Inovace studia molekulární a buněčné biologie

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "Inovace studia molekulární a buněčné biologie"

Transkript

1 Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/ Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky.

2 I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Předmět: KBB/OGPSB Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky.

3 Determinace pohlaví I n v e s t i c e d o r o z v o j e v z d ě l á v á n í Chromozomové a genové určení pohlaví. Lyonizace. Dana Šafářová Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky.

4 Cíl přednášky: Objasnění základních principů determinace pohlaví založené na přítomnosti pohlavních chromozomů a pohlavních faktorů. Klíčová slova: Pohlavní chromozomy, pohlavní faktory, pohlavní index. Drosophila, Protenor, XY-systém; Abraxas (Lymantria); Habrobracon. Znaky na pohlaví vázané, ovládané a ovlivněné.

5 Determinace pohlaví Pohlavnost, pohlavní chromozomy. Gonochoristé, hermafroditi, gynandromorfismus, intersexy Drosophila (Protenor), Human, Abraxas, Habrobracon Vlastnosti na pohlaví vázané, pohlavím ovládané a pohlavím ovlivněné.

6 Pohlavnost (sexualita), pohlavní (sexuální) organismus - každý organismus, u kterého se v průběhu jeho života a vývinu střídá haploidní a diploidní fáze a kdy se pomocí meiotického dělení dochází k redukci diploidního (2n) počtu chromozómů somatických buněk na haploidní (n). Protiklad je klon, kdy všichni jeho potomci jsou GT identičtí Hermafrodit - jedinec, který produkuje oba typy gamet Gonochorista - jeden jedinec produkuje pouze jeden typ gamet (samčí nebo samičí)

7 Pohlavní chromozomy Zastoupení samčího a samičího pohlaví v poměru 1:1 tj. Aa x aa XY, XX

8 Determinace pohlaví - Pohlavní chromozomy X, Y; Z, W Heterochromozom : Y, W heterologní oblast homologní oblast Homogametické x heterogametické pohlaví

9 Determinace pohlaví Genetické působení nejméně jednoho specifického genu, který reguluje kaskádu událostí Přítomnost odlišných pohlavních chromozómů, účinek jednoho na nich lokalizovaného hlavního genu rozhoduje o pohlaví jedince Působení vnějšího prostředí v klíčových stádiích embryonálního vývoje

10 Determinace pohlaví - Pohlavní komplex komplex samičích (femininních) genů - F komplex samčích (maskulinních) genů - M obvykle F > M pohlaví vzniká jako důsledek interakce pohlavních komplexů Geny umístěné (lokalizované) na: nebo - pohlavních chromozómech - nepohlavních

11 Pohlavní typy Drosophila Protenor Člověk Lymantria/Abraxas (bekyně) Habrobracon/haplodiploidie (lumčík)

12 Drosophila hmyz, ryby, plazi a dvoudomé rostliny Pohlavní chromozomy: Pohlavní faktory: X, Y M, F AA XX, AA XY MM FF, MM F-

13 Drosophila hmyz, ryby, plazi a dvoudomé rostliny Pohlavní chromozomy: Pohlavní faktory: X, Y M, F AA XX, AA XY MM FF, MM F- Pohlavní index: sxl gen (F) p i X A Nadsamec Samec Intersex Samice 0,3 (<0.5) 0,5 0,67 (0,6-0,9) 1 nadsamice 1,3 (>1)

14 Protenor Protenor AAXX, AAX (rovnokřídlí, Caenorhabditis) monosomie X Geny: X0L-1 ( X0 lethal ) X-signální elementy

15 Člověk AA XX, AA XY 00 FF, 00 FM, M>F (savci, dvoudomé rostliny) sry region, TDF

16 Vyrovnání genové dávky (doze genu) Vyrovnání účinku genů lokalizovaných na různých pohlavních chromozomech (XX x XY /X0/ ) 1) Inaktivace X 2) Hyperaktivace X 3) Hypoaktivace X

17 Vyrovnání genové dávky (doze genu) Vyrovnání účinku genů lokalizovaných na různých pohlavních chromozomech (XX x XY /X0/ ) 1) Inaktivace X (savci, člověk) 2) Hyperaktivace X (Drosophila) 3) Hypoaktivace (Caenorhabditis)

18 Inaktivace X = Lyonizace Náhodná inaktivace nadbytečných pohlavních chromozomů X - Barrovo tělísko XIC (X-inaktivační centrum) ( inaktivace ke koncům chromozomů) (aktivní XIST, jeho produkty obalí chromozom) Methylace XIST (2. chromozom) -> potlačení fce XIST Chromozomy zůstávají spiralizovány i v interfázi = Pigmentace májových koček

19 Lyonizace - Želvovinové zbarvení koček

20 Hyperaktivace X = Drosophila X samečků je hyperaktivní Msl- geny -> MSL-proteiny (msl, rox proteiny, histoacetyltransferáza) MSL proteiny reagují s chromozomem X samečků, zabraňují jeho inaktivaci, dochází k acetylaci histonu H4

21 Hypoaktivace X = Caenorhabditis Částečné potlačení aktivity chromozomů X - Navázání specifických proteinů částečně blokuje transkripci.

