KVANTIFIKACE ZMĚN GENOVÉ EXPRESE

Save this PDF as:
 WORD  PNG  TXT  JPG

Rozměr: px
Začít zobrazení ze stránky:

Download "KVANTIFIKACE ZMĚN GENOVÉ EXPRESE"

Transkript

1 KVANTIFIKACE ZMĚN GENOVÉ EXPRESE Northern bloty pracné a zdlouhavé Genové čipy nákladné; Semikvantitativní RT-PCR qpcr nepřesné metodiky real-time PCR vysoké dynamické rozpětí 1

2 problém: precizní kvantifikace mrna spektrofotometrické stanovení koncentrace RNA nemusí být dostatečné řešení: stanovení koncentrace RNA pomocí fluorescenčního barviva RIBOgreen x citlivější, nereaguje s nukleotidy a krátkými fragmenty. nebo relativní stanovení pomocí qpcr control expt NORTHERN BLOT cílový gen GOI referenční gen aktin, GAPDHetc korigovaný nárůst exprese = 10/2 = 5 2

3 aplikace REAL-TIME PCR 1) absolutní kvantifikace množství DNA ve vzorku k externímu standardu, detekce virální či bakteriální DNA, forenzní chemie 2) koncová detekce SNP genotypizace, detekce mutací a polymorfismů 3) relativní kvantifikace srovnání úrovně exprese mrna nebo mikrorna mezi různými tkáněmi či biologickými podmínkami 3

4 princip měření vznikající fluorescence po každém cyklu PCR, stanovení křivek tání chemismus 1) interkalační barviva SYBRgreen interkalace barviva na dvoušroubovici vznikající (amplifikované) DNA precizní výběr primerů nesmí vytvářet dimery nutná kontrola amplifikovaného produktu na křivku denaturačních teplot 4

5 chemismus 2) hybridizační sondy (TAGman) uvolňování fluorescence po degradaci sondy nutná 5-3 exonukleasová aktivita Taq polymerasy fluorescenční značka: VIC, FAM (fluorescein) zhášeč: Tamra (Tetramethyl-6-Carboxyrhodamine ) FRET = Förster/fluorescence resonance energy transfer srovnání TagMan SybrGreen specifita primery proba PCR podmínky primery PCR podmínky flexibilita singleplex multiplex (max.4) singleplex aplikace kvantifikace SNP detekce kvantifikace cena vysoká nízká 5

6 kontaminace největší problém PCR aerosol, pipety, staré amplikony částečné řešení URACIL N-GLYKOSYLASA štěpí ss a dsdna s inkorporovaným deoxyuracilem (dutp) termolabilní, 0% aktivita nad 55 C nereaguje s templátem (dttp) dutp v qpcr mixu místo dttp pracuje během nastavení PCR reakce pg2 chyby v pipetování templát (cdna) premix (primery, y,p proba,,polymerasa, dntp,,p pufr, srovnávací fluorescenční barvivo) částečné řešení - ROX (Karboxy-X-Rhodamin) fluorescence se nemění během PCR cyklů a vzrůstající fluorescence v každé zkumavce vzorku je extrapolována na srovnávací DVOJÍ PIPETOVÁNÍ REAKČNÍ SMĚSI pracujeme s premixy 1) pufr, Mg 2+,dNTP, ROX, SybrGreen, TaqPol, primery 2) vzorek (cdna, genomická DNA) 6

7 Snímek 12 pg2 hořčík vyšší davky pro Tagman kvuli 5-3- exonucleasove aktivite galuszka; 22/02/2010

8 CYCLE NUMBER AMOUNT OF DNA , , , , , , , , , , ,048, ,097, ,194, ,388, ,777, ,554, ,108, ,217, ,435, ,870, ,073,741, ,400,000, ,500,000, ,550,000, ,580,000,000 AMOUNT OF DNA A A AMOUNT OF DNA lineární vynesení PCR CYCLE NUMBER logaritmické vynesení PCR CYCLE NUMBER lineární ~20 do ~1500 7

9 C T hodnoty threshold treshold je třeba nastavit tak aby u každého vzorku procházel lineární části křivky C T počet cyklů při kterém fluorescence vzorku překročí threshold (prahovou hodnotu) před každou kvantifikací je třeba vždy udělat standardní křivku threshold templát: 10x ředění buď přímo cdna, nebo plasmid s naklonovaným genem, který stanovujeme C T koncentrace templátu 8

10 PARAMETRY STANDARDNÍ KŘIVKY směrnice: ideální -3,32 = 100% efektivita reakce %EFF kolik kopii templátu je zkopírováno v každém cyklu R 2 korelační koeficient (tolerovat se dá ještě 0,995) Eff=10 (-1/slope) 1 CYCLE AMOUNT OF DNA AMOUNT OF DNA AMOUNT OF DNA AMOUNT OF DNA 100% EFFICIENCY 90% EFFICIENCY 80% EFFICIENCY 70% EFFICIENCY , ,048 1, ,096 2,213 1, ,192 4,205 2, ,384 7,990 3,748 1, ,768 15,181 6,747 2, ,536 28,844 12,144 4, ,072 54,804 21,859 8, , ,127 39,346 14, , ,842 70,824 23, ,048, , ,482 40, ,097, , ,468 69, ,194,304 1,356, , , ,388,608 2,578, , , ,777, ,898, ,338, , ,554,432 9,307,650 2,408, , ,108,864 17,684,534 4,335, , ,217,728 33,600,615 7,804,726 1,667, ,435,456 63,841,168 14,048,506 2,835, ,870, ,298,220 25,287,311 4,819, ,073,741, ,466,618 45,517,160 8,193,466 MOUNT OF DNA AM %EFF 100% = 2.00x 90% = 1.90x 80% = 1.80x 70% = 1.70x 10,000,000,000 1,000,000, ,000,000 10,000,000 1,000, ,000 10,000 1, % EFF 90% EFF 80% EFF 70% EFF PCR CYCLE NUMBER relativní kvantifikace je možná pouze pokud sledovaný gen a referenční gen má srovnatelnou a vysokou efektivitu > 90% ± 3% 9

11 tolerance efektivity Chemismus SybrGreen Nutná kontrola výsledných amplikonů na teplotní křivky tání teplota 10

