EPIGENETIKA : rehabilitace kacířství? Boris Vyskot Laboratoř vývojové genetiky, Biofyzikální ústav AV ČR v Brně

Rozměr: px
Začít zobrazení ze stránky:

Download "EPIGENETIKA : rehabilitace kacířství? Boris Vyskot Laboratoř vývojové genetiky, Biofyzikální ústav AV ČR v Brně"

Transkript

1 EPIGENETIKA : rehabilitace kacířství? Boris Vyskot Laboratoř vývojové genetiky, Biofyzikální ústav AV ČR v Brně

2 Negeneticky kódovaná informace (tj. mimo sekvence nukleotidů) je přenášena mitoticky v průběhu ontogeneze a/nebo do (fenotypu( fenotypu) ) pohlavního potomstva.

3 Negeneticky kódovaná informace (tj. mimo sekvence nukleotidů) je s neurčitou pravděpodobností, tj. s neúplnou penetrancí a/nebo variabilní expresivitou přenášena mitoticky v průběhu ontogeneze a/nebo do (fenotypu( fenotypu) ) pohlavního potomstva.

4 EPIGENEZE EZE individuální vývoj organismů spočívá v postupném vzrůstu jejich komplexity Aristoteles ( př.kr Kr.) EPIGENETIKA kombinuje preformistickou genetiku (studium dědičného materiálu nacházejícího se v zygotě) a vývojovou biologii ii (studium změn, ke kterým dochází v postzygotickém období - epigeneze ze) Conrad Waddington ( )

5 EPIGENETICKÉ JEVY PŘEDSTAVUJÍ VÝJIMKY Z MENDELOVÝCH ZÁKONŮ Gregor Mendel John Maynard Smith ( ) ( ) Princip NEZÁVISLÉ SEGREGACE ALEL : dvě odlišné alely paternálního a maternálního původu v heterozygotu při meiose segregují a v nezměněné podobě se přenášejí do potomstva.... Alely se mohou podrobovat vzájemným interakcím, které mají za následek dědičnou změnu jejich exprese : PARAMUTACE Pravidlo IDENTITY RECIPROKÝCH KŘÍŽENÍ : pohlaví rodičů nemá vliv na dědičnost (expresi) genu.... Některé genomy, chromosomy či lokusy jsou v průběhu gametogeneze sex-specificky reverzibilně modifikovány, což vede k jejich umlčení ve filiální generaci : PARENTÁLNÍ IMPRINTING

6 Robin Holliday Nová teorie karcinogeneze (Brit J Cancer, 1979) Dědičnost epigenetických defektů a new definition of epigenetics (Science, 1987)

7 Andrew P. Feinberg and Bert Vogelstein (Nature, 1983) Hypometylace DNA rozlišují některé nádory člověka od normálních tkání

8 OBJEV ROKU 1984 GENOMOVÝ (PARENTÁLNÍ) IMPRINTING Davor Solter (Philadelphia) Azim Surani (Cambridge)

9 Richard B. Goldschmidt John Maynard Smith Evoluce spočívá ve zdědění změn individuálního vývoje Modely duálního systému dědičnosti the role of epigenetics in evolution

10 Dědictví Jean-Baptiste Lamarcka ( ) a jeho filosofie dědičnosti získaných znaků

11 Po selekci se dědí (přenáší) genotyp, selekce se však realizuje na bázi fenotypu (soma, fenotyp) ontogeneze, embryogeneze, vývojová biologie evoluce (genotyp, transmisní genetika, zárodečná dráha ) Weismannova bariéra (1889): somatické změny získané v průběhu života neovlivňují reprodukční buňky či potomstvo Rostliny a nižší živočichové tuto bariéru nemají!

12 Neslavní šiřitelé Lamarckových idejí Paul Kammerer ( ) Trofim D. Lysenko ( )

13 Craig Mello, Andrew Fire 2006: NOBELOVA CENA SELEKTIVNÍ UMLČOVÁNÍ GENŮ PROSTŘEDNICTVÍM dsrna INTERFERENCE červi Caenorhabditis tvořící Escherichia coli fluoreskující protein produkující dsrna

14 Prolog Genetika je podstatně složitejší než jsme si (Mendel, Watson, Crick ) mysleli. Současný pokrok v epigenetice oživuje filosofii zatracovaného Lamarcka. Bude rehabilitováno kacířství?