22 Člověk - pohlaví Pohlaví genetické - konfigurace pohlavních chromozómů, určuje vznik určitého typu pohlavních žláz a produkci pohlavních hormonů Pohlaví gonádové - tvorba pohlavních žláz Pohlaví genitální - hormony produkované z pohlavních žláz, ovlivňují utváření určitých genitálií Pohlaví somatické - sekundární pohlavní znaky utvářené v pubertě Pohlaví psychosociální - sociální (společenské) ovlivnění pohlaví Poměr mezi pohlavími Primární - při oplození, cca 1,3 tj 130M : 100F Sekundární - při narození, cca 1,05 Terciální se stoupajícím věkem klesá počet M

23 Lymantria/Abraxas Ptáci, motýli, ryby, obojživelníci, plazi Pohlavní chromozomy: Pohlavní faktory: Z, W M, F AA ZW, AA ZZ 00 MF, 00 MM DMRT1 gen (Z) ASW, FET1 (W)

24 Habrobracon/haplodiploidie Blanokřídlí (vosy,včely, mravenci) F i M se vyskytují společně na X chromozómu = označují se jako: jednolokusová komplementarita (slcsd single locus complemetary sex determiner)) F > M Existuje větší množství variant cds 1, cds 2, cds 3, cds 4 samička = heterozygot pro cds (např. X cds1 X cds2, X cds3 X cds1 ) sameček = hemizygot (haploidní) nebo homozygot (X cds1, X cds2, X cds3 ; X cds1 X cds1 )

25 Habrobracon/haplodiploidie

26 Poruchy v utváření pohlaví Intersex - jedinec, který sestavou pohlavních chromozómů odpovídá určitému pohlaví, v průběhu ontogenetického vývoje však vznikají pohlavni znaky pohlaví druhého. Pohlavní zvrat (extrémní intersex) sestava heterochromozómů odpovídá jednomu typu pohlaví, souhrn vlastností jedince však odpovídá pohlaví opačnému Gynandromorfismus - vznik jedinců jejichž těla nesou znaky obou pohlaví, jedinec (jeho tělo) je tvořen mozaikou buněk či tkání jednak samčích, jednak samičích. Vzniká poruchou v dělení zygoty, nondisjunkcí

27 Dědičnost znaků související s pohlavím Znaky na pohlaví vázané Znaky pohlavím ovládané Znaky pohlavím ovlivněné

28 Znaky na pohlaví vázané Znaky úplně pohlavně vázané - gen leží na nehomologických úsecích nepárových heterochromozómů (Y, W) Znaky neúplně pohlavně vázané - geny leží na homologických úsecích nepárových heterochromozómů (Y, W)

29 Pohlavní chromozomy Zastoupení samčího a samičího pohlaví v poměru 1:1 tj. Aa x aa XY, XX T. H. Morgan (drosophila) zbarvení oka (+ - červené oko: ++ nebo +w; ww - bílé oko) P: X w X w x X + Y P: X + X + x X w Y F1: X + X w X + X w X w Y Neplatí X + Y reciprocita F2: 1 X + X w křížení 2 X + X w, X + X + 1 X + Y 1 X + Y 1 X w X w 1 X w Y 1 X w Y

30 Přímá dědičnost Geny leží na nehomologickém úseku nepárového chromozómu Y nebo W. Přímý přenos z jedince heterogametického pohlaví (samec XY nebo samice ZW) na potomstvo heterogametického pohlaví - z otce na syna (drosophila) nebo z matky na dceru (Abraxas) Člověk: (Y chromozóm) - Geny umístěné na Y chromozómu = holandrické - dědí se po mužské linii. - Geny se nacházejí v tzv. hemizygotním stavu - nejsou párové. nadměrné ochlupení boltce

31 Dědičnost křížem Znak (gen) je lokalizován na nehomologickém úseku párového heterochromozómu (X, Z) Je-li jedinec homogametního pohlaví recesivního fenotypu křížen s jedincem heterogametického pohlaví dominantního fenotypu, dochází k tzv. dědičnosti křížem. (z otce na dceru a z matky na syna) - hemofilie, daltonismus, vitaminorezistentní rachitis podobnost otec - dcera, matka syn (soubor genů, který řídí morfogenezi obličejové části hlavy může být uložen v nehomologickém segmentu chromozómu X)

32 Neúplná vazba na pohlaví Geny leží na homologních úsecích heterochromozómů - nese-li dominantní znak matka, bude jej přenášet na dcery i syny - nese-li dominantní znak otec, bude jej přenášet na syny - V případě rekombinace se chová znak jako mendelovsky podmíněný

33 Znaky pohlavím ovládané Znaky, jejichž geny jsou umístěny na autozómech, ale jejich projev je odlišný u jedinců rozdílného pohlaví. Jsou závislé na přítomnosti pohlavních hormonů a projevují se pouze u jednoho pohlaví i když geneticky jsou založeny u obou pohlaví sekundární pohlavní znaky u člověka - geneticky založeny u obou pohlaví - hormonálními vlivy dochází k jejich projevu pouze u jednoho z obou pohlaví. tvar ploutví u Beta splendens, typ opeření u ptáků, produkce mléka u krav

34 Znaky pohlavím ovlivněné Znaky, jejichž geny jsou umístěny na autozómech, ale u jednotlivých pohlaví se projevují různě. Znaky se chovají jako dominantní u jednoho pohlaví a jako recesivní u druhého pohlaví (jejich projev je ovlivněn pohlavními hormony) zbarvení srsti u skotu Dominantní alela se v heterozygotní konstituci projevuje pouze u býků. V homozygotní konstituci se projevuje i u krav. býci: MM, Mm - mahagonová barva skvrn, mm - červená barva skvrnkrávy: MM - mahagonová barva, Mm a mm - červená barva skvrn předčasná plešatost (alopecie) u člověka dominantní znak u mužů, recesivní znak u žen (muž DD i Dd, ženy pouze DD)

35 Další způsoby determinace pohlaví Vnější ovlivnění Hormonální Bonelia viridis Teplotní (aromatáza mění androgeny na estrogeny) plazi

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/

Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí. Reg. č.: CZ.1.07/2.2.00/ Propojení výuky oborů Molekulární a buněčné biologie a Ochrany a tvorby životního prostředí Reg. č.: CZ.1.07/2.2.00/28.0032 Základy genetiky - Alelové a Genové interakce (Spolu)Působení genů Fenotypový

Více

GENETIKA. Dědičnost a pohlaví

GENETIKA. Dědičnost a pohlaví GENETIKA Dědičnost a pohlaví Chromozómové určení pohlaví Dvoudomé rostliny a gonochoristé (živočichové odděleného pohlaví) mají pohlaví určeno dědičně chromozómovou výbavou jedince = dvojicí pohlavních