12 REFERENČNÍ GEN musí mít stabilní expresi ve všech studovaných vzorcích nejčastěji provozní geny (house-keeping) aktin, GAPDH, cyklofilin, 18S RNA, EF1 TaqMan Human Endogenous Control Plate ΔC T 11

13 ΔC T = 2 čtyřnásobný rozdíl v expresi změna v jednom cyklu při 100% efektivitě je rovna dvounásobné změně ve výchozí koncentraci cdna 18S ribosomální RNA přepisována jinou RNA polymerasou než mrna byly popsány výkyvy mezi množstvím rrna a mrna nelze použít pokud se vychází z mrna vyhodnocení kalibrátor sample 1 sample 2 izolace celkové RNA (mrna) přepis do cdna navržení primerů a sond pro referenční gen a studovaný (GOI) určení č standardních d křivek k pro oba geny a stanovení efektivity it GAPDH GOI GAPDH GOI GAPDH GOI 12

14 vyhodnocení kalibrátor sample A kalibrátor sample B sample A sample B GAPDH GOI 1 vyhodnocení změny exprese pro sample 1 metoda delta delta cé té 1. určíme C T pro všechny křivky 2. určíme C T GOI -C TGAPDH pro kalibrátor ΔC T kalibrátor 3. určíme C T GOI -C TGAPDH pro sample 1 ΔC T sample 1 4. ΔC Tsample 1 - ΔC Tkalibrátor ΔΔC T výsledek (kolikrát je gen více či méně exprimován) 2 -ΔΔCT 13

15 2 vyhodnocení počítá se i s efektivitou Sample A - kalibrátor Sample B - vzorek 3 vyhodnocení pomocí standardů o známe koncentraci se spočítají počty kopií ve vzorcích 14

16 příklad linie živočišných buněk byla podstoupena umlčení (silencing) genu pkg2 s linie transfekované a netransfekované (kalibrátor) byla izolována RNA, přepsana do cdna a provedeno qpcr s primery a probou na gen pkg2 a GAPDH (referenční gen). Snížila se exprese genu pkg2 po umlčení? pkg2 Eff 86% cdna kalibrator C T 22,48 cdna silencing C T 22,3 GAPDH Eff 77% cdna kalibrator C T 20,05 cdna silencing C T 16,97 -ΔΔCT pkg2 cdna 2 kalibrator 2 (5,33-2,43) (1+0,86) 0,18 /(1+0,77) 3,08 1,1x10 4 kopií DNA 123 1,23x kopií cdna silencing GAPDH cdna kalibrator cdna silencing 0,134 0,192 0,194 Gen snížil expresi 7,5x 5,2x 5,2x 1,55x10 4 kopií 8,92x10 4 kopií pg1 navrhování primerů velikost amplikonu bp délka primerů ů 20 bp primery se nesmí překrývat s próbou Tm C optimální teplota pro degradaci proby exonukleasovou aktivitou GC obsah 50-70% žádné vlásenky žádné dimery (self-dimery, cross-dimery) 15

17 Snímek 30 pg1 > An ideal primer has a stable 5'end and an unstable 3' end. If the > primer has a stable 3' end, it will bond to a site which is > complementary to it other than the target with its 5' end hanging off > the edge...[nice terminology BTW]...Stability of the 5' termini allows for efficient bonding of the > primer to the target site. This stable 5' region is called the GC > Clamp. It ensures adequate binding of the primer to the template... > Notice that the 3' end should not be very stable and the 5' end should > have a strong GC clamp. galuszka; 22/02/2010

18 délka proby navrhování proby bp primery se nesmí překrývat s próbou Tm C o 10 C vyšší než Tm primerů GC obsah 50-70% žádné G na 5 konci zháší fluorescenci FAM barvy 16

19 navrhování primerů a proby kontaminace genomickou DNA 1) ošetření vzorků před RT DNasou 2) navržení primerů do dvou exonů mezi nimiž je dlouhý intron 3) navržení primeru nebo proby na přechod intron/exon 17

20 minor groove binding MGB PROBY stabilizuje vazbu proby na ssdna výrazně zvyšuje Tm můžeme navrhovat krátké proby při zachování vysoké Tm 18

21 MGB PROBY využití pro alelické diskriminace kolik replikací a kdy replikovat? sample extrakce RNA přepis do cdna qpcr 3X 6X 19

22 kolik replikací a kdy replikovat? ideální 3x sample extrakce RNA přepis do cdna qpcr 27X instrumentace 7500 Real Time PCR System 7900HT Real Time PCR System StepONE Real Time PCR System 20

23 halogenová lampa emisní filtry zesilovač ccd kamera excitační filtry zkumavky se vzorky v peltierovém bloku instrumentace 21

24 HRM ANALYSA (HIGH RESOLUTION MELT) detekce SNP bez specifických sond díky kvalitní instrumentaci Corbett (±0.02 C) 02 C) a nové generaci interkalačních barviv (LCGreenPlus) 22

25 HRM ANALYSA pro amplikony do 200bp 23

PRINCIPY A VYUŽITÍ qpcr (kvantifikace změn genové exprese)

PRINCIPY A VYUŽITÍ qpcr (kvantifikace změn genové exprese) PRINCIPY A VYUŽITÍ qpcr (kvantifikace změn genové exprese) Northern bloty Genové čipy pracné a zdlouhavé nákladné Semikvantitativní RT-PCR nepřesné qpcr vysoké dynamické rozpětí metodiky real-time PCR

Více

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Komponenty nukleových kyselin Nukleotid DNA deoxyguanosid monofosfát (dgmp) Koncept párování bazí je striktně konzervativní Cytosine

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KOLOREKTÁLNÍHO KARCINOMU Jednou z nejvhodnějších metod pro detekci minimální

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIDUÁLNÍ CHOROBY U KARCINOMU PANKREATU Jednou z nejvhodnějších metod pro detekci minimální reziduální

Více

Principy a využit. ití qpcr. KBC/BAM Pokročil. rní biologie

Principy a využit. ití qpcr. KBC/BAM Pokročil. rní biologie Principy a využit ití qpcr KBC/BAM Pokročil ilé biochemické a biotechnologické metody Mgr. Mária M Šmehilová, Ph.D. UP PŘF CRH Oddělen lení molekulárn rní biologie Úvod do PCR PCR - 1984 Kary Mullis (Nobelova

Více

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR

DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Úvod IntellMed, s.r.o., Václavské náměstí 820/41, 110 00 Praha 1 DIAGNOSTICKÝ KIT PRO DETEKCI MINIMÁLNÍ REZIUDÁLNÍ CHOROBY MRD EGFR Jednou z nejvhodnějších metod pro detekci minimální reziduální choroby

Více

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky.