15 zygota časné embryo (Ne)náhodná heterochromatinisace jednoho chromosomu X u samic savců Murray Barr Mary Lyon X-vázaný gen pro pigment (1949) (1961) Barrovo tělísko

16 zygota časné embryo (Ne)náhodná heterochromatinisace jednoho chromosomu X u samic savců Murray Barr Mary Lyon X-vázaný gen pro pigment (1949) (1961) Barrovo tělísko

17 GENOMOVÝ (PARENTÁLNÍ) IMPRINTING pohlavně specifická modifikace genů v parentální generaci vede k funkčním rozdílům mezi paternálním a maternálním genomem (alelami) v potomstvu

18 Parentální imprinting je reversibilní umlčování genů ve filiální generaci způsobené modifikací chromatinu imprinting je závislý na pohlaví rodiče imprinting není závislý na pohlaví potomstva imprintový záznam je obvykle stabilní po celý život jedince maternální paternální imprintový záznam se vymaže před meiosou ou a znovunastaví dle pohlaví jedince

19 Teorie parentální álního konfliktu souboj mezi matkou a potomstvem in utero paternálně exprimované geny (Peg( Peg) podporují prenatální růst maternálně exprimované geny (Meg( Meg) jsou růstovými supresory David Haig (Harvard 1991) vítězná MATKA : vítězný OTEC : pohádka o Palečkovi pohádka o Otesánkovi

20 Chybný imprint P-alely (insulinový růstový faktor) či M-alely (růst suprimující H19-RNA) vede k Beckwith- Wiedemannově syndromu (aneb příběh Otesánka) P M normál P BWS M Igf2 H19

21 Russell-Silverův syndrom : maternální disomie chromosomu 7 - růstová retardace in utero - postnatální růstová deficience - asymetrický dwarfismus POTLAČUJE MATKA VÝVIN SVÝCH DĚTÍ? aneb příběh Palečka

22 Maternální Kaguya (Nature 428: 860, 2004): vyřazení imprintovaných genů může vést k vývinu plodné myši partenogenetického původu

23 Klonování savců vede k poruchám imprintingu Rudolf Jaenisch imprinting Severino Antinori klonování

24 Prader-Willi Parentální imprinting genového shluku (ch15) paternální delece Angelman maternální delece Martin-Bell X-chromosom vázané mentální retardace metylace CGG Rett mc-vazebný protein

25 Parentální imprinting u rostlin : maternální efekt genu MEDEA... příběh Otesánka wt Ueli Grossniklaus (Zurich 1998) wt wt-alela: kontrola (redukce) embryonální proliferace MM/- mm/-

26 Vznik a dědičnost rostlinných monster (epimutace) Carl Linnaeus Charles Darwin Enrico Coen (1744) (1868) (1999) Linnaeus pelorie u lnice, historicky první doložená mutace? Darwin křížení normálních a pelorických forem v F2 127:37 (Variation of Animals and Plants under Domestication) metylace? Coen hypermetylace homologu genu Cycloidea

27 retroelement eumelanin agouti phaeomelanin hair-cycle-specific Agouti coding exons non coding exons Agouti Viable Yellow - epigenetický mozaicismus : metylace retroelementu vede k umlčení ektopické exprese žlutá myš : tmavá myš : hypometylace hypermetylace alely Avy alely Avy ektopická umlčení agouti exprese = pseudoagouti agouti

28 Fenotypová (maternální) dědičnost Viable Yellow A vy /a x a/a výsledky reciprokých křížení s recesívním mutantem Emma Whitelaw (Sydney 1999)

29 standardní výživa A vy / a Nedostatečný CH 3 -metabolismus gravidní samičky nezajistí metylaci paternálního transposonu ektopická exprese Agouti retroelement žlutá srst

30 metylačně bohatá výživa A vy / a Maternální CH 3 metabolismus-podporující dieta zvyšuje metylaci paternálního genomu v potomstvu retroelement přirozená exprese genů hnědá srst

31 více jedinců s fenotypem pseudoagouti více žlutých myší Tyto dvě myši mají stejný genotyp (A vy /a) i fenotyp (pseudoagouti) ale odlišné potomstvo

32 Klasifikace epigenetických jevů podle (i) mediátoru přenosu informace - (m)dna, RNA, (m)histony, jiné proteiny? (ii) pravděpodobnosti jevu - obligatorní, stochastické (iii) vzdálenosti přenosu informace - mitotický bookmarking, meiotická transmise