Více

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek

Cvičeníč. 10 Dědičnost a pohlaví. Mgr. Zbyněk Houdek Cvičeníč. 10 Dědičnost a pohlaví Mgr. Zbyněk Houdek Dědičnost a pohlaví Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů, ale i další geny. V těchto

Více

Genetika pohlaví genetická determinace pohlaví

Genetika pohlaví genetická determinace pohlaví Genetika pohlaví Genetická determinace pohlaví Způsoby rozmnožování U nižších organizmů může docházet i k ovlivnění pohlaví jedince podmínkami prostředí (např. teplotní závislost pohlavní determinace u

Více

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické

lní Gonozomáln Chromozomové určení pohlaví autozomy x gonozomy gonozomů ení Mgr. Aleš RUDA XY: : pohlaví heterogametické Gonozomáln lní dědičnost Mgr. Aleš RUDA Chromozomové určení pohlaví autozomy gonozomy člověk má 22 párůp autozomů a 1 pár p gonozomů označen ení pohlavních chromozomů: : X a Y. jsou možné celkem 3 kombinace:

Více

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek

Dědičnost a pohlaví. KBI/GENE Mgr. Zbyněk Houdek Dědičnost a pohlaví KBI/GENE Mgr. Zbyněk Houdek Dědičnost pohlavně vázaná Gonozomy se v evoluci vytvořily z autozomů, proto obsahují nejen geny řídící vznik pohlavních rozdílů i další jiné geny. V těchto

Více

Genetické určení pohlaví

Genetické určení pohlaví Přehled GMH Seminář z biologie Genetika 2 kvalitativní znaky Genetické určení pohlaví Téma se týká pohlavně se rozmnožujících organismů s odděleným pohlavím (gonochoristů), tedy dvoudomých rostlin, většiny

Více

Dědičnost pohlaví a znaků s pohlavím souvisejících

Dědičnost pohlaví a znaků s pohlavím souvisejících Dědičnost pohlaví a znaků s pohlavím souvisejících Rozmnožování Nepohlavní amixis, bez zvýšení genotypové proměnlivosti Pohlavní amfimixis střídání 2n a n fáze, zvýšení genotypové proměnlivosti Hermafrodité:

Více

MENDELOVSKÁ DĚDIČNOST

MENDELOVSKÁ DĚDIČNOST MENDELOVSKÁ DĚDIČNOST Gen Část molekuly DNA nesoucí genetickou informaci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RNA Různě dlouhá sekvence nukleotidů Jednotka funkce Genotyp

Více

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra

Základy genetiky 2a. Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základy genetiky 2a Přípravný kurz Komb.forma studia oboru Všeobecná sestra Základní genetické pojmy: GEN - úsek DNA molekuly, který svojí primární strukturou určuje primární strukturu jiné makromolekuly

Více

Genetika na úrovni mnohobuněčného organizmu

Genetika na úrovni mnohobuněčného organizmu Genetika na úrovni mnohobuněčného organizmu Přenos genetické informace při rozmnožování Nepohlavní rozmnožování: - nový jedinec vzniká ze somatické buňky nebo ze souboru somatických buněk jednoho rodičovského

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování

Dědičnost pohlaví Genetické principy základních způsobů rozmnožování Dědičnost pohlaví Vznik pohlaví (pohlavnost), tj. komplexu znaků, vlastností a funkcí, které vymezují exteriérové i funkční diference mezi příslušníky téhož druhu, je výsledkem velmi komplikované série

Více

Vytvořilo Oddělení lékařské genetiky FN Brno

Vytvořilo Oddělení lékařské genetiky FN Brno GONOSOMY GONOSOMY CHROMOSOMY X, Y Obr. 1 (Nussbaum, 2004) autosomy v chromosomovém páru homologní po celé délce chromosomů crossingover MEIÓZA Obr. 2 (Nussbaum, 2004) GONOSOMY CHROMOSOMY X, Y ODLIŠNOSTI

Více

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák

MENDELISMUS. Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák MENDELISMUS Biologie a genetika LS 3, BSP, 2014/2015, Ivan Literák 1822-1884 In the ten years G. Mendel worked on his plants in the garden of the monastery, he made the greatest discovery in biology that

Více

Determinace pohlaví a evoluce pohlavních chromosomů

Determinace pohlaví a evoluce pohlavních chromosomů Determinace pohlaví a evoluce pohlavních chromosomů Radka Reifová Katedra zoologie Prezentaci naleznete na: http://web.natur.cuni.cz/~radkas/ v záložce Courses Jak vznikají dvě pohlaví Mechanismy determinace

Více

Nauka o dědičnosti a proměnlivosti

Nauka o dědičnosti a proměnlivosti Nauka o dědičnosti a proměnlivosti Genetika Dědičnost na úrovni nukleových kyselin molekulární buněk organismů populací Předávání vloh z buňky na buňku Předávání vlastností mezi jednotlivci Dědičnost znaků

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie I n v e s t i c e d o r o z v o j e v z d ě l á v á n í reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

Deoxyribonukleová kyselina (DNA)

Deoxyribonukleová kyselina (DNA) Genetika Dědičností rozumíme schopnost rodičů předávat své vlastnosti potomkům a zachovat tak rozličnost druhů v přírodě. Dědičností a proměnlivostí jedinců se zabývá vědní obor genetika. Základní jednotkou

Více

Úvod do obecné genetiky

Úvod do obecné genetiky Úvod do obecné genetiky GENETIKA studuje zákonitosti dědičnosti a proměnlivosti živých organismů GENETIKA dědičnost - schopnost uchovávat soubor dědičných informací a předávat je nezměněný potomkům GENETIKA

Více

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek

Cvičení č. 8. KBI/GENE Mgr. Zbyněk Houdek Cvičení č. 8 KBI/GENE Mgr. Zbyněk Houdek Genové interakce Vzájemný vztah mezi geny nebo formami existence genů alelami. Jeden znak je ovládán alelami působícími na více lokusech. Nebo je to uplatnění 2

Více

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce?

REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince. Co bylo dřív? Slepice nebo vejce? REPRODUKCE A ONTOGENEZE Od spermie s vajíčkem až po zralého jedince Co bylo dřív? Slepice nebo vejce? Rozmnožování Rozmnožování (reprodukce) může být nepohlavní (vegetativní, asexuální) pohlavní (sexuální;

Více

Genetika přehled zkouškových otázek:

Genetika přehled zkouškových otázek: Genetika přehled zkouškových otázek: 1) Uveďte Mendelovy zákony (pravidla) dědičnosti, podmínky platnosti Mendelových zákonů. 2) Popište genetický zápis (mendelistický čtverec) monohybridního křížení u

Více

Počet chromosomů v buňkách. Genom

Počet chromosomů v buňkách. Genom Počet chromosomů v buňkách V každé buňce těla je stejný počet chromosomů. Výjimkou jsou buňky pohlavní, v nich je počet chromosomů poloviční. Spojením pohlavních buněk vzniká zárodečná buňka s celistvým

Více

Degenerace genetického kódu

Degenerace genetického kódu AJ: degeneracy x degeneration CJ: degenerace x degenerace Degenerace genetického kódu Genetický kód je degenerovaný, resp. redundantní, což znamená, že dva či více kodonů může kódovat jednu a tutéž aminokyselinu.

Více

Determinace pohlaví a evoluce pohlavních chromosomů

Determinace pohlaví a evoluce pohlavních chromosomů Determinace pohlaví a evoluce pohlavních chromosomů Radka Reifová Katedra zoologie Prezentaci naleznete na: http://web.natur.cuni.cz/~radkas/ v záložce Courses Jak vznikají dvě pohlaví Mechanismy determinace

Více

Stavba chromozomů Lidský karyotyp

Stavba chromozomů Lidský karyotyp Přípravný kurz z biologie 5 Stavba chromozomů Lidský karyotyp 3. 12. 2011 Mgr. Kateřina Caltová Stavba chromozomů Lidský karyotyp Chromozom buněčná struktura v jádře eukaryotních buněk řec. chroma = barva,

Více

Genetika mnohobuněčných organismů

Genetika mnohobuněčných organismů Genetika mnohobuněčných organismů Metody studia dědičnosti mnohobuněčných organismů 1. Hybridizační metoda představuje systém křížení, který umožňuje v řadě generací vznikajících pohlavní cestou zjišťovat

Více

Genetická kontrola prenatáln. lního vývoje

Genetická kontrola prenatáln. lního vývoje Genetická kontrola prenatáln lního vývoje Stádia prenatáln lního vývoje Preembryonální stádium do 6. dne po oplození zygota až blastocysta polární organizace cytoplasmatických struktur zygoty Embryonální

Více

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Obecná genetika a zákonitosti dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Obecná genetika a zákonitosti dědičnosti KBI / GENE Mgr. Zbyněk Houdek Důležité pojmy obecné genetiky Homozygotní genotyp kdy je fenotypová vlastnost genotypově podmíněna uplatněním páru funkčně zcela

Více

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním

1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním 1. Téma : Genetika shrnutí Název DUMu : VY_32_INOVACE_29_SPSOA_BIO_1_CHAM 2. Vypracovala : Hana Chamulová 3. Vytvořeno v projektu EU peníze středním školám Genetika - shrnutí TL2 1. Doplň: heterozygot,

Více

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme:

Křížení dvou jedinců, při kterém sledujeme dědičnost pouze jednoho znaku (páru alel) Generace označujeme: Otázka: Genetika II Předmět: Biologie Přidal(a): Paris Genetika mnohobuněčného organismu Dědičnost kvalitativnívh znaků: Podmíněna obvykle 1 genem = monogenní znaky Lze sledovat při křížení = pohlavním

Více

Inovace studia molekulární. a buněčné biologie

Inovace studia molekulární. a buněčné biologie Inovace studia molekulární I n v e s t i c e d o r o z v o j e v z d ě l á v á n í a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním

Více

GENETIKA A JEJÍ ZÁKLADY

GENETIKA A JEJÍ ZÁKLADY GENETIKA A JEJÍ ZÁKLADY Genetické poznatky byly v historii dlouho výsledkem jen pouhého pozorování. Zkušenosti a poznatky se přenášely z generace na generaci a byly tajeny. Nikdo nevyvíjel snahu poznatky

Více

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY

GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY GENETIKA POPULACÍ ŘEŠENÉ PŘÍKLADY 5. Speciální případy náhodného oplození PŘÍKLAD 5.1 Testováním krevních skupin systému AB0 v určité populaci 6 188 bělochů bylo zjištěno, že 2 500 osob s krevní skupinou

Více

Genetika zvířat - MENDELU

Genetika zvířat - MENDELU Genetika zvířat Gregor Mendel a jeho experimenty Gregor Johann Mendel (1822-1884) se narodil v Heinzendorfu, nynějších Hynčicích. Během období, v kterém Mendel vyvíjel svou teorii dědičnosti, byl knězem

Více

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony

Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Obecná genetika Základní pravidla dědičnosti - Mendelovy a Morganovy zákony Ing. Roman LONGAUER, CSc. Doc. RNDr. Ing. Eva PALÁTOVÁ, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je

Více

12. Mendelistická genetika

12. Mendelistická genetika 12. Mendelistická genetika Genetika se zabývá studiem dědičnosti a proměnlivosti organismů proměnlivost (variabilita) odraz vlivu prostředí na organismus potomků klasická dědičnost schopnost rodičů předat

Více

Molekulární genetika, mutace. Mendelismus

Molekulární genetika, mutace. Mendelismus Molekulární genetika, mutace 1) Napište komplementární řetězec k uvedenému řetězci DNA: 5 CGTACGGTTCGATGCACTGTACTGC 3. 2) Napište sekvenci vlákna mrna vzniklé transkripcí molekuly DNA, pokud templátem