Polymerázová řetězová reakce. Základní technika molekulární diagnostiky. Polymerázová řetězová reakce Základní technika molekulární diagnostiky. Kdo za to může? Kary Mullis 1983 Nobelova cena 1993 Princip PCR Polymerázová řetězová reakce (polymerase chain reaction PCR) umožňuje

Více

Metody studia genové exprese

Metody studia genové exprese Metody studia genové exprese Ing. Lucie Němcová, Ph.D. Laboratoř vývojové biologie nemcova@iapg.cas.cz Transkriptom Genová exprese: Geny jsou exprimovány tehdy, jsou-li přepsány do RNA (mrna). Rozdílná

Více

KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR)

KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) KVANTITATIVNÍ REAL-TIME PCR (q-real-time PCR) Metoda Real-time PCR slouží pro kvantifikaci DNA a transkripce. Metoda je založena na klasické PCR, ovšem s využitím speciálního cycleru, který v průběhu PCR

Více

Metody studia exprese mrna. jádro a genová exprese 2007

Metody studia exprese mrna. jádro a genová exprese 2007 Metody studia exprese mrna Buněčné jádro a genová exprese 2007 Aktivita genu je primárn ě vyjád ř ena jeho transkripcí-prvním krokem vedoucím k syntéze kódovaného proteinu. Cíle metod Ur č ení mno ž ství

Více

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová

DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH. Michaela Nesvadbová DNA TECHNIKY IDENTIFIKACE ŽIVOČIŠNÝCH DRUHŮ V KRMIVU A POTRAVINÁCH Michaela Nesvadbová Význam identifikace živočišných druhů v krmivu a potravinách povinností každého výrobce je řádně a pravdivě označit

Více

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR)

MOLEKULÁRNÍ BIOLOGIE. 2. Polymerázová řetězová reakce (PCR) MOLEKULÁRNÍ BIOLOGIE 2. Polymerázová řetězová reakce (PCR) Náplň praktik 1. Izolace DNA z buněk bukální sliznice - izolační kit MACHEREY-NAGEL 2. PCR polymerázová řetězová reakce (templát gdna) 3. Restrikční

Více

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.:

Yi TPMT. Diagnostická souprava. Návod k použití. Haasova 27 Brno Česká republika. tel.: Yi TPMT Diagnostická souprava Návod k použití Výrobce: YBUX s.r.o. Haasova 27 Brno 616 00 Česká republika IČ 63487951 tel.: +420 541 423 710 e-mail: ybux@ybux.eu Název: Yi TPMT Popis: Diagnostická souprava

Více

NÁVOD K POUŽITÍ PRO HER2 DNA QUANTIFICATION KIT

NÁVOD K POUŽITÍ PRO HER2 DNA QUANTIFICATION KIT IČ: 80 DIČ: CZ80 sales@intellmed.eu NÁVOD K POUŽITÍ PRO HER DNA QUANTIFICATION KIT IČ: 80 DIČ: CZ80 sales@intellmed.eu OBSAH Návod k použití pro HER DNA QUANTIFICATION KIT.... Úvod.... Označení.... Rozsah

Více

Stanovení Ct hodnoty. Stanovení míry variability na úrovni izolace RNA, reverzní transkripce a real-time PCR

Stanovení Ct hodnoty. Stanovení míry variability na úrovni izolace RNA, reverzní transkripce a real-time PCR Stanovení Ct hodnoty Ct hodnotu (číselný výstup real-time PCR) stanovíme z amplifikačního grafu (grafický výstup real-time PCR) proložením thresholdu skrze lineární část amplifikační křivky. V bodě protnutí

Více

nastavení real-time PCR cykleru Rotor Gene 3000

nastavení real-time PCR cykleru Rotor Gene 3000 Verze: 1.4 Datum poslední revize: 25. 3. 2015 nastavení real-time PCR cykleru Rotor Gene 3000 (Corbett Research) generi biotech OBSAH: 1. Nastavení teplotního profilu a spuštění cykleru... 3 2. Zadání

Více

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR)

POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) POLYMERÁZOVÁ ŘETĚZOVÁ REAKCE (PCR) Polymerázová řetězová reakce (PCR, z anglického Polymerase Chain Reaction) je metoda rychlého zmnožení (amplifikace) vybraného úseku DNA. Množený (amplifikovaný) úsek

Více

Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI

Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI Fragment Analyzer UNIKÁTNÍ KAPILÁROVÝ FRAGMENTAČNÍ ANALYZÁTOR VÝBORNÉ VÝSLEDKY UNIKÁTNÍ VLASTNOSTI Výborný přístroj, výborné výsledky Fragmentační analyzátor je automatizovaný kapilárový systém s CE značkou

Více

Hybridizace nukleových kyselin

Hybridizace nukleových kyselin Hybridizace nukleových kyselin Tvorba dvouřetězcových hybridů za dvou jednořetězcových a komplementárních molekul Založena na schopnosti denaturace a renaturace DNA. Denaturace DNA oddělení komplementárních

Více

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha

MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII. Martina Nováková, VŠCHT Praha MOLEKULÁRNĚ BIOLOGICKÉ METODY V ENVIRONMENTÁLNÍ MIKROBIOLOGII Martina Nováková, VŠCHT Praha MOLEKULÁRNÍ BIOLOGIE V BIOREMEDIACÍCH enumerace FISH průtoková cytometrie klonování produktů PCR sekvenování

Více

Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie

Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Kvantitativní detekce houbových patogenů v rostlinných pletivech s využitím metod molekulární biologie Leona Leišová Přírodovědecká fakulta UK, Praha 2009 Metody kvantifikace: Nepřímé metody odhad míry