33

34 5-azacytidin, butyrát dědičná pohlavní reverse sameček hermafrodit

35 PARAMUTACE = stabilně dědičné alelické interakce

36

37 Klasifikace epigenetických jevů podle (i) mediátoru přenosu informace - (m)dna, RNA, (m)histony, jiné proteiny? (ii) pravděpodobnosti jevu - variabilní penetrance a expresivita (iii) vzdálenosti přenosu informace - mitotický bookmarking, meiotická transmise

38 Neúplná penetrance a variabilní expresivita epi-lokusu vedou i k mozaikovému fenotypu

39 Stochastická epigenetická variabilita Příklad: divergence epigenotypu v průběhu stárnutí v somatických liniích buněk člověka

40 Klasifikace epigenetických jevů podle (i) mediátoru přenosu informace - (m)dna, RNA, (m)histony, jiné proteiny? (ii) pravděpodobnosti jevu - variabilní penetrance a expresivita (iii) vzdálenosti přenosu informace - mitotický bookmarking, meiotická transmise

41 Buněčná paměť Gene bookmarking je epigenetický proces, kterým mitoticky se dělící buňky přenášejí specifické stavy svých genových aktivit PcG -

42 Maternální programování epigenetických stavů Maternální péče jako model experience-dependent chromatin plasticity serotonin mozkový transmitter mateřská péče o novorozence (lízání a mazlení) DNA demetylázy cyklický adenosin monofosfát protein kináza A histon-acetyltransferázy mozkový transkripční faktor DOBRÁ MATEŘSKÁ PÉČE exprese genu kódujícího glukokortikoidní receptor - STABILNÍ PSYCHIKA POTOMSTVA DNA-metyltransferáza ŠPATNÁ MATEŘSKÁ PÉČE nízká exprese genu GR, STRESOVÁ PSYCHIKA DOSPĚLÉHO POTOMSTVA

43 Epigenetické intergenerační programování porodní váhy a rizika ke kardiovaskulárním chorobám původní environmentální vliv dítě nízká porodní váha permanentní programování funkcí v době těhotenství drogy, léky, choroby, výživa, chování matky, postnatální péče přenos epigenetického stavu do další generace vzrůst maternálního kortisolu, insulinu, maternálního krevního tlaku dospělec (matka) zvýšené riziko kardiovaskulárních chorob, hormonální aktivita, stres další předávání epigenetického programu (DNA metylační záznam) dospělec progresivní udržování / stabilizace syndromu choroby

44 samičky hrotnatky Daphnia si po ataku predátora vytvářejí ochrannou přílbu, tento znak pak přenášejí do potomstva

45 rostliny ohnice Raphanus raphanistrum v reakci na požer housenkou Pieris rapae syntetizují odpudivé hořčičné látky, znak přetrvává minimálně do další generace

46 Meiotický přenos epigenetického stavu (fenotypu) aneb environmentální indukce dědičných změn - genotrofy u lnu (vliv podnebí a výživy na větvení) LIN specific sequence bez hnojení F 0 bez hnojení F 1, F 2, WT hnojení bez hnojení F 1, F 2, F 0

47 Vliv environmentálních faktorů - vývojové abnormality (teratogeneze) drosofily způsobené deficiencí heat-shock proteinů

48 Tepelný šok navozuje fenokopie vzorce zbarvení křídel motýlů (Aglais urticae) Richard B. Goldschmidt ( ) středoevropská heat-shock fenokopie Sardinská varianta připomínající formu ze Sardinie varianta

49 Waddington: Diferenciace je epigenetický proces ovlivňovaný prostředím možné výsledné fenotypy (kanalizace) adaptivnía změny genové exprese mohou být za určitých podmínek v ontogenezi stabilizovány (asimilovány) evoluce je fixace ontogenetických změn

50 ChR = remodelátory chromatinu DNMT = DNA metyltransferásy HAT = histon acetyltransferásy HDAC = histon deacetylásy HMT = histon metyltransferásy HDM = histon demetylásy DDM = DNA demetylásy TF = transkripční faktory

51 Cold Spring Harbor Laboratory Press, New York, 2007

52

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

EPIGENETIKA reverzibilních změn funkce genů, Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická

EPIGENETIKA reverzibilních změn funkce genů, Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická EPIGENETIKA Epigenetika se zabývá studiem reverzibilních změn funkce genů, aniž by při tom došlo ke změnám v sekvenci jaderné DNA. Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická

Více

DĚDIČNOST MÍSENÍM (BLENDING INHERITANCE)

DĚDIČNOST MÍSENÍM (BLENDING INHERITANCE) Dědičnost DĚDIČNOST MÍSENÍM (BLENDING INHERITANCE) Pokud by dědičnost fungovala takto, tak by se všechny příznivé vlastnosti v každé následující generaci ředily, dokud by nevymizely. Darwinova evoluční

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI

Více

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny

AUG STOP AAAA S S. eukaryontní gen v genomové DNA. promotor exon 1 exon 2 exon 3 exon 4. kódující oblast. introny eukaryontní gen v genomové DNA promotor exon 1 exon 2 exon 3 exon 4 kódující oblast introny primární transkript (hnrna, pre-mrna) postranskripční úpravy (vznik maturované mrna) syntéza čepičky AUG vyštěpení

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální

Více

Molekulární procesy po fertilizacinormální či abnormální po ART?

Molekulární procesy po fertilizacinormální či abnormální po ART? Molekulární procesy po fertilizacinormální či abnormální po ART? Aleš Hampl Již více jak MILION dětí bylo na světě počato pomocí ART ART jako zdroj zvýšeného rizika:? Kongenitální malformace (Ericson and

Více

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika

Atestace z lékařské genetiky inovované otázky pro rok A) Molekulární genetika Atestace z lékařské genetiky inovované otázky pro rok 2017 A) Molekulární genetika 1. Struktura lidského genu, nomenklatura genů, databáze týkající se klinického dopadu variace v jednotlivých genech. 2.

Více

Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto

Více

Molekulární mechanismy formování epigenomu

Molekulární mechanismy formování epigenomu lncrna a epigenom Molekulární mechanismy formování epigenomu Epigenetika = věda o stabilních genetických modifikacích, které vedou ke změně exprese a funkce genů beze změny sekvence DNA Epigenetické procesy

Více

Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

7. Regulace genové exprese, diferenciace buněk a epigenetika

7. Regulace genové exprese, diferenciace buněk a epigenetika 7. Regulace genové exprese, diferenciace buněk a epigenetika Aby mohl mnohobuněčný organismus efektivně fungovat, je třeba, aby se jednotlivé buňky specializovaly na určité funkce. Nový jedinec přitom

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat

Více

Evoluce fenotypu II. http://www.natur.cuni.cz/~kratoch1/

Evoluce fenotypu II. http://www.natur.cuni.cz/~kratoch1/ Evoluce fenotypu II http://www.natur.cuni.cz/~kratoch1/ Fenotypová plasticita schopnost organismu měnit fenotyp v závislosti na vnějších podmínkách (jeden genotyp odpovídá mnoha fenotypům) - phenotypic

Více

genů - komplementarita

genů - komplementarita Polygenní dědičnost Interakce dvou nealelních genů - komplementarita Křížením dvou bělokvětých odrůd hrachoru zahradního vznikly v F1 generaci rostliny s růžovými květy. Po samoopylení rostlin F1 generace

Více

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková

Těsně před infarktem. Jak předpovědět infarkt pomocí informatických metod. Jan Kalina, Marie Tomečková Těsně před infarktem Jak předpovědět infarkt pomocí informatických metod Jan Kalina, Marie Tomečková Program, osnova sdělení 13,30 Úvod 13,35 Stručně o ateroskleróze 14,15 Měření genových expresí 14,00

Více

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010

Více

Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem

Více

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA

ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA učební texty Univerzity Karlovy v Praze ZÁKLADY BIOLOGIE a GENETIKY ČLOVĚKA Berta Otová Romana Mihalová KAROLINUM Základy biologie a genetiky člověka doc. RNDr. Berta Otová, CSc. MUDr. Romana Mihalová

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

Epigenetické regulace. (Viz také speciální přednáška P. Svobody - Epigenetika)

Epigenetické regulace. (Viz také speciální přednáška P. Svobody - Epigenetika) Epigenetické regulace (Viz také speciální přednáška P. Svobody - Epigenetika) Epigenetická dědičnost Epigenetická regulace genové exprese Definice: Heritabilní změna genové exprese beze změn DNA sekvence.