Více

Barevné formy zebřiček a jejich genetika - část II. příklady

Barevné formy zebřiček a jejich genetika - část II. příklady Barevné formy zebřiček a jejich genetika - část II. příklady Tyto příklady se váží k předchozímu článku o obecných zákonitostech genetiky. K napsaní těchto detailů mne inspiroval jeden dotaz, který určuje

Více

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248

Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 Gymnázium a Střední odborná škola pedagogická, Čáslav, Masarykova 248 M o d e r n í b i o l o g i e reg. č.: CZ.1.07/1.1.32/02.0048 TENTO PROJEKT JE SPOLUFINANCOVÁN EVROPSKÝM SOCIÁLNÍM FONDEM A STÁTNÍM

Více

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům

-dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům Otázka: Molekulární základy dědičnosti Předmět: Biologie Přidal(a): KatkaS GENETIKA =dědičnost, proměnlivost organismu -dědičnost= schopnost rodičů předat vlastnosti v podobě vloh potomkům -umožní zachovat

Více

13. Genová vazba a genová interakce

13. Genová vazba a genová interakce 13. Genová vazba a genová interakce o Chromosomová teorie dědičnosti o Bateson a Morgan, chromosomová mapa o Typy genových interakcí Chromosomová teorie dědičnosi Roku 1903 William Sutton pozoroval meiózu

Více

Rozmnožování a vývoj živočichů

Rozmnožování a vývoj živočichů Rozmnožování a vývoj živočichů Rozmnožování živočichů Rozmnožování - jeden z charakteristických znaků organizmů. Uskutečňuje se pohlavně nebo nepohlavně. Nepohlavní rozmnožování - nevytvářejí se specializované

Více

Genotypy absolutní frekvence relativní frekvence

Genotypy absolutní frekvence relativní frekvence Genetika populací vychází z: Genetická data populace mohou být vyjádřena jako rekvence (četnosti) alel a genotypů. Každý gen má nejméně dvě alely (diploidní organizmy). Součet všech rekvencí alel v populaci

Více

Otázka: Genetika. Předmět: Biologie. Přidal(a): - GENETIKA

Otázka: Genetika. Předmět: Biologie. Přidal(a): - GENETIKA Otázka: Genetika Předmět: Biologie Přidal(a): - GENETIKA = nauka o dědičnosti a proměnlivosti organismů Dědičnost Schopnost organismů předávat určité znaky potomkům Zabezpečuje stálost druhu Způsobuje

Více

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.

Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální. Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni. Mutace, Mendelovy zákony, dědičnost autosomální a gonosomální Mgr. Hříbková Hana Biologický ústav LF MU Kamenice 5, Brno 625 00 hribkova@med.muni.cz Mutace Mutace - náhodná změna v genomu organismu - spontánní

Více

DĚDIČNOST A POHLAVÍ. Lekce 4 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc.

DĚDIČNOST A POHLAVÍ. Lekce 4 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. DĚDIČNOST A POHLAVÍ Lekce 4 kurzu GENETIKA Doc. RNDr. Jindřich Bříza, CSc. V evoluci předcházejí asexuální organismy organismům sexuálním a organismy haploidní organismům diploidním. Sexualita se může

Více

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika

VY_32_INOVACE_11.18 1/6 3.2.11.18 Genetika Genetika 1/6 3.2.11.18 Cíl chápat pojmy dědičnost, proměnlivost, gen, DNA, dominantní, recesivní, aleoly - vnímat význam vědního oboru - odvodit jeho využití, ale i zneužití Tajemství genů - dědičnost schopnost

Více

Základy genetiky populací

Základy genetiky populací Základy genetiky populací Jedním z významných odvětví genetiky je genetika populací, která se zabývá studiem dědičnosti a proměnlivosti u velkých skupin jedinců v celých populacích. Populace je v genetickém

Více

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY

II. ročník, zimní semestr 1. týden OPAKOVÁNÍ. Úvod do POPULAČNÍ GENETIKY II. ročník, zimní semestr 1. týden 6.10. - 10.10.2008 OPAKOVÁNÍ Úvod do POPULAČNÍ GENETIKY 1 Informace o výuce (vývěska) 2 - nahrazování (zcela výjimečně) - podmínky udělení zápočtu (docházka, prospěch

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky Populační genetika (KBB/PG)

Více

Předmět:: Přírodopis. anatomie a morfologie typických zástupců skupin živočichů funkce orgánů. vybraní zástupci různých skupin živočichů

Předmět:: Přírodopis. anatomie a morfologie typických zástupců skupin živočichů funkce orgánů. vybraní zástupci různých skupin živočichů 19 zhodnotí i pro 19 zhodnotí i pro funkce funkce ZÁŘÍ ŘÍJEN 19 zhodnotí i pro Obecná biologie a genetika 3 rozpozná, porovná a objasní funkci základních (orgánových soustav) rostlin i živočichů 20 určí

Více

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162

Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 Rozvoj vzdělávání žáků karvinských základních škol v oblasti cizích jazyků Registrační číslo projektu: CZ.1.07/1.1.07/02.0162 ZŠ Určeno pro Sekce Předmět Téma / kapitola Prameny 8. třída (pro 3. 9. třídy)

Více

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace

Pojmy k zapamatování. Exprese eukaryotních genů - souhrn všech dějů, které se podílejí na průběhu transkripce a translace Pojmy k zpmtování Gen -část molekuly DN nesoucí genetickou informci pro syntézu specifického proteinu (strukturní gen) nebo pro syntézu RN Gen je různě dlouhá sekvence nukleotidů Gen je jednotk funkce