Více

Verze: 1.2 Datum poslední revize: 24.9.2014. Nastavení real-time PCR cykleru. Light Cycler 480 Instrument. (Roche) generi biotech

Verze: 1.2 Datum poslední revize: 24.9.2014. Nastavení real-time PCR cykleru. Light Cycler 480 Instrument. (Roche) generi biotech Verze: 1.2 Datum poslední revize: 24.9.2014 Nastavení real-time PCR cykleru Light Cycler 480 Instrument (Roche) generi biotech OBSAH 1. Nastavení teplotního profilu...3 1.1. Nastavení nového teplotního

Více

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/

Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci. reg. č.: CZ.1.07/2.2.00/ Implementace laboratorní medicíny do systému vzdělávání na Univerzitě Palackého v Olomouci reg. č.: CZ.1.07/2.2.00/28.0088 Hybridizační metody v diagnostice Mgr. Gabriela Kořínková, Ph.D. Laboratoř molekulární

Více

Molekulární genetika

Molekulární genetika Molekulární genetika Genetické inženýrství Technologie rekombinantní DNA Vektor Genomová DNA Štěpení RE Rozštěpení stejnou RE, lepivé konce Ligace Transformace Bakteriální chromozóm Rekombinantní vektor

Více

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek

Modifikace PCR, sekvenování. Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Modifikace PCR, sekvenování Molekulární biologie v hygieně potravin 5, 2013/14, Ivo Papoušek Multiplex PCR Reakční směs obsahuje ne jeden, ale několik párů primerů rozpoznávajících různé cílové sekvence

Více

Písemná zpráva zadavatele

Písemná zpráva zadavatele Písemná zpráva zadavatele veřejné zakázky zadávané dle zákona č. 137/2006 Sb., o veřejných zakázkách, ve znění účinném ke dni zahájení zadávacího řízení (dále jen ZVZ ). Veřejná zakázka Název: Ostatní

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/ Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) Analýza transkriptomu Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s moderními metodami komplexní

Více

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI

GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI GENOTOXICITA A ZMĚNY V GENOVÉ EXPRESI INDUKOVANÉ PŮSOBENÍM ORGANICKÝCH LÁTEK Z PRACHOVÝCH ČÁSTIC V OVZDUŠÍ Kateřina Hanzalová Oddělení genetické ekotoxikologie Ústav experimentální medicíny AV ČR v.v.i.

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti NUKLEOVÉ KYSELINY 3 složky Nukleotidy dusík obsahující báze (purin či pyrimidin) pentosa fosfát Fosfodiesterová vazba. Vyskytuje se mezi

Více

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek

Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Molekulární biologie v hygieně potravin 4, 2013/14, Ivo Papoušek Polymerázová řetězová reakce (PCR) Zavedení PCR v roce 1983 (Kary B. Mullis) Nobelova cena 1993 Metodika

Více

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14

OBSAH. PP Master Mixy... 11 PPP Master Mix 12 Plain PP Master Mix 13 Combi PPP Master Mix 14 OBSAH DNA polymerázy pro PCR a pufry.................. 3 Taq DNA polymeráza 4 Taq DNA polymeráza Unis 5 TaqPurple DNA polymeráza 6 Taq DNA polymeráza 1.1 7 Combi Taq DNA polymeráza 8 LA DNA Polymerases

Více

Enzymy používané v molekulární biologii

Enzymy používané v molekulární biologii Enzymy používané v molekulární biologii Rozdělení enzymů 1. Podle substrátové specifity: většina metod molekulární biologie je závislá na použití enzymů, jejichž substrátem jsou nukleové kyseliny. Tyto

Více

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce

TECHNIKY PCR. PCR - polymerase chain reaction -polymerázová řetězová reakce TECHNIKY PCR PCR - polymerase chain reaction -polymerázová řetězová reakce Přehled Molekulárně-biologický úvod, DNA struktura, replikace, DNA polymerasa Princip procesu PCR Optimalizace PCR Typy PCR Aplikace

Více

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i.

Výzkumné centrum genomiky a proteomiky. Ústav experimentální medicíny AV ČR, v.v.i. Výzkumné centrum genomiky a proteomiky Ústav experimentální medicíny AV ČR, v.v.i. Systém pro sekvenování Systém pro čipovou analýzu Systém pro proteinovou analýzu Automatický sběrač buněk Systém pro sekvenování

Více

FNUSA - ICRC Termocyklery pro PCR

FNUSA - ICRC Termocyklery pro PCR Název projektu OP VaVpI: FN u sv. Anny v Brně Mezinárodní centrum klinického výzkumu (FNUSA-ICRC) Číslo projektu: CZ.1.05/1.1.00/02.0123 ZADÁVACÍ DOKUMENTACE pro zadávací řízení podle zákona č. 137/2006

Více

DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod.

DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. DYNEX nabízí komplexní řešení v oblasti zpracování a analýzy biologických materiálů pomocí molekulárně biologických metod. Od 1.1.2014 DYNEX jediným OFICIÁLNÍM (autorizovaným) distributorem společnosti

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. VI. Aplikace qrt-pcr ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR VI. Aplikace qrt-pcr 1. Detekce DNA - Diagnóza infekčních onemocnění (přítomnost patogenů v krvi, séru, plazmě ) - Sledování minimální reziduální nemoci - Detekce patogenů

Více

DY D NE N X Hana Vlastníková

DY D NE N X Hana Vlastníková DYNEX Hana Vlastníková Molekulární biologie: Vybavení laboratoře na klíč Přístrojová technika Kompatibilní diagnostické soupravy Profesionální přístup SOP Technická podpora Servis Přístrojové vybavení:

Více

Sure-MeDIP I. with magnetic beads and MNase. www.krd.cz

Sure-MeDIP I. with magnetic beads and MNase. www.krd.cz Sure-MeDIP I with magnetic beads and MNase www.krd.cz 1 Obsah soupravy a skladování MeDIP souprava obsahuje reagencie na provedení 25 reakcí. Souprava je rozdělen do dvou částí, jedna je distribuována