Více

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií

Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Obecná genetika Zesouladení ( sjednocení ) poznatků genetiky a evolucionistických teorií Ing. Roman Longauer, CSc. Ústav zakládání a pěstění lesů, LDF MENDELU Brno Tento projekt je spolufinancován Evropským

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

GENETIKA. zkoumá dědičnost a proměnlivost organismů

GENETIKA. zkoumá dědičnost a proměnlivost organismů GENETIKA zkoumá dědičnost a proměnlivost organismů Dědičnost: schopnost organismů uchovávat informace o své struktuře a funkčních schopnostech a předávat je svým potomkům Proměnlivost (variabilita) je

Více

GENETIKA 1. Úvod do světa dědičnosti. Historie

GENETIKA 1. Úvod do světa dědičnosti. Historie GENETIKA 1. Úvod do světa dědičnosti Historie Základní informace Genetika = věda zabývající se dědičností a proměnlivostí živých soustav sleduje variabilitu (=rozdílnost) a přenos druhových a dědičných

Více

VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita

VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita VYUŽITÍ CYTOLOGICKÝCH A MOLEKULÁRNĚ BIOLOGICKÝCH METOD PŘI DETEKCI NÁDORŮ Definice problematiky Profil přístupů Nádorová heterogenita Všechny nádory mají genetický podtext, ale některé mají tento podtext

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat

Více

Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci

Více

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce?

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce? REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince Co bylo dřív? Slepice nebo vejce? Rozmnožování Rozmnožování (reprodukce) může být nepohlavní (vegetativní, asexuální) pohlavní (sexuální;

Více

TERATOGENEZA ONTOGENEZA

TERATOGENEZA ONTOGENEZA TERATOGENEZA ONTOGENEZA Vrozené vývojové vady (VVV) Jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo 3-5 % novorozenců.

Více

Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u

Více

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316

Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Zvyšování konkurenceschopnosti studentů oboru botanika a učitelství biologie CZ.1.07/2.2.00/15.0316 Tradice šlechtění šlechtění zlepšování pěstitelsky, technologicky a spotřebitelsky významných vlastností

Více

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku)

UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) UNIVERZITA KARLOVA V PRAZE 3. LÉKAŘSKÁ FAKULTA (tématické okruhy požadavků pro přijímací zkoušku) B I O L O G I E 1. Definice a obory biologie. Obecné vlastnosti organismů. Základní klasifikace organismů.

Více

Vypracované otázky z genetiky

Vypracované otázky z genetiky Vypracované otázky z genetiky 2015/2016 Dana Hatoňová 1. Základní zákony genetiky 2. Dihybridismus 3. Aditivní model polygenní dědičnosti 4. Interakce nealelních genů 5. Genová vazba 6. Genotyp a jeho

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH

v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH RÁMCOVÝ VZDĚLÁVACÍ PROGRAM PRO ZÍSKÁNÍ SPECIALIZOVANÉ ZPŮSOBILOSTI v oboru KLINICKÁ GENETIKA PRO ODBORNÉ PRACOVNÍKY V LABORATORNÍCH METODÁCH 1. Cíl specializačního vzdělávání Cílem specializačního vzdělávání

Více

S v a z c h o v a t e l ů k o n í K i n s k ý c h

S v a z c h o v a t e l ů k o n í K i n s k ý c h ZBARVENÍ A DĚDIČNOST BARVY U KINSKÉHO KONĚ Prof. Ing. Václav Jakubec, DrSc., Česká zemědělská univerzita, Praha, Česká republika Dr. Monika Reissmann, Humboldt-Universität zu Berlin, Německo Ing. Josef

Více

Genetika - maturitní otázka z biologie (2)

Genetika - maturitní otázka z biologie (2) Genetika - maturitní otázka z biologie (2) by jx.mail@centrum.cz - Ned?le, B?ezen 01, 2015 http://biologie-chemie.cz/genetika-maturitni-otazka-z-biologie-2/ Otázka: Genetika I P?edm?t: Biologie P?idal(a):

Více

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D.