Více

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek

Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací. KBI/GENE: Mgr. Zbyněk Houdek Cvičeníč. 9: Dědičnost kvantitativních znaků; Genetika populací KBI/GENE: Mgr. Zbyněk Houdek Kvantitativní znak Tyto znaky vykazují plynulou proměnlivost (variabilitu) svého fenotypového projevu. Jsou

Více

Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21

Glosář - Cestina. Odchylka počtu chromozomů v jádře buňky od normy. Např. 45 nebo 47 chromozomů místo obvyklých 46. Příkladem je trizomie 21 Glosář - Cestina alely aneuploidie asistovaná reprodukce autozomálně dominantní autozomálně recesivní BRCA chromozom chromozomová aberace cytogenetický laborant de novo Různé formy genu, které se nacházejí

Více

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA

RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA RIGORÓZNÍ OTÁZKY - BIOLOGIE ČLOVĚKA 1. Genotyp a jeho variabilita, mutace a rekombinace Specifická imunitní odpověď Prevence a časná diagnostika vrozených vad 2. Genotyp a prostředí Regulace buněčného

Více

GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D.

GENETIKA Mendelistická dědičnost. 2014 Doc. MVDr. Eva Bártová, Ph.D. GENETIKA Mendelistická dědičnost 2014 Doc. MVDr. Eva Bártová, Ph.D. Nauka o DĚDIČNOSTI (HEREDITA) a PROMĚNLIVOSTI (VARIABILITA) termín genetika poprvé použil v r. 1905 W. BATESON název genetika odvozen

Více

Vrozené vývojové vady, genetika

Vrozené vývojové vady, genetika UNIVERZITA KARLOVA V PRAZE Fakulta tělesné výchovy a sportu Vrozené vývojové vady, genetika studijní opora pro kombinovanou formu studia Aplikovaná tělesná výchova a sport Doc.MUDr. Eva Kohlíková, CSc.

Více

Předmět:: Přírodopis. Savci funkce základních orgánů. Savci - anatomie a morfologie typických zástupců skupin živočichů, funkce orgánů

Předmět:: Přírodopis. Savci funkce základních orgánů. Savci - anatomie a morfologie typických zástupců skupin živočichů, funkce orgánů Obecná biologie a genetika 3 rozpozná, porovná a objasní funkci základních orgánů (orgánových soustav) rostlin i živočichů Biologie živočichů 16 porovná základní vnější a vnitřní stavbu vybraných živočichů

Více

TERATOGENEZA ONTOGENEZA

TERATOGENEZA ONTOGENEZA TERATOGENEZA ONTOGENEZA Vrozené vývojové vady (VVV) Jsou defekty orgánů, ke kterým došlo během prenatálního vývoje plodu a jsou přítomny při narození jedince. Postihují v různém rozsahu okolo 3-5 % novorozenců.

Více

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.

Konzervační genetika INBREEDING. Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28. Konzervační genetika INBREEDING Dana Šafářová Katedra buněčné biologie a genetiky Univerzita Palackého, Olomouc OPVK (CZ.1.07/2.2.00/28.0032) Hardy-Weinbergova rovnováha Hardy-Weinbergův zákon praví, že

Více

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Registrační číslo projektu: CZ.1.07/1.5.00/34.0649 Výukový materiál zpracován v rámci projektu EU peníze školám Název školy: Střední zdravotnická škola a Obchodní akademie, Rumburk, příspěvková organizace Registrační číslo projektu: CZ.1.07/1.5.00/34.0649

Více

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje

Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Tento výukový materiál vznikl za přispění Evropské unie, státního rozpočtu ČR a Středočeského kraje Mgr. Siřínková Petra březen 2009 Mendelovy zákony JOHANN GREGOR MENDEL Narodil se 20. července 1822 v

Více

Savci. ZÁŘÍ 8h. přírodniny a jejich pozorování bezpečnost práce v laboratoři a při pozorování v terénu. Savci. ŘÍJEN 7h

Savci. ZÁŘÍ 8h. přírodniny a jejich pozorování bezpečnost práce v laboratoři a při pozorování v terénu. Savci. ŘÍJEN 7h ZÁŘÍ ŘÍJEN 7h LISTOPAD Obecná biologie a genetika 3 rozpozná, porovná a objasní funkci základních orgánů (orgánových soustav) rostlin i živočichů Biologie člověka 21 orientuje se v základních vývojových

Více

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp.

V F 2. generaci vznikají rozdílné fenotypy. Stejné zabarvení značí stejný fenotyp. Cvičení č. 6: Mendelovy zákony KI/GENE Mgr. Zyněk Houdek Mendelovy zákony Při pohlavním rozmnožování se může z každého rodiče přenést na jeho potomka vždy pouze jediná alela z páru. Vyslovil v roce 1865

Více

NUMERICKÉ ABERACE ÚBLG 1.LF UK

NUMERICKÉ ABERACE ÚBLG 1.LF UK NUMERICKÉ ABERACE ÚBLG 1.LF UK CHROMOSOMÁLN LNÍ ABERACE NUMERICKÉ ANEUPLOIDIE POLYPLOIDIE MONOSOMIE TRISOMIE TRIPLOIDIE TETRAPLOIDIE STRUKTURÁLN LNÍ MIXOPLOIDIE MOZAICISMUS CHIMÉRISMUS ZÁKLADNÍ SYNDROMY

Více

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů

Crossing-over. Synaptonemální komplex. Crossing-over a výměna genetického materiálu. Párování homologních chromosomů Vazba genů Crossing-over V průběhu profáze I meiózy Princip rekombinace genetického materiálu mezi maternálním a paternálním chromosomem Synaptonemální komplex Zlomy a nová spojení chromatinových řetězců

Více

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů

- Zákl. metodou studia organismů je křížení (hybridizace)- rozmn. dvou vybraných jedinců, umožnuje vytváření nových odrůd rostlin a živočichů Otázka: Základní zákonitosti dědičnosti Předmět: Biologie Přidal(a): Kateřina P. - Zákl. zákonitosti dědičnosti zformuloval Johann Gregor Mendel - Na základě svých pokusů křížením hrachu- popsal a vysvětlil