Více

Příručka pro sadu ipsogen BCR- ABL1 Mbcr

Příručka pro sadu ipsogen BCR- ABL1 Mbcr Leden 2013 Příručka pro sadu ipsogen BCR- ABL1 Mbcr 24 Verze 1 In vitro diagnostikum pro kvantitativní stanovení Pro použití s přístroji Rotor-Gene Q, ABI PRISM, LightCycler a SmartCycler 670123 QIAGEN

Více

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN

ZDRAVOTNÍ NEZÁVADNOST POTRAVIN ZDRAVOTNÍ NEZÁVADNOST POTRAVIN Možnosti stanovení Listeria monocytogenes popis metod a jejich princip Mária Strážiková Aleš Holfeld Obsah Charakteristika Listeria monocytogenes Listerióza Metody detekce

Více

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354

Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Inovace studia molekulární a buněčné biologie reg. č. CZ.1.07/2.2.00/07.0354 Genomika (KBB/GENOM) SNPs Odvozování a genotyping Ing. Hana Šimková, CSc. Cíl přednášky - seznámení s problematikou hledání

Více

Univerzita Palackého v Olomouci. Bakalářská práce

Univerzita Palackého v Olomouci. Bakalářská práce Univerzita Palackého v Olomouci Bakalářská práce Olomouc 2012 Eliška Růžičková Univerzita Palackého v Olomouci Přírodovědecká fakulta Katedra buněčné biologie a genetiky Real-time PCR a jeho využití pro

Více

Filozofie validace. Je validace potřebná? Mezinárodní doporučení pro provádění validací ve forenzně genetických laboratořích

Filozofie validace. Je validace potřebná? Mezinárodní doporučení pro provádění validací ve forenzně genetických laboratořích INVESTICE DO ROZVOJE VZDĚLÁVÁNÍ Vzdělávání v oblasti forenzní genetiky reg. č. CZ.1.07/2.3.00/09.0080 Mezinárodní doporučení pro provádění validací ve forenzně genetických laboratořích INVESTICE DO ROZVOJE

Více

Environmentální aplikace molekulární biologie

Environmentální aplikace molekulární biologie Environmentální aplikace molekulární biologie Petra Jančová, Kristýna Maršálková, Jana Šerá, Hana Pištěková Ústav Inženýrství Ochrany Životního Prostředí, Fakulta Technologická, Univerzita Tomáše Bati

Více

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení

Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Diagnostika infekce Chlamydia trachomatis pomocí molekulárně genetické metody real time PCR nejen u pacientek z gynekologických zařízení Mgr. Klára Vilimovská Dědečková, Ph.D. Synlab genetics s.r.o. Molekulární

Více

Pokročilé biofyzikální metody v experimentální biologii

Pokročilé biofyzikální metody v experimentální biologii Pokročilé biofyzikální metody v experimentální biologii Ctirad Hofr 1/1 Proč biofyzikální metody? Biofyzikální metody využívají fyzikální principy ke studiu biologických systémů Poskytují kvantitativní

Více

Analýza DNA. Co zjišťujeme u DNA

Analýza DNA. Co zjišťujeme u DNA Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů, záměny), chromosomové aberace (numerické, strukturní) Polymorfismy konkrétní

Více

J09 Průkaz nukleové kyseliny

J09 Průkaz nukleové kyseliny J09 Průkaz nukleové kyseliny VLLM0421c (jaro 2016) Osnova využití a metody průkazu NK PCR a její modifikace proces prokazování specifické sekvence NK 2/55 Přímé vs. nepřímé metody přímé hledáme mikroba,

Více

Příručka sady ipsogen BCR-ABL1 Mbcr IS-MMR DX

Příručka sady ipsogen BCR-ABL1 Mbcr IS-MMR DX Leden 2013 Příručka sady ipsogen BCR-ABL1 Mbcr IS-MMR DX Verze 1 24 In vitro diagnostikum pro kvantitativní stanovení Pro použití s přístroji Rotor-Gene Q, Applied Biosystems, ABI PRISM, and LightCycler

Více

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2

cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 cdna synthesis kit First-Strand cdna Synthesis System Verze 1.2 Obsah soupravy a její skladování Tato souprava pro reverzní transkripci obsahuje reagencie potřebné k provedení reverzní transkripce (RT)

Více

NÁVOD K POUŽITÍ PRO KIT BRAF P.VAL600GLU

NÁVOD K POUŽITÍ PRO KIT BRAF P.VAL600GLU NÁVOD K POUŽITÍ PRO KIT BRAF P.VAL600GLU IntellMed, s.r.o. Šlechtitelů 21 78371 Olomouc IČ: 27780317 DIČ: CZ27780317-18 C 1 2 OBSAH IntellMed, s.r.o., Šlechtitelů 21, 78371 Olomouc Návod k použití pro

Více

Polymorfizmy detekované. polymorfizmů (Single Nucleotide

Polymorfizmy detekované. polymorfizmů (Single Nucleotide Polymorfizmy detekované speciálními metodami s vysokou rozlišovací schopností Stanovení jednonukleotidových polymorfizmů (Single Nucleotide Polymorphisms - SNPs) Příklad jednonukleotidových polymorfizmů

Více

Základy molekulární biologie KBC/MBIOZ

Základy molekulární biologie KBC/MBIOZ Základy molekulární biologie KBC/MBIOZ Ivo Frébort 4. Metody molekulární biologie I Izolace DNA a RNA Specifické postupy pro baktérie, kvasinky, rostlinné a živočišné tkáně U RNA nutno zabránit kontaminaci

Více

Izolace RNA. doc. RNDr. Jan Vondráček, PhD..