1. 21.2.2012 Klinická genetika genetické poradenství MUDr. Renata Gaillyová, Ph.D. Plán výuky jarní semestr 2011/2012 LF ošetřovatelství, porodní asistentka presenční forma Velká posluchárna, Komenského náměstí 2 Úterý 10:20-12:00 sudé týdny (první týden je sudý) 1. 21.2.2012 Klinická

Více

Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk. Aleš Hampl

Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk. Aleš Hampl Molekulární mechanismy diferenciace a programované buněčné smrti - vztah k patologickým procesům buněk Aleš Hampl Tkáně Orgány Živé buňky, které plní různé funkce (podpora struktury, přijímání živin, lokomoce,

Více

GENETIKA A JEJÍ ZÁKLADY

GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY

BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY BUNĚČNÁ TRANSFORMACE A NÁDOROVÉ BUŇKY 1 VÝZNAM BUNĚČNÉ TRANSFORMACE V MEDICÍNĚ Příklad: Buněčná transformace: postupná kumulace genetických změn Nádorové onemocnění: kolorektální karcinom 2 3 BUNĚČNÁ TRANSFORMACE

Více

Buněčné dělení ŘÍZENÍ BUNĚČNÉHO CYKLU

Buněčné dělení ŘÍZENÍ BUNĚČNÉHO CYKLU BUNĚČNÝ CYKLUS Buněčné dělení Cykliny a na cyklinech závislé proteinkinázy (Cyclin- Dependent Protein Kinases; Cdk-proteinkinázy) - proteiny, které jsou součástí řídícího systému buněčného cyklu 8 cyklinů

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že

Více

Determinace pohlaví a evoluce pohlavních chromosomů

Determinace pohlaví a evoluce pohlavních chromosomů Determinace pohlaví a evoluce pohlavních chromosomů Radka Reifová Katedra zoologie Prezentaci naleznete na: http://web.natur.cuni.cz/~radkas/ v záložce Courses Jak vznikají dvě pohlaví Mechanismy determinace

Více

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B

Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Doprovodný materiál k práci s přípravným textem Biologické olympiády 2014/2015 pro soutěžící a organizátory kategorie B Níže uvedené komentáře by měly pomoci soutěžícím z kategorie B ke snazší orientaci

Více

Výuka genetiky na PřF OU K. MALACHOVÁ

Výuka genetiky na PřF OU K. MALACHOVÁ Výuka genetiky na PřF OU K. MALACHOVÁ KATEDRA BIOLOGIE A EKOLOGIE BAKALÁŘSKÉ STUDIJNÍ PROGRAMY Experimentální Systematická Aplikovaná (prezenční, kombinovaná) Jednooborová Dvouoborová KATEDRA BIOLOGIE

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních

Více

Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie

Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie Zaměření bakalářské práce na Oddělení genetiky a molekulární biologie 1) Zadávání témat dle studovaného oboru 2) Přehled řešených témat v minulosti 3) 4) Přehled externích školících pracovišť Zaměření

Více

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii

ONKOGENETIKA. Spojuje: - lékařskou genetiku. - buněčnou biologii. - molekulární biologii. - cytogenetiku. - virologii ONKOGENETIKA Spojuje: - lékařskou genetiku - buněčnou biologii - molekulární biologii - cytogenetiku - virologii Důležitost spolupráce různých specialistů při detekci hereditárních forem nádorů - (onkologů,internistů,chirurgů,kožních

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

Maturitní témata Biologie MZ 2017

Maturitní témata Biologie MZ 2017 Maturitní témata Biologie MZ 2017 1. Buňka - stavba a funkce buněčných struktur - typy buněk - prokaryotní buňka - eukaryotní buňka - rozdíl mezi rostlinnou a živočišnou buňkou - buněčný cyklus - mitóza

Více

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou

Více

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita

GENETIKA dědičností heredita proměnlivostí variabilitu Dědičnost - heredita podobnými znaky genetickou informací Proměnlivost - variabilita GENETIKA - věda zabývající se dědičností (heredita) a proměnlivostí (variabilitu ) živých soustav - sleduje rozdílnost a přenos dědičných znaků mezi rodiči a potomky Dědičnost - heredita - schopnost organismu

Více

13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

Genetické mapování. v přírodních populacích i v laboratoři

Genetické mapování. v přírodních populacích i v laboratoři Genetické mapování v přírodních populacích i v laboratoři Funkční genetika Cílem je propojit konkrétní mutace/geny s fenotypem Vzniklý v laboratoři pomocí mutageneze či vyskytující se v přírodě. Forward

Více

TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE

TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE TEST: GENETIKA, MOLEKULÁRNÍ BIOLOGIE 1) Důležitým biogenním prvkem, obsaženým v nukleových kyselinách nebo ATP a nezbytným při tvorbě plodů je a) draslík b) dusík c) vápník d) fosfor 2) Sousedící nukleotidy