Více

- vytvoření speciálních buněk (gamety), vznikají meiózou (redukční dělení) v pohlavních orgánech

- vytvoření speciálních buněk (gamety), vznikají meiózou (redukční dělení) v pohlavních orgánech Otázka: Pohlavní rozmnožování Předmět: Biologie Přidal(a): Pípi - většina živočichů - vytvoření speciálních buněk (gamety), vznikají meiózou (redukční dělení) v pohlavních orgánech 1) Prvoci k obohacení

Více

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům

A. chromozómy jsou rozděleny na 2 chromatidy spojené jen v místě centromery. B. vlákna dělícího vřeténka jsou připojena k chromozómům Karlova univerzita, Lékařská fakulta Hradec Králové Obor: všeobecné lékařství - test z biologie Vyberte tu z nabídnutých odpovědí (1-5), která je nejúplnější. Otázka Odpověď 1. Mezi organely membránového

Více

Dedičnosť a pohlavie 45

Dedičnosť a pohlavie 45 Dedičnosť a pohlavie 45 5. DEDIČNOSŤ A POHLAVIE Kľúčové slová: autozómy, Barrovo teliesko, gonozómy, gynandromorfizmus, heterogametické pohlavie, heterochromozómy, holandrická dedičnosť, homogametické

Více

BIO: Genetika. Mgr. Zbyněk Houdek

BIO: Genetika. Mgr. Zbyněk Houdek BIO: Genetika Mgr. Zbyněk Houdek Nukleové kyseliny Nukleové kyseliny = DNA, RNA - nositelky dědičné informace. Přenos dědičných znaků na potomstvo. Kódují bílkoviny. Nukleotidy - základní stavební jednotky.

Více

Výukový materiál zpracován v rámci projektu EU peníze školám

Výukový materiál zpracován v rámci projektu EU peníze školám http://vtm.zive.cz/aktuality/vzorek-dna-prozradi-priblizny-vek-pachatele Autorem materiálu a všech jeho částí, není-li uvedeno jinak, je Mgr. Eva Strnadová. Dostupné z Metodického portálu www.rvp.cz ;

Více

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové

Genetika. Markéta Vojtová VOŠZ a SZŠ Hradec Králové Genetika Markéta Vojtová VOŠZ a SZŠ Hradec Králové Johann Gregor Mendel * 12.7.1822 Hynčice na Moravě + 9.1.1884 Brno Augustiniánský klášter sv. Tomáše na Starém Brně 1856 zahájil své experimenty s křížením

Více

Rozmnožování živočichů

Rozmnožování živočichů Biologie I 13. přednáška Rozmnožování živočichů Rozmnožování v živočišné říši 13/2 Rozmnožování v živočišné říši Nepohlavní (asexuální) nový jedinec shodný s genotypem 1 rodiče (klony) Pohlavní (sexuální)

Více

Semenné sady systém reprodukce a efektivita

Semenné sady systém reprodukce a efektivita Genetika a šlechtění lesních dřevin Semenné sady systém reprodukce a efektivita Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským

Více

Selekce v populaci a její důsledky

Selekce v populaci a její důsledky Genetika a šlechtění lesních dřevin Selekce v populaci a její důsledky Doc. Ing. RNDr. Eva Palátová, PhD. Ústav zakládání a pěstění lesů LDF MENDELU Brno Tento projekt je spolufinancován Evropským sociálním

Více

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny.

Geny p řevážně nepůsobí izolovan ě izolovan ale, v kontextu s okolním prostředím (vnitřním i vnějším) ě a v souladu souladu s ostatními g eny geny. Genové interakce Geny převážně nepůsobí izolovaně, ale v kontextu s okolním prostředím (vnitřním i vnějším) a v souladu s ostatními geny. Genové interakce -intraalelické -interalelické A a intraalelické

Více

VÝVOJ POHLAVNÍHO ÚSTROJÍ Určení pohlaví obecně Určení pohlaví u člověka Stadium indiferentní (gonáda, vývody, zevní pohlavní orgány) Diferenciace v po

VÝVOJ POHLAVNÍHO ÚSTROJÍ Určení pohlaví obecně Určení pohlaví u člověka Stadium indiferentní (gonáda, vývody, zevní pohlavní orgány) Diferenciace v po VÝVOJ POHLAVNÍHO ÚSTROJÍ Určení pohlaví obecně Určení pohlaví u člověka Stadium indiferentní (gonáda, vývody, zevní pohlavní orgány) Diferenciace v pohlaví mužské či ženské Určení pohlaví obecně Genetické

Více

Dědičnost na úrovni organismu

Dědičnost na úrovni organismu Dědičnost na úrovni organismu MENDELISTICKÁ GENETIKA (výběr z přednášky) CO JE MENDELISMUS? Mendelismus vysvětluje, jak se kvalitativní znaky dědí a jak se budou chovat v následujících generacích Mendelismus

Více

Moderní biologie na dosah ruky EUSOCIALITA. Kateřina Černá (katerina.cerna84@gmail.com), Přírodovědecká Fakulta Univerzity Karlovy, Katedra zoologie

Moderní biologie na dosah ruky EUSOCIALITA. Kateřina Černá (katerina.cerna84@gmail.com), Přírodovědecká Fakulta Univerzity Karlovy, Katedra zoologie EUSOCIALITA Kateřina Černá (katerina.cerna84@gmail.com), Přírodovědecká Fakulta Univerzity Karlovy, Katedra zoologie Když v lese potkáte bloudícího mravence nebo na louce zahlédnete poletující včelu medonosnou,

Více

Základy klinické cytogenetiky I

Základy klinické cytogenetiky I Základy klinické cytogenetiky I Mgr.Hanáková DEFINICE A HISTORIE klinická cytogenetika se zabývá analýzou chromosomů (jejich počtem a morfologií), jejich segregací v meióze a mitóze a vztahem mezi nálezy