Izolace RNA. doc. RNDr. Jan Vondráček, PhD.. Izolace RNA doc. RNDr. Jan Vondráček, PhD.. Metodiky izolace RNA celková buněčná RNA ( total RNA) zahrnuje řadu typů RNA, které se mohou lišit svými fyzikálněchemickými vlastnostmi a tedy i nároky na jejich

Více

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. IV. Interkalační barviva a sondy

ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR. IV. Interkalační barviva a sondy ÚVOD DO KVANTITATIVNÍ REAL-TIME PCR IV. Interkalační barviva a sondy Fluorofor (F) Fluorofor většinou heterocyklická nebo polyaromatická sloučenina, při přechodu z excitovného do základního stavu fluoreskuje

Více

Příručka sady ipsogen BCR-ABL1 Mbcr IS-MMR

Příručka sady ipsogen BCR-ABL1 Mbcr IS-MMR Červenec 2016 Příručka sady ipsogen BCR-ABL1 Mbcr IS-MMR Verze 1 24 In vitro diagnostikum pro kvantitativní stanovení Pro použití s přístroji Rotor-Gene Q, Applied Biosystems, ABI PRISM a LightCycler 670723

Více

ZADÁVACÍ PODMÍNKY. Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT) Sídlo: U Nemocnice 2094/1, 128 20 Praha 2 IČ / DIČ

ZADÁVACÍ PODMÍNKY. Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT) Sídlo: U Nemocnice 2094/1, 128 20 Praha 2 IČ / DIČ VÝZVA K PODÁNÍ NABÍDEK DO VÝBĚROVÉHO ŘÍZENÍ NA ZADÁVACÍ PODMÍNKY Název zakázky: Systém Real-Time PCR 1. Identifikační údaje zadavatele Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT)

Více

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK

Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK ové technologie v analýze D A, R A a proteinů Stanislav Kmoch Centrum aplikované genomiky, Ústav dědičných metabolických poruch, 1.LFUK Motto : "The optimal health results from ensuring that the right

Více

Molekulární diagnostika

Molekulární diagnostika Molekulární diagnostika Odry 11. 11. 2010 Michal Pohludka, Ph.D. Buňka základní jednotka živé hmoty Všechny v současnosti známé buňky se vyvinuly ze společného předka, tedy buňky, která žila asi před 3,5-3,8

Více

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách

Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Detekce geneticky modifikovaných organizmů v potravinách a potravinářských surovinách Kamila Zdeňková Transgenní rostliny, tj. takové rostliny, do jejichž dědičného základu byly metodami genového inženýrství

Více

BioArray Molecular. Graham Smallridge, Immucor Prague November 2013

BioArray Molecular. Graham Smallridge, Immucor Prague November 2013 BioArray Molecular Immunohaematology Graham Smallridge, Immucor Prague November 2013 1 BioArray Solutions BioArray Solutions Ltd. Bylo založeno ve městě Warren, New Jersey, (USA) v roce 1997 skupinou vědeckých

Více

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno

Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom Mgr. Veronika Peňásová vpenasova@fnbrno.cz Laboratoř molekulární diagnostiky, OLG FN Brno Klinika dětské onkologie, FN Brno Retinoblastom (RBL) zhoubný nádor oka, pocházející z primitivních

Více

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz

Hybridizace. doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Hybridizace doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2013 Obsah přednášky 1) Způsoby provedení hybridizace 2) Hybridizace v roztoku 3) Příprava značených sond 4) Hybridizace

Více

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života?

6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? 6. Kde v DNA nalézáme rozdíly, zodpovědné za obrovskou diverzitu života? Pamatujete na to, co se objevilo v pracích Charlese Darwina a Alfreda Wallace ohledně vývoje druhů? Aby mohl mechanismus přírodního

Více

MEZILABORATORNÍ POROVNÁNÍ stanovení hla znaků asociovaných s chorobami 2016 II. KOLO ALELY VÁZANÉ S CELIAKIÍ

MEZILABORATORNÍ POROVNÁNÍ stanovení hla znaků asociovaných s chorobami 2016 II. KOLO ALELY VÁZANÉ S CELIAKIÍ stanovení hla znaků asociovaných s chorobami 6 II. KOLO Organizátor: Národní referenční laboratoř pro DNA diagnostiku Adresa: U Nemocnice, 8 Praha Zodpovědná osoba: Ing. Milena Vraná e-mail: milena.vrana@uhkt.cz

Více

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA

Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti. Translace, techniky práce s DNA Evropský sociální fond Praha & EU: Investujeme do vaší budoucnosti Translace, techniky práce s DNA Translace překlad z jazyka nukleotidů do jazyka aminokyselin dá se rozdělit na 5 kroků aktivace aminokyslin

Více

NRAS StripAssay. Kat. číslo 5-610. 20 testů 2-8 C

NRAS StripAssay. Kat. číslo 5-610. 20 testů 2-8 C NRAS StripAssay Kat. číslo 5-610 20 testů 2-8 C Popis stripu: Pracovní postup 1. Izolace DNA Pro izolaci DNA musí být použita vhodná metoda vzhledem k typu tkáně vzorku. Pro doporučení vhodné metody kontaktujte

Více

Metody molekulární biologie

Metody molekulární biologie Metody molekulární biologie 1. Základní metody molekulární biologie A. Izolace nukleových kyselin Metody využívající různé rozpustnosti Metody adsorpční Izolace RNA B. Centrifugační techniky o Princip

Více

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin

Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Mendelova univerzita v Brně Agronomická fakulta Ústav biologie rostlin Inovace laboratorních úloh genetických předmětů metodikami pracujícími s ribonukleovými kyselinami pšenice Metodické návody pro laboratorní

Více

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR

Analýza DNA. Co zjišťujeme u DNA DNA. PCR polymerase chain reaction. Princip PCR PRINCIP METODY PCR o zjišťujeme u DN nalýza DN enetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní mutace,

Více

Univerzita Pardubice Chemicko-technologická fakulta Katedra analytické chemie

Univerzita Pardubice Chemicko-technologická fakulta Katedra analytické chemie Univerzita Pardubice Chemicko-technologická fakulta Katedra analytické chemie 12. licenční studium PYTHAGORAS Statistické zpracování dat Kalibrace a limity její přesnosti Semestrální práce 2009 RNDr. Markéta

Více

ÚLOHA C Klonování PCR produktu do plasmidu

ÚLOHA C Klonování PCR produktu do plasmidu Jméno a učo: Datum: ÚLOHA C Klonování PCR produktu do plasmidu TEORETICKÝ ÚVOD Při klonování PCR produktů do plasmidů se využívá vlastnosti Taq polymerasy, a jiných non-proofreading polymeras, přidávat

