziechciarková, M.Staňková, A.Janošťáková, D.Dvořáková, M.Hajdúch Laboratoř

Více