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Investice do rozvoje vzdělávání Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. Investice do rozvoje vzdělávání

Více

OLYMPIÁDA MLADÝCH CHOVATELŮ 2015

OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 OLYMPIÁDA MLADÝCH CHOVATELŮ 2015 Genetika a plemenné znaky u králíků Chov králíků, II. Kategorie Johana Vinšová *13. 8. 1997 Žabonosy 113, Kolín 2, 280 02 ZO ČSCH Kolín 1 Práce započata dne: 25. 11. 2014

Více

10. oogeneze a spermiogeneze meióza, vznik spermií a vajíček ovulační a menstruační cyklus antikoncepční metody, oplození

10. oogeneze a spermiogeneze meióza, vznik spermií a vajíček ovulační a menstruační cyklus antikoncepční metody, oplození 10. oogeneze a spermiogeneze meióza, vznik spermií a vajíček ovulační a menstruační cyklus antikoncepční metody, oplození MEIÓZA meióza (redukční dělení/ meiotické dělení), je buněčné dělení, při kterém

Více

Spermatogeneze saranče stěhovavé (Locusta migratoria)

Spermatogeneze saranče stěhovavé (Locusta migratoria) Spermatogeneze saranče stěhovavé (Locusta migratoria) Vývoj pohlavních buněk u živočichů zahrnuje několik dějů, které zajistí, že dojde k redukci a promíchání genetického materiálu a vzniklé buňky jsou

Více

Inovace studia molekulární a buněčné biologie

Inovace studia molekulární a buněčné biologie Inovace studia molekulární a buněčné biologie Tento projekt je spolufinancován Evropským sociálním fondem a státním rozpočtem České republiky. MBIO1/Molekulární biologie 1 Tento projekt je spolufinancován

Více

Rozmnožovací soustava

Rozmnožovací soustava Rozmnožování = jeden ze základních znaků živých organismů - schopnost reprodukce je podmínkou udržení existence každého druhu. - člověk se rozmnožuje pouze pohlavně člověk pohlaví určeno geneticky (pohl.

Více

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě

-zakladatelem je Johan Gregor Mendel ( ), který se narodil v Hynčicích na Moravě Otázka: Genetika I Předmět: Biologie Přidal(a): Paris -věda, která se zabývá dědičností a proměnlivostí -zakladatelem je Johan Gregor Mendel (1822 1884), který se narodil v Hynčicích na Moravě 1. MOLEKULÁRNÍ

Více

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny

Základní škola a Mateřská škola G.A.Lindnera Rožďalovice. Za vše mohou geny Základní škola a Mateřská škola G.A.Lindnera Rožďalovice Za vše mohou geny Jméno a příjmení: Sandra Diblíčková Třída: 9.A Školní rok: 2009/2010 Garant / konzultant: Mgr. Kamila Sklenářová Datum 31.05.2010

Více

Hermafroditismus - pohlavni rozmnozovani, ten jedinec je schopen produkce obou typu pohlavnich bunek (gonády samčí i samičí)

Hermafroditismus - pohlavni rozmnozovani, ten jedinec je schopen produkce obou typu pohlavnich bunek (gonády samčí i samičí) Otázka: Genetika Předmět: Biologie Přidal(a): Klára Mavrov Hermafroditismus - pohlavni rozmnozovani, ten jedinec je schopen produkce obou typu pohlavnich bunek (gonády samčí i samičí) Obligatni hermafrodit

Více

Buněčné dělení ŘÍZENÍ BUNĚČNÉHO CYKLU

Buněčné dělení ŘÍZENÍ BUNĚČNÉHO CYKLU BUNĚČNÝ CYKLUS Buněčné dělení Cykliny a na cyklinech závislé proteinkinázy (Cyclin- Dependent Protein Kinases; Cdk-proteinkinázy) - proteiny, které jsou součástí řídícího systému buněčného cyklu 8 cyklinů

Více

Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek

Chromozomová teorie dědičnosti. KBI / GENE Mgr. Zbyněk Houdek Chromozomová teorie dědičnosti KBI / GENE Mgr. Zbyněk Houdek Proč octomilka a T.H. Morgan? Drosophila melanogaster ideální objekt pro genetický výzkum : Rychlý reprodukční cyklus a snadný chov v laboratorních

Více

Sylabus kurzu: Biologie

Sylabus kurzu: Biologie Sylabus kurzu: Biologie Výchozí úroveň studentů: Vědomosti z biologie na gymnaziální úrovni Cílová úroveň studentů: Cílem je zopakovat a prohloubit vědomosti v oblasti biologie nabyté na gymnáziu, případně

Více

EPIGENETIKA reverzibilních změn funkce genů, Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická

EPIGENETIKA reverzibilních změn funkce genů, Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická EPIGENETIKA Epigenetika se zabývá studiem reverzibilních změn funkce genů, aniž by při tom došlo ke změnám v sekvenci jaderné DNA. Epigenetické faktory ovlivňují fenotyp bez změny genotypu. Epigenetická

Více

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů

9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů 9.12.2012 Brno - Lužánky Základy chovatelství a genetiky potkanů Obrázky použité v prezentaci byly postahovány z různých zdrojů na internetu z důvodů ilustračních a nejedná se o má díla. Prezentace nejsou

Více

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512

Výukový materiál zpracován v rámci operačního projektu. EU peníze školám. Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Výukový materiál zpracován v rámci operačního projektu EU peníze školám Registrační číslo projektu: CZ.1.07/1.5.00/34.0512 Střední škola ekonomiky, obchodu a služeb SČMSD Benešov, s.r.o. ZDRAVOVĚDA Genetika

Více

Dědičnost vázaná na X chromosom

Dědičnost vázaná na X chromosom 12 Dědičnost vázaná na X chromosom EuroGentest - Volně přístupné webové stránky s informacemi o genetickém vyšetření (v angličtině). www.eurogentest.org Orphanet - Volně přístupné webové stránky s informacemi

Více