Více

ZÁKLADNÍ PRINCIPY A VYUŽITÍ KVANTITATIVNÍ PCR S OHLEDEM NA ONKOLOGICKOU DIAGNOSTIKU

ZÁKLADNÍ PRINCIPY A VYUŽITÍ KVANTITATIVNÍ PCR S OHLEDEM NA ONKOLOGICKOU DIAGNOSTIKU Masarykova univerzita v Brně Přírodovědecká fakulta Katedra Biochemie ZÁKLADNÍ PRINCIPY A VYUŽITÍ KVANTITATIVNÍ PCR S OHLEDEM NA ONKOLOGICKOU DIAGNOSTIKU Bakalářská práce Magdaléna Dvořáková Brno 2007

Více

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C

α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C α-globin StripAssay Kat. číslo 4-160 10 testů 2-8 C Popis stripů: Pracovní postup Izolace DNA Doporučujeme použít následující kit pro izolaci DNA z plné krve nebo jiných typů vzorků: Spin Micro DNA Extraction

Více

Aplikace molekulárně biologických postupů v časné detekci sepse

Aplikace molekulárně biologických postupů v časné detekci sepse Aplikace molekulárně biologických postupů v časné detekci sepse Mgr. Jana Ždychová, Ph.D. IKEM PLM - LLG Sepse je častou příčinou úmrtí během hospitalizace. Včasné nasazení odpovídající ATB terapie je

Více

nastavení real-time PCR cykleru CFX 96 Real-Time System

nastavení real-time PCR cykleru CFX 96 Real-Time System Verze: 1.2 Datum poslední revize: 24.9.2014 nastavení real-time PCR cykleru CFX 96 Real-Time System (BioRad) generi biotech OBSAH 1. Spuštění již existujícího či nastavení nového teplotního profilu...3

Více

ZADÁVACÍ PODMÍNKY. Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT) Sídlo: U Nemocnice 2094/1, 128 20 Praha 2 IČ / DIČ:

ZADÁVACÍ PODMÍNKY. Název zadavatele: ÚSTAV HEMATOLOGIE A KREVNÍ TRANSFUZE V PRAZE (ÚHKT) Sídlo: U Nemocnice 2094/1, 128 20 Praha 2 IČ / DIČ: VÝZVA K PODÁNÍ NABÍDEK DO VÝBĚROVÉHO ŘÍZENÍ NA VEŘEJNOU ZAKÁZKU MALÉHO ROZSAHU ZADÁVACÍ PODMÍNKY Název zakázky: Systém pro Real-Time PCR 1. Identifikační údaje zadavatele Název zadavatele: ÚSTAV HEMATOLOGIE

Více

1. Real time PCR se softwarem a příslušenstvím pro rutinní použití

1. Real time PCR se softwarem a příslušenstvím pro rutinní použití Příloha č. 15 Zadávacích podmínek Mikrobiologické přístrojové vybavení Technická specifikace předmětu nabízeného plnění bude tvořit Přílohu č. 1 Kupní smlouvy Termín dodání předmětu kupní smlouvy po podpisu

Více

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta Ústav experimentální biologie Oddělení genetiky a molekulární biologie Interakce proteinu p53 s genomovou DNA v kontextu chromatinu glioblastoma buněk

Více

Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE

Laboratorní workshop s teoreticko praktickou ukázkou molekulárně biologických technik ve spolupráci s firmou ROCHE BiochemNet vytvoření sítě pro podporu spolupráce biomedicínských pracovišť a zvýšení uplatnitelnosti absolventů biochemických oborů v praxi Laboratorní workshop s teoreticko praktickou ukázkou molekulárně

Více

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky.

Příprava vektoru IZOLACE PLASMIDU ALKALICKÁ LYZE, KOLONKOVÁ IZOLACE DNA GELOVÁ ELEKTROFORÉZA RESTRIKČNÍ ŠTĚPENÍ. E. coli. lyze buňky. Příprava vektoru IZOLCE PLSMIDU LKLICKÁ LYZE, KOLONKOVÁ IZOLCE DN E. coli plasmidová DN proteiny proteiny + + vysrážená plasmidová lyze buňky + snížení ph chromosomální DN centrifugace DN chromosomální

Více

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné:

2. Z následujících tvrzení, týkajících se prokaryotické buňky, vyberte správné: Výběrové otázky: 1. Součástí všech prokaryotických buněk je: a) DNA, plazmidy b) plazmidy, mitochondrie c) plazmidy, ribozomy d) mitochondrie, endoplazmatické retikulum 2. Z následujících tvrzení, týkajících

Více

IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek

IZOLACE, SEPARACE A DETEKCE PROTEINŮ I. Vlasta Němcová, Michael Jelínek, Jan Šrámek IZOLACE, SEPARACE A DETEKCE PROTEINŮ I Vlasta Němcová, Michael Jelínek, Jan Šrámek Studium aktinu, mikrofilamentární složky cytoskeletu pomocí dvou metod: detekce přímo v buňkách - fluorescenční barvení

Více

Nukleové kyseliny Replikace Transkripce translace

Nukleové kyseliny Replikace Transkripce translace Nukleové kyseliny Replikace Transkripce translace Figure 4-3 Molecular Biology of the Cell ( Garland Science 2008) Figure 4-4 Molecular Biology of the Cell ( Garland Science 2008) Figure 4-5 Molecular

Více

Systém pro kvantitativní multiplex amplifikaci DNA PLEXAMP KIT. PXT5 Detekce genomové přestavby genu BRCA2 NÁVOD K POUŽITÍ

Systém pro kvantitativní multiplex amplifikaci DNA PLEXAMP KIT. PXT5 Detekce genomové přestavby genu BRCA2 NÁVOD K POUŽITÍ Systém pro kvantitativní multiplex amplifikaci DNA PLEXAMP KIT PXT5 Detekce genomové přestavby genu BRCA2 NÁVOD K POUŽITÍ REFERENCE: PXT5-01.01.25: 25 testů PXT5-01.01.50: 50 testů PXT5-01.01.100: 100

Více

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014

Molekulárně biologické metody v mikrobiologii. Mgr. Martina Sittová Jaro 2014 Molekulárně biologické metody v mikrobiologii Mgr. Martina Sittová Jaro 2014 Harmonogram 1. den Izolace DNA 2. den Měření koncentrace DNA spektrofotometricky, real-time PCR 3. den Elektroforéza Molekulární