Více

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce

Více

Význam genetického vyšetření u pacientů s mentální retardací

Význam genetického vyšetření u pacientů s mentální retardací Význam genetického vyšetření u pacientů s mentální retardací Šantavá, A., Hyjánek, J., Čapková, P., Adamová, K., Vrtěl, R. Ústav lékařské genetiky a fetální medicíny FN a LF UP Olomouc Mentální retardace

Více

Populační genetika II

Populační genetika II Populační genetika II 4. Mechanismy měnící frekvence alel v populaci Genetický draft (genetické svezení se) Genetický draft = zvýšení frekvence alely díky genetické vazbě s výhodnou mutací. Selekční vymetení

Více

Biologie - Oktáva, 4. ročník (přírodovědná větev)

Biologie - Oktáva, 4. ročník (přírodovědná větev) - Oktáva, 4. ročník (přírodovědná větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that

Více

Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského

Více

9. června KONFERENCE PSYCHOSOMATICKÉ MEDICÍNY: PSYCHOSOMATIKA V KLINICKÝCH OBORECH Liberec

9. června KONFERENCE PSYCHOSOMATICKÉ MEDICÍNY: PSYCHOSOMATIKA V KLINICKÝCH OBORECH Liberec Učíme mediky, že smějí vidět, co vidí. Vladislav Chvála 9. června 2016 16. KONFERENCE PSYCHOSOMATICKÉ MEDICÍNY: PSYCHOSOMATIKA V KLINICKÝCH OBORECH Liberec Marek Vácha Ústav etiky, 3. lékařská fakulta

Více

Biologie - Oktáva, 4. ročník (humanitní větev)

Biologie - Oktáva, 4. ročník (humanitní větev) - Oktáva, 4. ročník (humanitní větev) Biologie Výchovné a vzdělávací strategie Kompetence k řešení problémů Kompetence komunikativní Kompetence sociální a personální Kompetence občanská Kompetence k podnikavosti

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

8 cyklinů (A, B, C, D, E, F, G a H) - v jednotlivých fázích buněčného cyklu jsou přítomny určité typy cyklinů

8 cyklinů (A, B, C, D, E, F, G a H) - v jednotlivých fázích buněčného cyklu jsou přítomny určité typy cyklinů Buněč ěčné dělení BUNĚČ ĚČNÝ CYKLUS ŘÍZENÍ BUNĚČ ĚČNÉHO CYKLU cykliny a na cyklinech závislé proteinkinázy (Cyclin-Dependent Protein Kinases; Cdk-proteinkinázy) - proteiny, které jsou součástí řídícího

Více

Nemendelovská dědičnost

Nemendelovská dědičnost Nemendelovská dědičnost Některá onemocnění a znaky, za které zodpovídají variace jednotlivých genů, nesledují do značné míry pravidla přenosu do dalších generací, která platí pro dědičnost "klasických"

Více

Vzdělávací obsah vyučovacího předmětu

Vzdělávací obsah vyučovacího předmětu Vzdělávací obsah vyučovacího předmětu Přírodopis 8. ročník Zpracovala: RNDr. Šárka Semorádová Biologie živočichů porovná základní vnější a vnitřní stavbu těla vybraných živočichů; určí vybrané zástupce

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

9. Evo-devo. Thomas Huxley ( )

9. Evo-devo. Thomas Huxley ( ) 9. Evo-devo Můžeme žasnout nad procesem, kterým se z vajíčka vyvine dospělý jedinec, ale bez problémů přijímáme tento proces jako každodenní fakt. Je to pouze nedostatek fantazie, který nám brání pochopit,

Více

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch

Více

Základy klinické cytogenetiky I

Základy klinické cytogenetiky I Základy klinické cytogenetiky I Mgr.Hanáková DEFINICE A HISTORIE klinická cytogenetika se zabývá analýzou chromosomů (jejich počtem a morfologií), jejich segregací v meióze a mitóze a vztahem mezi nálezy

Více

Genové terapie po 20 letech = více otázek než odpovědí

Genové terapie po 20 letech = více otázek než odpovědí Genové terapie po 20 letech = více otázek než odpovědí Jiří Heřmánek Genzyme 25.11.2008 Disclosure statement Ač vzděláním biochemik, nejsem odborník na genové terapie, tzn. považujte mne prosím za poučeného

Více