Více

KUPNÍ SMLOUVA. dle 409 a násl. zákona č. 513/1991 Sb., obchodního zákoníku, ve znění pozdějších předpisů (dále jen obchodní zákoník ) Smluvní strany:

KUPNÍ SMLOUVA. dle 409 a násl. zákona č. 513/1991 Sb., obchodního zákoníku, ve znění pozdějších předpisů (dále jen obchodní zákoník ) Smluvní strany: KUPNÍ SMLOUVA dle 409 a násl. zákona č. 513/1991 Sb., obchodního zákoníku, ve znění pozdějších předpisů (dále jen obchodní zákoník ) Smluvní strany: prodávající:... zapsaná v obchodním rejstříku vedeném...,

Více

PP Master Mixy... 13 PPP Master Mix 14 Plain PP Master Mix 15 Combi PPP Master Mix 16 new Plain Combi PP Master Mix 17

PP Master Mixy... 13 PPP Master Mix 14 Plain PP Master Mix 15 Combi PPP Master Mix 16 new Plain Combi PP Master Mix 17 Obsah DNA polymerázy pro PCR a pufry............................... 5 Taq DNA polymeráza 6 Taq DNA polymeráza Unis 7 TaqPurple DNA polymeráza 8 Taq DNA polymeráza 1.1 9 Combi Taq DNA polymeráza 10 LA DNA

Více

Uživatelská příručka

Uživatelská příručka PGM Barcoding Set 1-8 Navrženo pro PGM ION-TORRENT KÓD PRODUKTU: 2001 (1-8) BALEN9: 32 testů Uživatelská příručka Rev02.2015 Str. 1 Rejstřík 1. POUŽITÍ VÝROBKU 3 2. OBSAH KITU 4 3. SKLADOVÁNÍ 4 4. STABILITA

Více

Izolace, klonování a analýza DNA

Izolace, klonování a analýza DNA Izolace, klonování a analýza DNA Ing. Pavel Kotrba, Ph.D., Ing. Zdeněk Knejzlík, Ph.D., Ing. Zdeněk Chodora Ústav biochemie a mikrobiologie, VŠCHT Praha HTpavel.kotrba@vscht.czTH, HTzdenek.knejzlik@vscht.czTH,

Více

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC

Co zjišťujeme u DNA ACGGTCGACTGCGATGAACTCCC ACGGTCGACTGCGATCAACTCCC ACGGTCGACTGCGATTTGAACTCCC Analýza DNA Co zjišťujeme u DNA Genetickou podstatu konkrétních proteinů Mutace bodové (sekvenční delece nebo inzerce nukleotidů), chromosomové aberace (numerické, strukturální) Polymorfismy konkrétní

Více

Návod k použití CRC RAScan Combination Kit

Návod k použití CRC RAScan Combination Kit Návod k použití CRC RAScan Combination Kit Souprava SURVEYOR Scan KRAS a NRAS Exons 2, 3 & 4 CE IVD se systémy Tento návod k použití si důkladně přečtěte před použitím tohoto produktu. Uschovejte si tento

Více

Real Time-PCR - nástroj pro detekci a kvantifikaci mikroorganismů. Bc. Jitka Bakalová

Real Time-PCR - nástroj pro detekci a kvantifikaci mikroorganismů. Bc. Jitka Bakalová Real Time-PCR - nástroj pro detekci a kvantifikaci mikroorganismů Bc. Jitka Bakalová Diplomová práce 2017 1) zákon č. 111/1998 Sb. o vysokých školách a o změně a doplnění dalších zákonů (zákon o vysokých

Více

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně

1. Definice a historie oboru molekulární medicína. 3. Základní laboratorní techniky v molekulární medicíně Obsah Předmluvy 1. Definice a historie oboru molekulární medicína 1.1. Historie molekulární medicíny 2. Základní principy molekulární biologie 2.1. Historie molekulární biologie 2.2. DNA a chromozomy 2.3.

Více

~ 10 base pairs (3.4 nm)

~ 10 base pairs (3.4 nm) Metody molekulární biologie 1. Manipulace s DNA - mutace, delece, - genomová DNA x cdna - restrikční endonukleasy a enzymy modifikující DNA - DNA a RNA polymerasy - syntetické oligonukleotidy (primery

Více

Využití metody Real Time-PCR v detekci genů pro dekarboxylační enzymy u vybraných bakterií. Bc. Kristýna Maršálková

Využití metody Real Time-PCR v detekci genů pro dekarboxylační enzymy u vybraných bakterií. Bc. Kristýna Maršálková Využití metody Real Time-PCR v detekci genů pro dekarboxylační enzymy u vybraných bakterií Bc. Kristýna Maršálková Diplomová práce 2014 ABSTRAKT Předkládaná diplomová práce se zabývá zavedením metody

Více

Kras XL StripAssay. Kat. číslo 5-680. 20 testů 2-8 C

Kras XL StripAssay. Kat. číslo 5-680. 20 testů 2-8 C Kras XL StripAssay Kat. číslo 5-680 20 testů 2-8 C Popis stripu: Pracovní postup 1. Izolace DNA Musí být použity vhodné metody extrakce DNA, v závislosti na typu vzorku, který má být vyšetřován. Doporučení

Více

Mikročipy v mikrobiologii

Mikročipy v mikrobiologii Mikročipy v mikrobiologii doc. RNDr. Milan Bartoš, Ph.D. bartosm@vfu.cz Přírodovědecká fakulta MU, 2014 Obsah přednášky 1) Charakteristika biočipů, DNA microarrays a DNA chip 2) Výroba čipů, charakteristika

Více

TESTOVÁNÍ GMO Praktikum fyziologie rostlin

TESTOVÁNÍ GMO Praktikum fyziologie rostlin Teoretický úvod: TESTOVÁNÍ GMO Praktikum fyziologie rostlin 1 Teoretický úvod: TESTOVÁNÍ GMO Obecně na úvod Určitě jste už slyšeli pojem geneticky modifikovaný organismus (GMO). Úprava vlastností přirozeně

Více